Localized Co-delivery of Doxorubicin, Cisplatin, and Methotrexate by

Research Article www.acsami.org

Localized Co-delivery of Doxorubicin, Cisplatin, and Methotrexate by Thermosensitive Hydrogels for Enhanced Osteosarcoma Treatment Hecheng Ma,†,‡ Chaoliang He,*,† Yilong Cheng,† Zhiming Yang,‡ Junting Zang,‡ Jianguo Liu,‡ and Xuesi Chen† †

Key Laboratory of Polymer Ecomaterials, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022, People’s Republic of China ‡ Department of Orthopaedics, The First Hospital of Jilin University, Changchun 130021, People’s Republic of China S Supporting Information *

ABSTRACT: Localized cancer treatments with combination drugs have recently emerged as crucial approaches for effective inhibition of tumor growth and reoccurrence. In this study, we present a new strategy for the osteosarcoma treatment by localized co-delivery of multiple drugs, including doxorubicin (DOX), cisplatin (CDDP) and methotraxate (MTX), using thermosensitive PLGA−PEG−PLGA hydrogels. The release profiles of the drugs from the hydrogels were investigated in vitro. It was found that the multidrug coloaded hydrogels exhibited synergistic effects on cytotoxicity against osteosarcoma Saos-2 and MG-63 cells in vitro. After a single peritumoral injection of the drug-loaded hydrogels into nude mice bearing human osteosarcoma Saos-2 xenografts, the hydrogels coloaded with DOX, CDDP, and MTX displayed the highest tumor suppression efficacy in vivo for up to 16 days, as well as led to enhanced tumor apoptosis and increased regulation of the expressions of apoptosis-related genes. Moreover, the monitoring on the mice body change and the ex vivo histological analysis of the key organs indicated that the localized treatments caused less systemic toxicity and no obvious damage to the normal organs. Therefore, the approach of localized co-delivery of DOX, CDDP, and MTX by the thermosensitive hydrogels may be a promising approach for enhanced osteosarcoma treatment. KEYWORDS: injectable hydrogels, localized delivery, multidrug co-delivery, synergistic therapy, combination therapy, osteosarcoma treatment osteosarcoma,14,15 which exhibits cytotoxicity by intercalating DNA and inhibiting the synthesis of DNA, RNA, and proteins.16,17 CDDP has also been shown to inhibit various types of tumors including osteosarcoma, through cross-linking DNA in several different ways to interfere with the mitosis and promote the apoptosis. MTX is reported to inhibit dihydrofolate reductase, leading to the tetrahydrofolate deficiency and inhibition of the synthesis of DNA, RNA, and proteins. MTX shows high toxicity against rapidly dividing cells and suppresses the growth and proliferation of osteosarcoma.18 Moreover, clinical evidence has proven the enhanced antitumor effects by the systemic administration of free DOX, CDDP, and MTX during the osteosarcoma treatment.11 However, the systemic chemotherapy by intravenous or oral administration usually leads to both short-term and long-term adverse effects.19 Due to the systemic distribution of the chemotherapeutic drugs and their dose-related toxicity, the multiagent chemotherapy regimens usually cause serious

1. INTRODUCTION Osteosarcoma remains the most common malignant bone cancer in children and adolescents.1 The annual incidence rate is 2−30 per million in Europe,2 and about 400−1000 new cases of osteosarcoma are diagnosed in United States each year.3 The common primary sites of osteosarcoma include the distal femur, proximal tibia, and proximal humerus.4,5 Moreover, osteosarcoma tends to produce a local or distant recurrence6 and early systemic metastases,4,7 resulting in a rather poor prognosis.6 Currently, the standard clinical treatments of osteosarcoma include surgery and systemic multiagent chemotherapy.8,9 Intravenous or oral drugs, with a combination of different chemotherapeutic drugs, are administered to patients both before and after surgery.10−12 The long-term survival of the patients has been enhanced to 60−70%, compared to the low survival rate (∼10%) of the patients who suffered limb amputation several decades ago.8 The current regimens applied for clinical osteosarcoma treatments are generally based on three chemotherapeutic drugs, doxorubicin (DOX), cisplatin (CDDP), and high-dose methotrexate (MTX).5,11,13 DOX shows efficacy in the treatments of a wide range of human cancers including © XXXX American Chemical Society

Received: February 15, 2015 Accepted: November 17, 2015

A

DOI: 10.1021/acsami.5b09112 ACS Appl. Mater. Interfaces XXXX, XXX, XXX−XXX

Research Article

ACS Applied Materials & Interfaces

Figure 1. Schematic illustration for the localized, sustained co-delivery of DOX, CDDP, and MTX using injectable hydrogels for synergistic tumor treatment.

adverse effects, such as cardiotoxity,20 nephrotoxicity, ulcerative stomatitis, and myelo suppression.21,22 It is reported that over 30% of osteosarcoma patients are either resistant to current chemotherapy regimens or suffer from serious life-threatening complications, and eventually succumb to metastases and death.23 Recently, increasing attention has been paid to localized drug delivery systems for cancer chemotherapy, which can facilitate drug release at target pathological sites with relatively high drug concentration and less nonspecific distribution of drugs in normal organs.24 As a type of emerging localized delivery systems, injectable hydrogels have attracted considerable interest due to their unique advantages, including mild gelation process, minimally invasive treatment procedure, appropriate biodegradability and a sustained drug release manner.25−28 Thermosensitive injectable hydrogels are a type of hydrogels that exist as liquid polymer solutions at a lower temperature, such as room temperature, but transform into free-standing hydrogels at the physiological temperature.25−27 Therefore, drugs may be mixed easily with the polymer solutions at a lower temperature, while drug-loaded hydrogels can be formed upon injection in vivo, rendering the advantages in practical applications. Very recently, various injectable hydrogels have been developed as drug depots for localized co-delivery of drugs and genes for treating different types of cancers.26,29−41 For osteosarcoma treatments, the pioneer studies by Dass et al. have investigated the anticancer efficacies of co-delivery of DOX and anticancer genes by thermosensitive hydrogels.30,38 Nevertheless, to-date, the study on localized co-delivery of multiple chemotherapeutic drugs by using injectable hydrogels for osteosarcoma treatment has been rarely reported. In this study, we present the first example of localized codelivery of DOX, CDDP and MTX by using an injectable thermosensitive hydrogel for osteosarcoma treatment (Figure 1). The thermosensitive hydrogels of this study were based on the poly(L-lactide-co-glycolide)-poly(ethylene glycol)-poly(Llactide-co-glycolide) triblock copolymer (PLGA−PEG− PLGA), the components of which have been approved by the U.S. Food and Drug Administration (FDA) for in vivo applications.42 The sol−gel phase transition and gelation time of the PLGA−PEG−PLGA aqueous solutions were studied. The in vitro drug release behaviors of the drug-loaded hydrogels were investigated. The potential synergistic effects of the multidrug coloaded hydrogels on the cytotoxicities against osteosarcoma Saos-2 and MG-63 cells were tested in

vitro. Moreover, the in vivo antitumor efficacy of the multidrug coloaded hydrogels was investigated by peritumoral injection of the drug-containing hydrogels into nude mice bearing human osteosarcoma Saos-2 xenografts. Additionally, the systemic toxic side effects of the localized treatments were evaluated by ex vivo histological analysis of the major organs of the nude mice.

2. EXPERIMENTAL SECTION 2.1. Materials. PEG (Mn 1000), tin(II) 2-ethylhexanoate (Sn(Oct)2) and 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were bought from Sigma-Aldrich. L-Lactide (LLA) and glycolide (GA) were purchased from Purac (The Netherlands). Doxorubicin hydrochloride (DOX·HCl) was bought from Hisun Pharmaceutical (China), and CDDP and MTX were purchased from Sigma-Aldrich (USA). 2.2. General Characterization. The chemical structure and composition of the copolymer was analyzed by 1H NMR using a 300 MHz NMR spectrometer (Bruker DMX300). The molecular weight and polydispersity index (PDI) of the copolymer were measured by gel permeation chromatography (GPC, Waters HPLC pump), and chloroform was used as the eluent at a flow-rate of 1.0 mL/min at 35 °C. The molecular weight was evaluated according to the calibration curve generated from a series of monodispersed polystyrenes. 2.3. Synthesis of PLGA−PEG−PLGA Triblock Copolymer. The PLGA−PEG−PLGA triblock copolymer was prepared through the ring-opening copolymerization (ROP) of LLA and GA with PEG (Mn 1000) and Sn(Oct)2 as the macroinitiator and catalyst, respectively. Briefly, PEG, LLA, and GA were dissolved in anhydrous toluene. The weight ratio of (LLA+GA)/PEG was 2.5:1, and the molar ratio of LLA/GA was 2:1. The reaction was allowed to proceed for 24 h at 130 °C under nitrogen atmosphere. The resulting copolymer was isolated by pouring the solution into diethyl ether, and collected through filtration. The crude product was further purified by repeated precipitation and dialysis against deionized water and was then collected by lyophilization. The triblock copolymer was analyzed by 1 H NMR and GPC to determine the chemical structure and molecular weight. 2.4. Sol−Gel Phase Transition and Gelation Time. The sol−gel phase transitions of PLGA−PEG−PLGA solutions were tested by a vial inverting method. First, PLGA−PEG−PLGA was dissolved in water in an ice bath at different concentrations. The polymer solutions (∼0.5 mL for each sample) was then put into the vials (inner diameter = 11 mm). The sol−gel phase transition was monitored as the temperature increased gradually with the temperature interval of 2 °C per step. After incubation of the vials at each temperature for 10 min, the status of the samples was checked. A gel state was recorded if the sample in the inverted vial did not flow within 30 s. B


Research Article

ACS Applied Materials & Interfaces Table 1. Sequences of Primers Used for Real-Time PCR gene

gene ID

forward primer

reverse primer

β-actin Bcl-2 BAX Caspase-3

BC002409 NM_000633.2 NM_004324.3 NM_004346.3

CTGGGACGACATGGAGAAAA ATGTGTGTGGAGAGCGTCAAC AAGCTGAGCGAGTGTCTCAAG ATCACAGCAAAAGGAGCAGTTT

AAGGAAGGCTGGAAGAGTGC AGAGACAGCCAGGAGAAATCAAAC CAAAGTAGAAAAGGGCGACAAC ACACCACTGTCTGTCTCAATGC

The gelation time of PLGA−PEG−PLGA solutions at different polymer concentrations were tested at 37 °C. The PLGA−PEG− PLGA aqueous solutions in ice-bath were transferred to an incubator at 37 °C immediately before the measurement, and the time for gel formation was recorded by the vial inverting method. 2.5. Rheological Test. The variation of mechanical property of PLGA−PEG−PLGA aqueous solution in response to temperature change was tested by a rheometer (MCR 301, Anton Paar) in oscillatory mode with the samples locating between parallel plates. The diameter of the plate was 25 mm, and the gap was set at 0.5 mm. The strain and frequency were fixed at 1% and 1 Hz, respectively. 2.6. In Vitro Drug Release. The drug-containing PLGA−PEG− PLGA solutions were prepared by dissolving the drug (DOX, CDDP or MTX) in 20 wt % PLGA−PEG−PLGA solution with each drug concentration of 1 mg/mL in an ice−water bath. Then, the drugcontaining polymer solutions (∼0.5 mL for each sample) were transferred to the vials (inner diameter = 16 mm), and the drug-loaded hydrogels were formed after incubating the vials at 37 °C for 10 min. Next, 3 mL of phosphate buffer saline (PBS, pH 7.4) was added to the top of the formed hydrogels as the release medium. At predetermined time intervals, 2.0 mL of release medium was collected periodically and the vials were refilled with an equal volume of fresh medium. The amount of DOX in the release medium was measured by fluorescence measurement (λex = 480 nm), the amount of MTX was tested by UV (λ = 328 nm) spectrometry and the amount of CDDP in the release medium was tested by ICP-MS (Thermo XSERIES 2). Each data point was performed in triplicate. 2.7. In Vitro Antiproliferation Efficacy of PLGA−PEG−PLGA Hydrogels Containing Single Drug or Multidrugs against Osteosarcoma Cells. The in vitro cytotoxicities of the PLGA− PEG−PLGA triblock copolymer against both a normal cell line (L929) and osteosarcoma cell lines (Saos-2 and MG-63) were evaluated by MTT assay, according to the previous procedure.38 Cell viability (%) was estimated by eq 1: cell viability (%) = (A sam /Acon ) × 100

CI =

DDOX DCDDP DMTX + + (D0)DOX (D0)CDDP (D0)MTX

(2)

where (D0 )DOX, (D0 )CDDP, and (D0 )MTX represent the drug concentration of the hydrogel containing DOX, CDDP, or MTX, respectively, alone at a certain cell inhibition efficiency (e.g., IC50 and IC60), while DDOX, DCDDP, and DMTX are the concentration of DOX, CDDP, or MTX, respectively, in the hydrogel containing multiple drugs at the given inhibition efficiency. The weight ratio of DOX/ CDDP/MTX in the multidrug coloaded hydrogels was fixed at 5:3:10 for the tests of synergistic cytotoxicities. The CI values 1 represent synergism, additivity, and antagonism, respectively. 2.8. Analysis of Apoptosis-Related Genes in Osteosarcoma Cells after Treating with Drug-Loaded Hydrogels in Vitro. The expressions of apoptosis-related genes, including Bcl-2, BAX and Caspase-3, in osteosarcoma Saos-2 and MG-63 cells treated with the hydrogels containing single or multiple drugs were evaluated by realtime PCR. First, the cells were treated with the drug-loaded hydrogels for 24 h according to the procedure in section 2.7. The total RNA of osteosarcoma cells was isolated by Trizol reagent (Invitrogen). The RNA was extracted and then converted into a complementary DNA by using the reverse transcription kit (Takara, Japan). Quantitative realtime PCR was carried out on a Mxpro3005 system (Stratagene, La Jolla, CA) with a SYBR Premix Ex Taq kit (Takara, Japan). Specific primers used for the apoptosis-related genes and the housekeeping gene β-actin were designed, as shown in Table 1. Gene expression levels relative to the housekeeping gene β-actin were estimated by the ΔCt method. 2.9. In Vivo Antitumor Efficacy of Drug-Loaded Hydrogels by Local Treatment. The in vivo tumor inhibition efficacy of the PLGA−PEG−PLGA hydrogels loaded with single drug or multidrugs was tested with 5 week old male BALB/c nude mice bearing human osteosarcoma Saos-2 xenografts. The cell suspension of 5.0 × 106 Saos-2 cells in 0.1 mL PBS was inoculated subcutaneously into each nude mouse (19−20 g). As the tumor volume was ∼50 mm3 after 1 week, the mice were split randomly into 8 groups with 6 mice in each group. Then, the tumor-bearing mice were subjected to treatment with single peritumoral injection of 100 μL of drug solutions or 20 wt % drug-loaded hydrogels. The recipes include normal saline, PLGA− PEG−PLGA hydrogel only (Gel), free DOX solution in PBS (DOX), mixed solution of DOX and CDDP (DOX+CDDP), mixed solution of DOX, CDDP and MTX (DOX+CDDP+MTX), DOX-loaded hydrogel (Gel+DOX), DOX and CDDP coloaded hydrogel (Gel+DOX +CDDP), as well as DOX, CDDP and MTX coloaded hydrogel (Gel +DOX+CDDP+MTX). The concentrations of DOX, CDDP and MTX were 5.0, 3.0, and 10 mg/kg mouse weight, respectively, if any drug was used in the treatment. The antitumor efficacy and safety evaluation were measured by monitoring the tumor volume and body weight of mice every 2 days during the period of 16 days. The tumor volume (V) was evaluated according to eq 3:

(1)

where Asam and Acon are the absorbency values for the experimental sample and control wells, respectively, which were detected by a microplate reader (Biorad 680). Additionally, the in vitro cytotoxicities of the hydrogels loaded with single drug or multidrugs against Saos-2 and MG-63 cells were tested through MTT assay. In brief, after seeding the cells in 24-well plates at a density of 50 000 cells per well, the cells were allowed to grow for 24 h in complete Dulbecco’s modified Eagle medium (DMEM; 1 mL per well). After removing the culture media, the 20 wt % hydrogel precursor solutions containing single or multiple drugs were added to the wells (10 μL for each well). The drug-loaded hydrogels were formed by incubating the plates at 37 °C for 5 min, and then fresh DMEM was added into the wells (1 mL for each well). The cells were incubated with the drug-loaded hydrogels for another 48 h. Finally, MTT assay was performed and the cell viability was calculated according to eq 1. The inhibitory concentration (ICx) of hydrogel containing single drug or multiple drugs was evaluated by the dose−effect curves. The synergistic, additive or antagonistic effects of the multiple drugs (i.e., DOX, CDDP, and MTX) on the cytotoxicity against Saos-2 and MG63 cells were analyzed by calculating the combination index (CI). The CI value for a certain inhibitory concentration (ICx) was estimated according to the Berenbaum method (eq 2):43,44

V = L × W 2/2

(3)

where L and W represent the longest and shortest diameters (in mm) of the tumor mass, respectively. After the mice were sacrificed at the end of the experiment, the tumors and organs in the mice were collected, and further analyses were carried out. 2.10. Ex Vivo Analysis of Tumor Apoptosis. The apoptosis of the tumors following the treatments with drug solutions or drugloaded hydrogels was assessed by real-time PCR and TUNEL assay, respectively. C


Research Article

ACS Applied Materials & Interfaces For the analysis of the apoptosis-related genes in the tumors by realtime PCR, the tumor masses isolated from the mice were frozen and grinded in liquid nitrogen. Total RNA of 100 mg tumor mass was isolated using Trizol reagent (Invitrogen) according to the protocol. The reverse transcription and the real-time PCR were carried out similarly according to the procedure in section 2.8. Additionally, the apoptosis of tumor tissues were visualized by TUNEL assay. The tumor masses dissected from the mice were sectioned, and terminal nucleotidyltransferase-mediated nick end labeling (TUNEL) assay was then performed according to the manufacturer’s protocol (Roche, Switzerland). The nicked DNA ends for tumor sections were labeled. The cell apoptosis in tumor tissues was visualized by a fluorescence microscopy (Carl Zeiss). 2.11. Histology Analysis. At the end of the animal test, the mice were sacrificed, and the major organs of the mice were collected and fixed in 4% (w/v) paraformaldehyde. Histological analysis was carried out by staining the tissue sections with hematoxylin/eosin (H&E) to assess the organ damage after all the treatments. 2.12. Animal Procedure. The animal tests were performed according to the guide for the care and use of laboratory animals, provided by Jilin University, China, and the procedure was approved by the local Animal Ethics Committee. 2.13. Statistical Analysis. The statistical differences between the control and experimental groups were analyzed according to the paired Student’s t-test. Statistically significances were presented when the p value was less than 0.05. The data were given as mean ± standard deviation.

Figure 2. (A) Sol−gel phase transition of the PLGA−PEG−PLGA aqueous solutions with increasing temperature. (B) The complex viscosity of the PLGA−PEG−PLGA aqueous solution as the increase in temperature. (C) Gelation time of the PLGA−PEG−PLGA aqueous solutions with various concentrations at 37 °C.

variation of mechanical property of the hydrogel in response to temperature change was tested by rheology. As presented in Figure 2B, the complex viscosity of the PLGA−PEG−PLGA aqueous solution exhibited an abrupt enhancement as the temperature increased to over 10 °C, indicating a sol−gel phase transition. By contrast, the complex viscosity was found to decrease to less than 10 Pa·S after the temperature further increased to over 40 °C. This confirmed the occurrence of the gel-precipitation transition. Moreover, the gelation time of the PLGA−PEG−PLGA aqueous solution was measured at 37 °C. It was found that the gelation time of the PLGA−PEG−PLGA aqueous solution was highly dependent on the polymer concentration. With increasing the polymer concentration from 15 to 25 wt %, the gelation time decreased dramatically from ∼225 to 10 s. This may be due to the fact that the increase in polymer concentration promoted the gel formation, which was consistent with the effect of polymer concentration on the sol−gel phase transition.25−27 3.3. In Vitro Drug Release from PLGA−PEG−PLGA Hydrogels. Due to its appropriate sol−gel transition temperature and gelation time, the 20 wt % PLGA−PEG−PLGA hydrogel was used for drug loading and release in the further studies.37,45 The drug release behaviors of the 20 wt % PLGA− PEG−PLGA hydrogels containing different drugs (DOX, CDDP or MTX) were evaluated in vitro. To prepare the drug-loaded hydrogels, the drugs were first dissolved in the 20 wt % PLGA−PEG−PLGA solutions in PBS at 0−4 °C, the drug-loaded hydrogels were formed by incubation of the drugcontaining polymer solutions at 37 °C for 10 min. As shown in Figure 3A,B, the release profiles of DOX and MTX from the hydrogels at 37 °C indicated an initial burst release in the first 2 days, followed by a sustained drug release profile over 10 days. The two-phase drug release behaviors suggested a fast drug diffusion at the initial stage and the successive diffusion/ degradation-mediated process.37,46,47 Notably, a relatively fast CDDP release profile was observed, as shown in Figure 3 (C). More than 70% of CDDP was released from the hydrogels in 2 days. The fast CDDP release from the hydrogels in vitro may be attributed to the enhanced solubility of CDDP, reduced

3. RESULTS AND DISCUSSION 3.1. Synthesis and Characterization of PLGA−PEG− PLGA Triblock Copolymer. The PLGA−PEG−PLGA triblock copolymer was synthesized by the ring-opening polymerization of L-lactide (LLA) and glycolide (GA) using PEG and Sn(Oct)2 as the macroinitiator and catalyst, respectively (Scheme S1, Supporting Information). The resulting copolymer was analyzed by 1H NMR and GPC. As shown in Figure S1 (Supporting Information), the resonance peaks were well assigned to the protons of PEG, LA and GA units. The molecular weight of the copolymer calculated from 1H NMR was 3500, and the molar ratio of LA to GA was 1.8:1. Additionally, the GPC measurement indicated a unimodal distribution of the resulting copolymer with the molecular weight and polydispersity index (PDI) of 7800 and 1.34, respectively. The 1H NMR and GPC results indicated the successful synthesis of the PLGA−PEG−PLGA triblock copolymer. 3.2. Physical Properties. The sol−gel phase transition in response to the increase in temperature from 5 °C to over 60 °C was tested by the tube inverting approach. As shown in Figure 2A, at the initial stage of temperature increase, the 15− 25 wt % PLGA−PEG−PLGA aqueous solutions showed a sol− gel phase transition. It has been well documented that the thermo-induced gelation of amphiphilic PLGA−PEG−PLGA was attributed to the micellar aggregation caused by the augment of the hydrophobic interaction between the PLGA segments and the partial dehydration of the PEG chains.25−27 The sol−gel transition temperature declined obviously with the increase in the polymer concentration. The dependence of the sol−gel transition temperature on the polymer concentration should be attributed to the fact that a higher polymer concentration facilitated the formation of the micellar aggregation network.25−27 Moreover, after the gel formation, further increase in the temperature led to a gel-precipitation transition, due to breakage of the micellar aggregation network caused by the further dehydration of the PEG shells. The D


Research Article


Figure 3. In vitro drug release profiles of 20 wt % PLGA−PEG− PLGA hydrogels containing (A) DOX, (B) MTX, or (C) CDDP with the drug concentration of 1 mg/mL in PBS at 37 °C. Data are presented as the average ± standard deviation (n = 3).

Figure 4. Cytotoxicities of the hydrogels containing single drug or multiple drugs against (A) Saos-2 cells or (B) MG-63 cells, after incubation for 48 h. (C) CI values for the DOX, CDDP and MTX coloaded hydrogel against Saos-2 and MG-63 cells.

substitution activity of Cl− ions in CDDP and inhibited hydrate formation in the release medium (PBS) containing NaCl (∼0.9 wt %).48 3.4. In Vitro Cytotoxicities of Drug-Loaded Hydrogels against Osteosarcoma Saos-2 and MG-63 Cells. The in vitro cytocompatibilities of the PLGA−PEG−PLGA triblock copolymer against a normal cell line (L929 cells) and osteosarcoma cells (Saos-2 and MG-63 cells) were tested by MTT assay. It was observed that the Saos-2, MG-63 and L929 cells exposure to the copolymer solutions remained over 90% viable at polymer concentrations up to 6 mg/mL (Figure S2, Supporting Information). This implied that the PLGA−PEG− PLGA triblock copolymer exhibited no detectable cytotoxicity and good cytocompatibility. Furthermore, the in vitro antiproliferation efficacy of the hydrogels containing single drug or multiple drugs against Saos2 and MG-63 cells was evaluated by MTT assay, as shown in Figure 4A,B. The potential synergistic, additive or antagonistic effect of the multidrug coloaded hydrogel on the cytotoxicity against osteosarcoma Saos-2 and MG-63 cells was analyzed by calculating the combination index (CI) according to the Berenbaum method.43,44 As show in Figure 4C, the CI values were determined to be less than 1.0 at given drug effect levels (i.e., IC50 and IC60) against both Saos-2 and MG-63 cells. This indicated that the hydrogel coloaded with DOX, CDDP and MTX exhibited synergistic effects on the cytotoxicities against Sao-2 and MG-63 cells.43,44 The possible mechanisms for the synergistic effects on the cytotoxicity in vitro of DOX, CDDP, and MTX may be attributed to enhancement of the sensitivities of osteosarcoma cells to the drugs caused by the combination actions to the multiple targets of tumor cells, as well as the reduction in the possibility of drug-resistance.49 Additionally, the apoptosis-related genes, including Bcl-2, BAX and caspase-3, of the osteosarcoma cells exposure to the drug-loaded hydrogels were analyzed by quantitative real-time PCR. It has been established that chemotherapy leads to the regulation of a series of apoptosis or antiapoptosis genes, including the Bcl-2 family and caspase family to induce the apoptosis of osteosarcoma cells. The Bcl-2 family is referred as key regulators to the mitochondrial pathway of apoptosis by permeabilization of the mitochondrial outer membrane. The

regulation of Bcl-2 and BAX is associated with tumor initiation, growth, and progression,50 and therefore provides efficient approaches for anticancer therapy by preventing cytochrome c release and inhibiting apoptosome formation.51 Related conclusions were drawn in caspases family, especially caspase3. The down-regulation of caspase-3 was proven to promote the tumorigenesis.52 Additionally, caspase-3 can interact with Bcl-2 family to induce the apoptosis in a complicated way. As a result, the down-regulation of antiapoptosis gene Bcl-2 and upregulation of apoptosis genes BAX and caspase-3 can lead to the increase in the apoptosis rate of the osteosarcoma cells from different apoptosis pathways.53,54 In this study, the hydrogel coloaded with DOX, CDDP, and MTX showed enhanced effects on the expressions of apoptosisrelated genes in the Saos-2 and MG-63 cells, compared to the hydrogel loaded with DOX only, as shown in Figure 5, The cells treated with multidrug coloaded hydrogels showed obvious down-regulation of the expression of Bcl-2 gene and the up-regulation of the expressions of BAX and Caspase-3 genes, compared to the control group or the group treated with the DOX-loaded hydrogel. 3.5. In Vivo Antitumor Efficacies of Drug-Loaded Hydrogels. The in vivo antitumor efficacies of the drug-loaded hydrogels were evaluated on a nude mice model bearing human osteosarcoma Saos-2 xenografts. The mice were treated with a single injection of drug-loaded hydrogels or free drug solutions in the vicinity of the tumors. As shown in Figure 6A,B, the treatments with drug-loaded hydrogels showed enhanced tumor inhibition efficacies in vivo for up to 16 days compared to the treatments with free drugs. This should be due to the sustained drug release behaviors from the hydrogels, leading to prolonged tumor suppression in vivo. Moreover, it is noteworthy that the DOX, CDDP and MTX coloaded hydrogels resulted in markedly enhanced tumor suppression efficacy, compared to the hydrogels loaded with single drug or two kinds of drugs. It is noteworthy that, based on the in vitro drug release test (Figure 3), around 80% of the drugs released from the hydrogels at day 11. By contrast, from the in vivo antitumor tests, the drug-loaded hydrogels exhibited effective tumor suppression for up to 16 days, implying an efficient drug E


Research Article


Figure 5. Effects of the DOX, CDDP, and MTX coincorporated hydrogels on the expressions of apoptosis genes in Saos-2 and MG-63 after incubation for 24 in vitro. The apoptosis genes included Bcl-2, BAX and caspase-3. The concentration of DOX, CDDP or MTX in the hydrogel was 1 mg/mL. Data were normalized to β-actin (n = 3). (***p < 0.001).

release from the hydrogels over 16 days. This suggested that the in vitro drug release behaviors of the drug loaded hydrogels were different from those in vivo. Additionally, the body weights of the mice were monitored to assess the systemic toxicities of the treatments. As shown in Figure 6C, no obvious body weight loss was observed during the experimental period for all the groups treated with the peritumoral injection of free drugs or drug-loaded hydrogels, implying low systemic toxicities of the localized treatments. 3.6. Ex Vivo Analysis of Tumor Apoptosis and Apoptosis-Related Gene Expressions. To confirm the suppression of tumor growth was ascribed to the apoptosis of tumor cells, we sectioned the tumor masses and H&E and TUNEL stained for pathology analysis. As shown in Figure 7, based on the H&E staining, various degrees of tumor necrosis, including karyolysis, pyknosis, and karyorrhexis, were observed in the tumor sections treated with free drugs or drug-loaded hydrogels. It was found that the treatments with drug-loaded hydrogels resulted in higher tumor necrosis than free drugs. Notably, the highest extent of tumor necrosis was observed for the group treated with the DOX, CDDP and MTX coloaded hydrogel. Moreover, the highest apoptosis ratio of the tumor cells treated with the DOX, CDDP, and MTX coloaded hydrogel was also confirmed by TUNEL assay (Figure 7). Moreover, to investigate the mechanisms of apoptosisinducing process, we further studied the apoptosis-related genes, including Bcl-2, BAX, and caspase-3, of the tumor masses by real-time PCR. As shown in Figure 8, the treatments with free drugs or the drug-loaded hydrogels led to obvious reduction in the expression of antiapoptosis gene Bcl-2 and increase in the expressions of apoptosis genes, BAX and

Figure 6. In vivo antitumor efficacy of the free drugs or drug-loaded hydrogels after single injection to the vicinity of the tumors of BALB/c nude mice bearing human osteosarcoma Saos-2 xenografts. The formulations include Saline, hydrogel only (Gel), free DOX, free DOX +CDDP, free DOX+CDDP+MTX, Gel+DOX, Gel+DOX+CDDP, and Gel+DOX+CDDP+MTX. (A) Tumor growth inhibition. (B) Tumor weights obtained from the mice sacrificed at day 16. (C) Body weights of mice during the treatments. The final concentrations of DOX, CDDP and MTX were 5.0, 3.0, and 10 mg per kg mice weight, respectively. Data were presented as mean ± standard deviation (n = 6). (*p < 0.05, **p < 0.01, ***p < 0.001).

caspase-3. Importantly, it was found that the combination treatment with DOX, CDDP, and MTX coloaded hydrogel displayed obviously enhanced level of the drown-regulation of antiapoptosis gene Bcl-2 and up-regulation of apoptosis genes BAX and caspase-3, compared to the hydrogels containing DOX or DOX plus CDDP. 3.7. Systemic Safety Evaluation. To assess the systemic toxicities of the local treatments with free drugs or the drugloaded hydrogels, we sacrifuced the mice and dissected the key organs, including the heart, liver, kidney, and spleen. The organs were sectioned and stained with H&E for pathological analysis. As shown in Figure 9, no obvious abnormality was observed in the organs for all experimental groups. This suggested that the treatments by local, sustained delivery of free drugs or drug-loaded hydrogels caused lower systemic toxicity and no serious damage to the normal organs during the experimental period. F


Research Article


Figure 7. Ex vivo histological H&E staining and TUNEL assay analyses of tumor sections with various treatments: Saline, free DOX, free DOX +CDDP, free DOX+CDDP+MTX, Gel+DOX, Gel+DOX+CDDP, and Gel+DOX+CDDP+MTX. The final concentrations of DOX, CDDP, and MTX were 5.0, 3.0, and 10 mg/kg mouse weight, respectively. Nuclei were stained blue, and extracellular matrix and cytoplasm were stained red in H&E staining. Green fluorescence indicated apoptotic cells in TUNEL analysis.

Figure 9. Ex vivo histological H&E staining of the organs of the mice with different treatments: (A) Saline, (B) free DOX, (C) free DOX +CDDP, (D) free DOX+CDDP+MTX, (E) Gel+DOX, (F) Gel +DOX+CDDP, and (G) Gel+DOX+CDDP+MTX. The final concentrations of DOX, CDDP, and MTX were 5.0, 3.0, and 10 mg/kg mouse weight, respectively. The organs included heart, liver, kidney, and spleen. Figure 8. Ex vivo analysis of the expressions of apoptosis genes, including Bcl-2, BAX, and caspase-3, in the tumor masses after treatment with the free drugs or drug-loaded hydrogels by quantitative real-time PCR. Data were normalized to β-actin (n = 3). (*p < 0.05, ***p < 0.001).

in nude mice bearing human osteosarcoma Saos-2 xenografts, the drug-loaded hydrogels exhibited significantly higher tumor inhibition efficacies in vivo, compared to free drugs. Moreover, the hydrogels loaded with DOX, CDDP, and MTX led to increased efficacy in tumor growth inhibition, enhanced tumor necrosis, and increased regulation of the apoptosis-related gene expressions, compared to the hydrogels loaded with DOX or DOX plus CDDP. Furthermore, the ex vivo histological analysis of the key organs of the mice indicated no obvious damage of the normal organs, implying lower systemic toxic side-effects caused by the local treatments. Therefore, the localized combination treatment by sustained co-delivery of DOX, CDDP, and MTX with the PLGA−PEG−PLGA

4. CONCLUSIONS In this study, a DOX, CDDP, and MTX coloaded hydrogel system was investigated for localized treatment of osteosarcoma. The in vitro tests indicated that the multidrug coloaded hydrogels displayed synergistic effects on the cytotoxicities against osteosarcoma Saos-2 and MG-63 cells. After a single injection of the drug-loaded hydrogels in the vicinity of tumors G


Research Article


in Europe: Report From the RARECARE Project. Eur. J. Cancer 2013, 49, 684−695. (10) Anninga, J. K.; Gelderblom, H.; Fiocco, M.; Kroep, J. R.; Taminiau, A. H. M.; Hogendoorn, P. C. W.; Egeler, R. M. Chemotherapeutic Adjuvant Treatment for Osteosarcoma: Where Do We Stand? Eur. J. Cancer 2011, 47, 2431−2445. (11) Luetke, A.; Meyers, P. A.; Lewis, I.; Juergens, H. Osteosarcoma Treatment − Where Do We Stand? A State of the Art Review. Cancer Treat. Rev. 2014, 40, 523−532. (12) McTiernan, A.; Jinks, R. C.; Sydes, M. R.; Uscinska, B.; Hook, J. M.; van Glabbeke, M.; Bramwell, V.; Lewis, I. J.; Taminiau, A. H. M.; Nooij, M. A.; Hogendoorn, P. C. W.; Gelderblom, H.; Whelan, J. S. Presence of Chemotherapy-Induced Toxicity Predicts Improved Survival in Patients with Localised Extremity Osteosarcoma Treated with Doxorubicin and Cisplatin: A Report from the European Osteosarcoma Intergroup. Eur. J. Cancer 2012, 48, 703−712. (13) Marina, N.; Bielack, S.; Whelan, J.; Smeland, S.; Krailo, M.; Sydes, M.; Butterfass-Bahloul, T.; Calaminus, G.; Bernstein, M. International Collaboration Is Feasible in Trials for Rare Conditions: The EURAMOS Experience. In Pediatric and Adolescent Osteosarcoma; Jaffe, N.; Bruland, O. S.; Bielack, S.; Eds.; Springer: New York, 2010; pp 339−353. (14) Cortes, E. P.; Holland, J. F.; Wang, J. J.; Sinks, L. F.; Blom, J.; Senn, H.; Bank, A.; Glidewell, O. Amputation and Adriamycin in Primary Osteosarcoma. N. Engl. J. Med. 1974, 291 (19), 998−1000. (15) Carter, S. K.; Blum, R. H. New Chemotherapeutic Agents··· Bleomycin and Adriamycin. Ca-Cancer J. Clin. 1974, 24 (6), 322−331. (16) Pang, B.; Qiao, X.; Janssen, L.; Velds, A.; Groothuis, T.; Kerkhoven, R.; Nieuwland, M.; Ovaa, H.; Rottenberg, S.; van Tellingen, O.; et al. Drug-Induced Histone Eviction from Open Chromatin Contributes to the Chemotherapeutic Effects of Doxorubicin. Nat. Commun. 2013, 4, 1908. (17) Swift, L. P.; Rephaeli, A.; Nudelman, A.; Phillips, D. R.; Cutts, S. M. Doxorubicin-DNA Adducts Induce a Non-topoisomerase II− Mediated Form of Cell Death. Cancer Res. 2006, 66, 4863−4871. (18) Jolivet, J.; Cowan, K. H.; Curt, G. A.; Clendeninn, N. J.; Chabner, B. A. The Pharmacology and Clinical Use of Methotrexate. N. Engl. J. Med. 1983, 309, 1094−1104. (19) Janeway, K. A.; Grier, H. E. Sequelae of Osteosarcoma Medical Therapy: A Review of Rare AcuteToxicities and Late Effects. Lancet Oncol. 2010, 11 (7), 670−678. (20) Hayek, E. R.; Speakman, E.; Rehmus, E. Acute Doxorubicin Cardiotoxicity. N. Engl. J. Med. 2005, 352, 2456−2457. (21) Widemann, B. C.; Adamson, P. C. Understanding and Managing Methotrexate Nephrotoxicity. Oncologist 2006, 11, 694−703. (22) Park, S. B.; Goldstein, D.; Krishnan, A. V.; Lin, C. S. Y.; Friedlander, M. L.; Cassidy, J.; Koltzenburg, M.; Kiernan, M. C. Chemotherapy-Induced Peripheral Neurotoxicity: A Critical Analysis. Ca-Cancer J. Clin. 2013, 63, 419−437. (23) Berrino, F.; De Angelis, R.; Sant, M.; Rosso, S.; Lasota, M. B.; Coebergh, J. W.; Santaquilani, M. Survival for Eight Major Cancers and All Cancers Combined for European Adults Diagnosed in 1995− 99: Results of the EUROCARE-4 Study. Lancet Oncol. 2007, 8, 773− 783. (24) Kim, S.; Nishimoto, S. K.; Bumgardner, J. D.; Haggard, W. O.; Gaber, M. W.; Yang, Y. A Chitosan/β-Glycerophosphate Thermosensitive Gel for the Delivery of Ellagic Acid for the Treatment of Brain Cancer. Biomaterials 2010, 31, 4157−4166. (25) Yu, L.; Ding, J. Injectable Hydrogels as Unique Biomedical Materials. Chem. Soc. Rev. 2008, 37, 1473−1481. (26) He, C.; Kim, S. W.; Lee, D. S. In Situ Gelling Stimuli-Sensitive Block Copolymer Hydrogels for Drug Delivery. J. Controlled Release 2008, 127, 189−207. (27) Park, M. H.; Joo, M. K.; Choi, B. G.; Jeong, B. Biodegradable Thermogels. Acc. Chem. Res. 2012, 45, 424−33. (28) Alexander, A.; Ajazuddin; Khan, J.; Saraf, S.; Saraf, S. Poly(Ethylene Glycol)-Poly(Lactic-co-Glycolic Acid) Based Thermosensitive Injectable Hydrogels for Biomedical Applications. J. Controlled Release 2013, 172, 715−729.

hydrogels may serve as a promising strategy for enhanced treatment of osteosarcoma.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsami.5b09112. Additional characterization data and in vitro cytotoxicity assay. (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Tel/Fax: +86-431-85262116. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The authors are grateful for the financial support from the National Natural Science Foundation of China (projects 21174142, 51273081, 51233004, 51390484, and 51321062), the Ministry of Science and Technology of China (International cooperatio n and communication program 2011DFR51090) and Changchun Municipal Science and Technology Bureau Foundation (Project 2012092).

■

REFERENCES

(1) Ward, E.; DeSantis, C.; Robbins, A.; Kohler, B.; Jemal, A. Childhood and Adolescent Cancer Statistics. Ca-Cancer J. Clin. 2014, 64, 83−103. (2) Hogendoorn, P. C. W. Bone Sarcomas: ESMO Clinical Practice Guidelines for Diagnosis, Treatment and Follow-up. Ann. Oncol. 2010, 21, v204−v213. (3) Kaatsch, P. Epidemiology of Childhood Cancer. Cancer Treat. Rev. 2010, 36, 277−285. (4) Bielack, S. S.; Kempf-Bielack, B.; Delling, G.; Exner, G. U.; Flege, S.; Helmke, K.; Kotz, R.; Salzer-Kuntschik, M.; Werner, M.; Winkelmann, W. Prognostic Factors in High-Grade Osteosarcoma of the Extremities or Trunk: An Analysis of 1,702 Patients Treated on Neoadjuvant Cooperative Osteosarcoma Study Group Protocols. J. Clin. Oncol. 2002, 20, 776−790. (5) Bielack, S.; Jürgens, H.; Jundt, G.; Kevric, M.; Kühne, T.; Reichardt, P.; Zoubek, A.; Werner, M.; Winkelmann, W.; Kotz, R. Osteosarcoma: The COSS Experience. In Pediatric and Adolescent Osteosarcoma; Jaffe, N.; Bruland, O. S.; Bielack, S.; Eds.; Springer: New York, 2010; pp 289−308. (6) Kempf-Bielack, B.; Bielack, S. S.; Jürgens, H.; Branscheid, D.; Berdel, W. E.; Exner, G. U.; Göbel, U.; Helmke, K.; Jundt, G.; Kabisch, H. Osteosarcoma Relapse After Combined Modality Therapy: An Analysis of Unselected Patients in the Cooperative Osteosarcoma Study Group (COSS). J. Clin. Oncol. 2005, 23, 559−568. (7) Kager, L.; Zoubek, A.; Pötschger, U.; Kastner, U.; Flege, S.; Kempf-Bielack, B.; Branscheid, D.; Kotz, R.; Salzer-Kuntschik, M.; Winkelmann, W. Primary Metastatic Osteosarcoma: Presentation and Outcome of Patients Treated on Neoadjuvant Cooperative Osteosarcoma Study Group Protocols. J. Clin. Oncol. 2003, 21, 2011−2018. (8) Gatta, G.; Botta, L.; Rossi, S.; Aareleid, T.; Bielska-Lasota, M.; Clavel, J.; Dimitrova, N.; Jakab, Z.; Kaatsch, P.; Lacour, B.; Mallone, S.; Marcos-Gragera, R.; Minicozzi, P.; Sanchez-Perez, M. J.; Sant, M.; Santaquilani, M.; Stiller, C.; Tavilla, A.; Trama, A.; Visser, O.; PerisBonet, R. Childhood Cancer Survival in Europe 1999−2007: Results of EUROCARE-5-A Population-Based Study. Lancet Oncol. 2014, 15, 35−47. (9) Stiller, C. A.; Trama, A.; Serraino, D.; Rossi, S.; Navarro, C.; Chirlaque, M. D.; Casali, P. G. Descriptive Epidemiology of Sarcomas H


Research Article


Characteristics and Clinical Evaluation. Chem. Pharm. Bull. 1991, 39, 1518−1521. (49) Jhaveri, A.; Deshpande, P.; Torchilin, V. Stimuli-Sensitive Nanopreparations for Combination Cancer Therapy. J. Controlled Release 2014, 190, 352−370. (50) Lowe, S. W.; Lin, A. W. Apoptosis in Cancer. Carcinogenesis 2000, 21, 485−495. (51) García-Sáez, A. The Secrets of the Bcl-2 Family. Cell Death Differ. 2012, 19, 1733−1740. (52) Devarajan, E.; Sahin, A. A.; Chen, J. S.; Krishnamurthy, R. R.; Aggarwal, N.; Brun, A.-M.; Sapino, A.; Zhang, F.; Sharma, D.; Yang, X.-H.; et al. Down-Regulation of Caspase 3 in Breast Cancer: A Possible Mechanism for Chemoresistance. Oncogene 2002, 21, 8843− 8851. (53) Hockenbery, D.; Nuñez, G.; Milliman, C.; Schreiber, R. D.; Korsmeyer, S. J. Bcl-2 Is an Inner Mitochondrial Membrane Protein That Blocks Programmed Cell Death. Nature 1990, 348, 334−336. (54) Srinivasula, S. M.; Hegde, R.; Saleh, A.; Datta, P.; Shiozaki, E.; Chai, J.; Lee, R.-A.; Robbins, P. D.; Fernandes-Alnemri, T.; Shi, Y.; et al. A Conserved XIAP-Interaction Motif in Caspase-9 and Smac/ DIABLO Regulates Caspase Activity and Apoptosis. Nature 2001, 410, 112−116.

(29) Guo, D. D.; Hong, S. H.; Jiang, H. L.; Kim, J. H.; Minai-Tehrani, A.; Kim, J. E.; Shin, J. Y.; Jiang, T.; Kim, Y.-K.; Choi, Y.-J.; et al. Synergistic Effects of Akt1 shRNA and Paclitaxel-Incorporated Conjugated Linoleic Acid-Coupled Poloxamer Thermosensitive Hydrogel on Breast Cancer. Biomaterials 2012, 33, 2272−2281. (30) Ta, H. T.; Dass, C. R.; Larson, I.; Choong, P. F.; Dunstan, D. E. A Chitosan Hydrogel Delivery System for Osteosarcoma Gene Therapy with Pigment Epithelium-Derived Factor Combined with Chemotherapy. Biomaterials 2009, 30, 4815−4823. (31) Narayani, R.; Panduranga Rao, K. Collagen-Poly(HEMA) Hydrogels for the Controlled Delivery of Methotrexate and Cisplatin. Int. J. Pharm. 1996, 138, 121−124. (32) Bouhadir, K. H.; Alsberg, E.; Mooney, D. J. Hydrogels for Combination Delivery of Antineoplastic Agents. Biomaterials 2001, 22, 2625−2633. (33) Konishi, M.; Tabata, Y.; Kariya, M.; Hosseinkhani, H.; Suzuki, A.; Fukuhara, K.; Mandai, M.; Takakura, K.; Fujii, S. In Vivo AntiTumor Effect of Dual Release of Cisplatin and Adriamycin from Biodegradable Gelatin Hydrogel. J. Controlled Release 2005, 103, 7−19. (34) Miao, B.; Song, C.; Ma, G. Injectable Thermosensitive Hydrogels for Intra-Articular Delivery of Methotrexate. J. Appl. Polym. Sci. 2011, 122, 2139−2145. (35) Zhu, W.; Li, Y.; Liu, L.; Chen, Y.; Xi, F. Supramolecular Hydrogels as a Universal Scaffold for Stepwise Delivering Dox and Dox/cisplatin Loaded Block Copolymer Micelles. Int. J. Pharm. 2012, 437, 11−19. (36) Chen, Y. Y.; Wu, H. C.; Sun, J. S.; Dong, G. C.; Wang, T. W. Injectable and Thermoresponsive Self-Assembled Nanocomposite Hydrogel for Long-Term Anticancer Drug Delivery. Langmuir 2013, 29, 3721−3729. (37) Yu, L.; Ci, T.; Zhou, S.; Zeng, W.; Ding, J. The Thermogelling PLGA-PEG−PLGA Block Copolymer as a Sustained Release Matrix of Doxorubicin. Biomater. Sci. 2013, 1, 411−420. (38) Ma, H.; He, C.; Cheng, Y.; Li, D.; Gong, Y.; Liu, J.; Tian, H.; Chen, X. PLK1shRNA and Doxorubicin Co-Loaded Thermosensitive PLGA-PEG−PLGA Hydrogels for Osteosarcoma Treatment. Biomaterials 2014, 35, 8723−8734. (39) Cho, H.; Kwon, G. S. Thermosensitive Poly-(D,L-Lactide-coGlycolide)- block-Poly(Ethylene Glycol)-block-Poly-(D,L-Lactide-coGlycolide) Hydrogels for Multi-Drug Delivery. J. Drug Targeting 2014, 22, 669−77. (40) Xu, S.; Wang, W.; Li, X.; Liu, J.; Dong, A.; Deng, L. Sustained Release of PTX-Incorporated Nanoparticles Synergized by Burst Release of DOX•HCl from Thermosensitive Modified PEG/PCL Hydrogel to Improve Anti-Tumor Efficiency. Eur. J. Pharm. Sci. 2014, 62, 267−273. (41) Shen, W.; Luan, J.; Cao, L.; Sun, J.; Yu, L.; Ding, J. Thermogelling Polymer-Platinum(IV) Conjugates for Long-Term Delivery of Cisplatin. Biomacromolecules 2015, 16, 105−115. (42) Nair, L. S.; Laurencin, C. T. Biodegradable Polymers as Biomaterials. Prog. Polym. Sci. 2007, 32, 762−798. (43) Berenbaum, M. C. A Method for Testing for Synergy with Any Number of Agents. J. Infect. Dis. 1978, 137, 122−130. (44) Song, W.; Tang, Z.; Li, M.; Lv, S.; Sun, H.; Deng, M.; Liu, H.; Chen, X. Polypeptide-Based Combination of Paclitaxel and Cisplatin for Enhanced Chemotherapy Efficacy and Reduced Side-Effects. Acta Biomater. 2014, 10, 1392−1402. (45) Ci, T.; Chen, L.; Yu, L.; Ding, J. Tumor Regression Achieved by Encapsulating a Moderately Soluble Drug into a Polymeric Thermogel. Sci. Rep. 2014, 4, 5473. (46) Jeong, B.; Bae, Y. H.; Kim, S. W. Drug Release from Biodegradable Injectable Thermosensitive Hydrogel of PEG−PLGAPEG Triblock Copolymers. J. Controlled Release 2000, 63, 155−163. (47) Zentner, G. M.; Rathi, R.; Shih, C.; McRea, J. C.; Seo, M.-H.; Oh, H.; Rhee, B. G.; Mestecky, J.; Moldoveanu, Z.; Morgan, M.; Weitman, S. Biodegradable Block Copolymers for Delivery of Proteins and Water-Insoluble Drugs. J. Controlled Release 2001, 72, 203−215. (48) Nishioka, Y.; Kyotani, S.; Kusunose, M.; Mimoto, H.; Hamada, T.; Asai, M.; Sagara, Y. Cisplatin Suppository: Preparation, Release I


Localized Co-delivery of Doxorubicin, Cisplatin, and Methotrexate by

Recommend Documents