ARTICLE pubs.acs.org/JAFC
Low-Dose Fish Oil Consumption Prevents Hepatic Lipid Accumulation in High Cholesterol Diet Fed Mice Satoshi Hirako, Hyoun-Ju Kim,* Saya Shimizu, Hiroshige Chiba, and Akiyo Matsumoto Department of Clinical Dietetics and Human Nutrition, Josai University, Faculty of Pharmaceutical Sciences, Keyakidai 1-1, Sakado, Saitama 350-0295, Japan ABSTRACT: We examined the effects of low-dose fish oil ingestion on hepatic lipid accumulation caused after high cholesterol feeding in C57BL/6J mice. The mice were fed purified experimental diets consisting of 20 energy % (en%) safflower oil (SO or SO/CH), 2 en% fish oil + 18 en% safflower oil (2FO or 2FO/CH), or 5 en% fish oil + 15 en% safflower oil (5FO or 5FO/CH) with or without 2 weight % (wt %) cholesterol for 8 weeks. Hepatic triglyceride and total cholesterol contents were significantly lower in groups that were fed diets containing fish oil and cholesterol than in those that were fed safflower oil and cholesterol. The hepatic mRNA levels of fatty acid synthase (FAS) were lower in groups fed cholesterol or fish oil. Fatty acid oxidation-related hepatic gene expressions were higher in fish oil-fed groups. Fecal cholesterol excretion was higher in all cholesterol-fed groups; cholesterol excretion was high in groups fed fish oil and cholesterol. These results suggest that low-dose fish oil diets improve lipid metabolism by modifying the expression of lipid metabolism-related genes in the liver and increasing fecal cholesterol excretion. KEYWORDS: Low-dose fish oil diet, cholesterol, hepatic lipids, SREBP target genes, fatty acid oxidation
’ INTRODUCTION Cholesterol is indispensable to the human body, and its levels are subjected to complicated regulation. Cholesterol is modified into oxysterols, including 22- and 24-hydroxy cholesterol, when excess cholesterol is deposited in hepatic cells. It is well-known that oxysterols act as ligands for liver X receptor (LXR) α,1 which is a nuclear receptor that combines with LXR response elements at the promoter of target genes to control transcription. The target genes include sterol regulatory element-binding proteins (SREBPs), cholesterol 7α-hydroxylase (CYP7A1), ATP-binding cassette transporter (ABC) A1, ABCG5, and ABCG8, which are majorly involved in lipid metabolism.29 Our previous study demonstrated that a high cholesterol diet induced hepatic lipid accumulation and resulted in liver hypertrophy due to the accumulation of lipid droplets.10 It has been reported that hepatic lipid accumulation, or hepatic steatosis, promotes the development of insulin resistance, dyslipidemia, and cardiovascular disease.11 Preventing lipid accumulation in the liver is beneficial for the amelioration of insulin resistance and other metabolic syndromes. Fish oil consumption decreases lipogenesis and increases fatty acid oxidation in the liver as well as improves plasma and hepatic lipid levels in rats and hyperlipidemic patients.1214 Many studies also reported that fish oil inhibits the expression of lipogenic genes such as SREBP, fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and stearoyl-CoA desaturase (SCD).1517 In addition, fatty acid oxidation is stimulated by fish oil and caused by the activation of peroxisome proliferator-activated receptor (PPAR) α, which is a nuclear receptor that regulates acyl-CoA oxidase (AOX) and uncoupling protein 2 (UCP2).1821 Our previous research demonstrated that the lipid synthesisreducing effect of fish oil is observed with both 50 energy % (en%) and 20 en% fish oil irrespective of the addition of 2 wt% cholesterol.10 Although the consumption of 20 en% fish oil prevents the hepatic lipid accumulation by the cholesterol feeding, the 20 en% r 2011 American Chemical Society
fish oil is not feasible in ordinary diets. In the present study, we investigated whether 2 or 5 en% fish oil consumption, comprising approximately 10 or 25% of the total fat energy, improves lipid metabolism in mice fed with a high cholesterol diet.
’ MATERIALS AND METHODS Animals and Diets. Female C57BL/6J mice were obtained from Tokyo Laboratory Animals Science Co. (Tokyo, Japan) at 7 weeks of age and fed a normal laboratory diet (MF, Oriental Yeast Co., Tokyo, Japan) for 1 week to stabilize their metabolic conditions. All animals were maintained in a room with controlled temperature (23 ( 2 °C), humidity (55 ( 10%), and a 12 h day cycle (7:00 a.m.7:00 p.m.) at the Josai University Life Science Center. Mice were divided into six groups (n = 5 in each group). All groups were fed a diet containing 60 en% carbohydrate, 20 en% fat, and 20 en% protein with or without 2 wt % cholesterol. The detailed composition of diets is shown in Table 1. In this study, dietary fats contained a mixture of safflower oil and fish oil to maintain the total fat energy level at 20 en% (20 en% safflower oil/0 en% fish oil, 18 en% safflower oil/2 en% fish oil, or 15 en% safflower oil/5 en% fish oil). Safflower oil (high-oleic type) contained 78 wt % oleic acid (18:1n-9); fish oil contained 7 wt % eicosapentaenoic acid (20:5n-3) and 24 wt % docosahexaenoic acid (22:6n-3). For 8 weeks, feed and water were freely provided. The feed was changed at 10:00 a.m. every day, and the residual quantity was measured daily. All animal studies were performed in accordance with the “Standards Relating to the Care and Management of Experimental Animals” (Notice No. 6 of the Office of Prime Minister dated March 27, 1980) and the guidelines of Institutional Animal Care and Use Committee at the Josai University Life Science Center. CT Scan Analysis. After 8 weeks, mice were fasted for 3 h and anesthetized via intraperitoneal injections of pentobarbital sodium (Dainippon Sumitomo Pharma, Osaka, Japan). The abdominal composition of mice was Received: September 16, 2011 Accepted: November 8, 2011 Revised: November 8, 2011 Published: November 08, 2011 13353
dx.doi.org/10.1021/jf203761t | J. Agric. Food Chem. 2011, 59, 13353–13359
Journal of Agricultural and Food Chemistry
ARTICLE
Table 1. Composition of the Experimental Dietsa diet
SO
SO/CH
2FO
2FO/CH
5FO
5FO/CH
ingredients (g) safflower oil
8
8
fish oil
7.2
6
0.8
0.8
2
6 2
casein
20
20
20
20
20
20
sucrose
10.37
10.37
10.37
10.37
10.37
10.37
β-starch
51.83
51.83
51.83
51.83
51.83
51.83
vitamin mixb
1
1
1
1
1
1
mineral mix
3.5
3.5
3.5
3.5
3.5
3.5
cellulose powder L-cystin
5 0.3
5 0.3
5 0.3
5 0.3
5 0.3
5 0.3
tert-butyl hydroquinone
0.0016
0.0016
0.0016
0.0016
0.0016
0.0016
cholesterol
a
7.2
2
2
2
total (g)
100.00
102.00
100.00
102.00
100.00
102.00
energy (kcal/100 g)
374.02
366.68
374.02
366.68
374.02
366.68
fat energy ratio (%)
19.70
19.70
19.70
19.70
19.70
19.70
Vitamin mix and mineral mix were based on the AIN-93G formation. b Vitamin mix substituted 0.25% sucrose for choline bitartrate.
Table 2. Primer for RT-PCR Amplification of Indicated Genes gene
forward primer (50 30 )
reverse primer (50 30 )
SREBP-lc
GGAGCCATGGATTGCACATT
GGCCCGGGAAGTCACTGT
SREBP-2
GCGTTCTGGAGACCATGGA
ACAAAGTTGCTCTGAAAACAAATCA
Insig-1
TCACAGTGACTGAGCTTCAGCA
TCATCTTCATCACACCCAGGAC
FAS
TCACCACTGTGGGCTCTGCAGAGAAGCGAG
TGTCATTGGCCTCCTCAAAAAGGGCGTCCA
SCD1
CCGGAGACCCCTTAGATCGA
TAGCCTGTAAAAGATTTCTGCAAACC
HMG-CoA reductase
CTTGTGGAATGCCTTGTGATTG
AGCCGAAGCAGCACATGAT
LDL receptor
AGGCTGTGGGCTCCATAGG
TGCGGTCCAGGGTCATCT
ABCG5 ABCG8
TCTCCGCGTCCAGAACAAC CCCTCCGATTGCTTCTTTCAG
CATTGAGCATGCCGGTGTAT CTGAGAAATGCCCCCAGATAAA
PPARα
GTGGCTGCTATAATTTGCTGTG
GAAGGTGTCATCTGGATGGTT
AOX
TCAACAGCCCAACTGTGACTTCCATTA
TCAGGTAGCCATTATCCATCTCTTCA
UCP-2
GTTCCTCTGTCTCGTCTTGC
GGCCTTGAAACCAACCA
CYP7A1
CTGTGTTCACTTTCTGAAGCCATG
CCCAGGCATTGCTCTTTGAT
CYP8B1
TTCGACTTCAAGCTGGTCGA
CAAAGCCCCAGCGCCT
ABCA1
ACCAGCTTCCATCCTCCTTG
GGCCACATCCACAACTGTCT
NPC1L1 GAPDH
ATCCTCATCCTGGGCTTTGC TGTGTCCGTCGTGGATCTGA
GCAAGGTGATCAGGAGGTTGA CCTGCTTCACCACCTTCTTGAT
radiographically examined using a LaTheta (LCT-100) experimental animal computed tomography (CT) system (Aloka, Tokyo, Japan). Contiguous 2 mm slice images between L2 and L4 were used for the quantitative assessment using LaTheta software (version 2.10). Fat was divided into visceral and subcutaneous fat and evaluated quantitatively. Collection of Blood and Tissue Samples. After CT scanning and body weight measurements, autopsy was performed. Blood samples were drawn from the inferior vena cava and treated with EDTA 2Na. The liver and white adipose tissues (WATs) around the uterus were removed immediately and weighed. Photographs of the liver were taken using a digital camera. A piece of liver tissue was excised from the median lobe of the liver. Liver samples from five mice were collected for each group and fixed with 10% neutral buffered formalin (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Samples were embedded in paraffin, cut into sections, and stained with hematoxylin eosin (H&E) for histopathological examination by Kotobiken Medical Laboratories, Inc. (Tokyo, Japan).
The small intestine was divided into three segments: duodenum, jejunum, and ileum (jejunum was used in this study). The jejunum was gently rinsed with a 0.1 M phosphate-buffered saline (pH 7.4). Sample blood was centrifuged (900g, 4 °C, 10 min) to separate plasma, which was frozen at 80 °C for storage until analysis. Removed organs were frozen in liquid nitrogen and stored at 80 °C. Measurement of Lipid in Plasma and Liver. Hepatic lipids were extracted from approximately 100 mg of liver tissue for each mouse in accordance with the method of Folch et al.22 For the measurements of triglycerides and total cholesterol in the liver, Wako Triglyceride E-Test and Cholesterol E-Test kits (Wako Pure Chemical Industries, Ltd.) were used, respectively. Measurements of plasma triglyceride and total cholesterol levels were performed using the same test kits. For the measurements of plasma high-density lipoprotein cholesterol (HDL-C) levels, the Wako HDL-Cholesterol E-Test kit (Wako Pure Chemical Industries, Ltd.) was used. 13354
dx.doi.org/10.1021/jf203761t |J. Agric. Food Chem. 2011, 59, 13353–13359
Journal of Agricultural and Food Chemistry
ARTICLE
Table 3. Body Weight, Liver Weight, and White Adipose Tissue Weight of 16 Week Old Female Micea parameter
a
SO
SO/CH
2FO
2FO/CH
5FO
5FO/CH
initial body weight (g)
17.63 ( 0.89
17.64 ( 0.82
17.65 ( 0.58
17.67 ( 0.55
17.67 ( 0.53
17.65 ( 0.48
final body weight (g)
21.78 ( 1.54
21.30 ( l.45
21.67 ( 1.23
21.98 ( 1.35
22.70 ( 1.65
21.32 ( 0.84
liver weight (g)
0.94 ( 0.09
0.93 ( 0.09
0.92 ( 0.08
1.02 ( 0.12
0.94 ( 0.08
0.94 ( 0.05
liver weight/body weight (%)
4.23 ( 0.26 b
4.39 ( 0.16 ab
4.28 ( 0.15 ab
4.63 ( 0.32 a
4.12 ( 0.09 ab
4.39 ( 0.2 ab
white adipose tissue weight (g)
0.42 ( 0.12
0.32 ( 0.11
0.28 ( 0.10
0.36 ( 0.10
0.42 ( 0.12
0.33 ( 0.10
Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
Figure 1. Liver morphology, tissue histology, and hepatic lipids levels in 16 week old female mice. Liver morphology (A), H&E-stained liver sections (B), liver triglycerides (TG) (C), and liver total cholesterol (TC) (D) in mice fed SO, SO/CH, 2FO, 2FO/CH, 5FO, and 5FO/CH for 8 weeks. Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
Measurement of Cholesterol in Feces. Feces were collected from individual mice on each of the last 3 days of the experiment. Fecal lipids were extracted from approximately 300 mg of feces for each mouse in accordance with the method of Folch et al.22 For the measurement of fecal total cholesterol levels, the Wako Cholesterol E-Test kit was used. Measurement of mRNA Levels by Real-Time Polymerase Chain Reaction (PCR). The total RNA was extracted from the liver and intestinal tissue of each mouse using Trizol (Invitrogen Co.) in accordance with the manufacturer's protocol. The measurement of mRNA levels by real-time RT-PCR was performed using the ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA). Amplification of mRNA was performed using QuantiTect SYBR Green and QuantiTect RT Mix (Qiagen, Hilden, Germany). The thermal cycling conditions were as follows: reverse transcription at 50 °C for 30 min, initial activation at 95 °C for 15 min, 40 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min. A housekeeping transcript, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was used as an endogenous control gene. The primers used for real-time PCR analysis are listed in Table 2. Statistical Analysis. A one-way analysis of variance was performed on the data. Groups were compared using Fisher's protected least significant difference (PLSD) test (SYSTAT 11; Systat Software, Chicago, IL). Values were reported as the means ( standard deviations (SDs). Statistical significance was defined as P < 0.05.
’ RESULTS Body Weight and Tissue Weight. Although final body weights increased in all groups, body weight gain (final weight initial
Figure 2. CT-based body fat composition analysis in 16 week old female mice. Representative X-ray CT images of mice fed SO, SO/CH, 2FO, 2FO/CH, 5FO, and 5FO/CH for 8 weeks at the L3 level (A). The areas indicated with pink, yellow, and light blue are visceral fat, subcutaneous fat, and muscle, respectively. CT-estimated amounts of visceral fat (B) and subcutaneous fat (C) in the abdominal area of L2L4. Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
weight) was not significantly different among the groups. There were no large differences found in weights of the liver and WAT among the groups (Table 3). Food intakes (kcal/5 mice/day) during the study were comparable among the diet groups (SO, 51.3 ( 5.3; SO/CH, 56.0 ( 5.8; 2FO, 55.5 ( 5.3; 2FO/CH, 59.0 ( 7.1; 5FO, 54.2 ( 5.4; and 5FO/CH, 54.8 ( 5.4). Liver Morphology, Histology, and Hepatic Lipid Levels. To investigate the effects of fish oil and cholesterol consumption on lipid accumulation in the liver, the morphology and histology of the liver were compared among the groups. Although the liver weights in the SO/CH and 2FO/CH groups were similar to that in the SO group, the entire surface of the liver had a different color. The livers of SO/CH and 2FO/CH mice had a pale color, suggestive of increased lipid storage. In contrast, the livers of 5FO/CH mice were less pale and had a normal reddish appearance (Figure 1A). H&E staining revealed lipid droplets in the livers of SO/CH mice. However, the amount of lipid droplets was dramatically lower in the 2FO/CH and 5FO/CH groups. In addition, the size of hepatic lipid droplets was markedly smaller in the 2FO/CH and 5FO/CH groups than in the SO/CH group (Figure 1B). Hepatic triglyceride levels in the SO/CH group were 1.5-fold higher than those in the SO group, although the levels in the 2FO/CH and 5FO/CH groups were approximately 70 and 50% lower than that in the SO/CH group, respectively. In addition, hepatic total cholesterol levels in the 2FO/CH and 5FO/CH groups 13355
dx.doi.org/10.1021/jf203761t |J. Agric. Food Chem. 2011, 59, 13353–13359
Journal of Agricultural and Food Chemistry
ARTICLE
were also 50 and 33% lower than that in the SO/CH group, respectively (Figure 1C,D). Assessment of Abdominal Fat Tissues Using X-ray CT. Visceral fat levels were not significantly different among the groups (Figure 2B), and subcutaneous fat levels were lower in only the 2FO group than in the SO group (Figure 2C). Plasma Lipid Levels. To examine the effects of low-dose fish oil in response to high cholesterol diet consumption, plasma lipid levels were measured, and the results are shown in Figure 3. Although plasma total cholesterol levels were significantly lower
Figure 3. Blood glucose and plasma lipid levels in 16 week old female mice. Blood glucose (A), plasma triglyceride (TG) (B), plasma total cholesterol (TC) (C), and plasma HDL-C (D) in mice fed SO, SO/CH, 2FO, 2FO/CH, 5FO, and 5FO/CH for 8 weeks. Mice were fasted for 3 h prior to blood sampling. Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
in the 2FO group than in the SO group, its levels were higher in the SO/CH and 2FO/CH groups than in the SO and 2FO groups, respectively. In rodents such as mice or rat, the HDL-C fraction accounts for 5060% in the total cholesterol level. In this study, plasma HDL-C levels were comparable among the diet groups reflecting 2 or 5% fish oil or 2% cholesterol feeding in C57BL/6J mice did not modify plasma HDL-C levels. Liver Expression Levels of Genes Involved in Lipid Metabolism. The hepatic mRNA levels of lipid metabolism-regulating genes are shown in Table 4. There were minor differences observed in SREBP-1c mRNA levels between the 2FO and 5FO groups and the SO group. However, its levels were significantly higher in the fish oil groups with cholesterol supplementation. The mRNA levels of Insig-1, which strongly responds to nutrients and insulin, were similar among the SO, 2FO, and 5FO groups, although its levels were significantly lower when cholesterol was added. The mRNA levels of FAS, a target gene of SREBP-1c, were lower in the SO/CH group than in the SO group, but no differences were observed between the 2FO/CH and 5FO/CH groups and the 2FO and 5FO groups, respectively. The SCD1 mRNA levels in the 2FO/CH and 5FO/CH groups were not changed by the addition of cholesterol. SREBP-2 mRNA expression levels were lower in the cholesterolsupplemented groups than in the groups that were not fed cholesterol. HMG-CoA reductase mRNA levels were significantly lower in the 5FO and cholesterol-supplemented groups than in the SO group. The mRNA expression of ABCG5 and ABCG8, genes involved in cholesterol transport into the bile, were markedly increased in all cholesterol-supplemented groups. PPARα mRNA levels were significantly higher in the fish oil groups than in the SO groups, irrespective of the addition of cholesterol. Indeed, the mRNA levels of AOX, a target gene of PPARα involved in fatty acid oxidation, and UCP-2, which is
Table 4. Expression of Genes Associated with Lipid Metabolism in the Livera SO
SO/CH
2FO
2FO/CH
5FO
5FO/CH
SREBP pathway SREBP-lc
1.00 ( 0.82 b
1.59 ( 1.39 b
1.61 ( 0.20 b
3.39 ( 0.48 a
1.72 ( 0.29 b
3.93 ( 1.65 a
SREBP-2 Insig-1
1.00 ( 0.09 bc 1.00 ( 0.72 ab
0.74 ( 0.16 c 0.58 ( 0.28 c
1.39 ( 0.22 a 1.61 ( 0.22 a
1.01 ( 0.05 b 1.12 ( 0.70 c
1.60 ( 0.32 a 1.72 ( 0.13 a
0.86 ( 0.17 bc 0.91 ( 0.26 bc
fatty acid biosynthesis FAS
1.00 ( 0.21 a
0.54 ( 0.31 b
0.57 ( 0.13 b
0.48 ( 0.13 b
0.66 ( 0.12 ab
0.57 ( 0.41 b
SCD1
1.00 ( 0.12
0.69 ( 0.22
0.68 ( 0.11
0.75 ( 0.35
0.70 ( 0.30
0.70 ( 0.31
HMG-CoA reductase
1.00 ( 0.44 a
0.40 ( 0.20 b
0.71 ( 0.33 ab
0.41 ( 0.07 b
0.51 ( 0.36 b
0.44 ( 0.12 b
LDL receptor
1.00 ( 0.25 ab
0.63 ( 0.15 b
1.29 ( 0.11 a
0.93 ( 0.15 ab
1.16 ( 0.33 a
1.01 ( 0.14 ab
ABCG5
1.00 ( 0.22 b
2.07 ( 0.26 a
1.25 ( 0.18 b
2.54 ( 0.51 a
1.35 ( 0.18 b
2.39 ( 0.65 a
ABCG8
1.00 ( 0.05 d
1.51 ( 0.42 bc
1.12 ( 0.13 cd
2.02 ( 0.33 a
1.21 ( 0.14 cd
1.64 ( 0.27 b
PPARα
1.00 ( 0.16 d
1.39 ( 0.15 c
1.56 ( 0.21 bc
1.98 ( 0.18 ab
1.95 ( 0.67 ab
2.01 ( 0.31 a
AOX
1.00 ( 0.06 d
1.40 ( 0.30 d
2.19 ( 0.33 c
2.40 ( 0.35 bc
3.38 ( 0.83 a
2.96 ( 0.43 ab
UCP2
1.00 ( 0.29 c
1.48 ( 0.24 bc
1.99 ( 0.56 ab
1.72 ( 0.41 b
2.60 ( 0.71 a
1.70 ( 0.36 b
CYP7A1
1.00 ( 0.51 c
8.06 ( 3.13 a
1.42 ( 1.29 c
2.37 ( 1.35 bc
0.71 ( 0.64 c
4.11 ( 2.47 b
CYP8B1
1.00 ( 0.33 ab
0.81 ( 0.26 b
1.25 ( 0.43 ab
1.40 ( 0.40 ab
1.43 ( 0.39 a
1.41 ( 0.61 a
cholesterol homeostasis
fatty acid β-oxidation
bile acid bioynthesis
a The mRNA expression levels in liver of mice fed SO, SO/CH, 2F0, 2FO/CH, 5FO, and 5FO/CH for 8 weeks. Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
13356
dx.doi.org/10.1021/jf203761t |J. Agric. Food Chem. 2011, 59, 13353–13359
Journal of Agricultural and Food Chemistry
ARTICLE
Table 5. Expression of Genes Associated with Lipid Metabolism in the Intestinea SO
SO/CH
2FO
2FO/CH
5FO
5FO/CH
ABCG5
1.00 ( 0.22 bc
1.47 ( 0.49 ab
1.72 ( 0.34 a
2.02 ( 0.86 a
0.90 ( 034 c
1.54 ( 037 ab
ABCG8
1.00 ( 0.24 b
1.49 ( 0.23 ab
1.47 ( 0.38 a
1.76 ( 0.61 a
1.03 ( 0.38 b
1.23 ( 0.25 ab
ABCA1
1.00 ( 0.19 c
2.86 ( 0.68 a
1.53 ( 0.73 bc
2.86 ( 0.94 a
1.64 ( 0.19 b
2.63 ( 0.66 a
NPC1L1
1.00 ( 0.72 ab
1.20 ( 0.37 a
1.33 ( 0.50 a
1.00 ( 0.35 ab
0.77 ( 0.23 ab
0.46 ( 0.33 b
The mRNA expression levels in the intestine of mice fed SO, SO/CH, 2FO, 2FO/CH, 5FO, and 5FO/CH for 8 weeks. Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
a
Figure 4. Fecal weight and cholesterol excretion levels in 16 week old female mice. Fecal weight (A) and fecal cholesterol excretion (B) in mice fed SO, SO/CH, 2FO, 2FO/CH, 5FO, and 5FO/CH for 8 weeks. Values represent means ( SDs (n = 45). Means with different letters are different at the p < 0.05 level by Fisher's PLSD test.
involved in heat production, were also higher in the fish oil groups than in the SO group. The mRNA levels of CYP7A1, the rate-limiting gene in bile acid synthesis, were not significantly affected by fish oil feeding, but its levels significantly increased when cholesterol was added. Intestinal Expression Levels of Genes Involved in Cholesterol Metabolism and Fecal Cholesterol Levels. The intestinal mRNA levels of cholesterol metabolism-relating genes are shown in Table 5. The mRNA levels of ABCG5 and ABCG8, involved in cholesterol efflux from the enterocyte into the intestinal lumen, were higher in the 2FO group than in the SO group. The mRNA levels of ABCA1 were significantly higher in the 5FO group than in the SO group, and its levels were further increased upon cholesterol supplementation. The mRNA levels of Niemann Pick C1 like-1 (NPC1L1), a critical gene for cholesterol absorption, were not significantly changed by fish oil or cholesterol feeding. As shown in Figure 4, fecal cholesterol excretion was also increased in all groups when cholesterol was added, and fecal cholesterol excretion was higher after fish oil and cholesterol feeding than after safflower oil and cholesterol feeding.
’ DISCUSSION In this study, our data revealed that 2 or 5 en% fish oil consumption reduces hepatic lipid accumulation in response to high cholesterol feeding, although low-dose fish oil feeding did not particularly affect the body weight gain, parametrial white adipose tissue weight as well as visceral fat. Previously, we indicated that body weight gain was markedly decreased in C57BL/6J mice fed 20 en% fish oil diets and in KK female mice fed the 25 en% fish oil diets.10,23 However, the results from this study revealed that 2 and 5 en% fish oil feeding in C57BL/6J mice did not modify these parameters. De Craemer et al. reported that liver weight increases when peroxisomes proliferate in mice fed fish oil,24 but no significant
changes in liver weight or the liver weight to body weight ratio were observed in this study. Conversely, the effect of fish oil feeding on hepatic lipid contents was obvious. Hepatic lipid accumulation is considered a risk factor for fatty liver and steatohepatitis, which promote the development of insulin resistance, dyslipidemia, and cardiovascular disease.11 In this present study, lipid droplets were dispersed throughout the hepatic cells of hepatic tissue specimens in the SO/CH group. Such lipid deposition caused by high cholesterol feeding was inhibited in groups in which fish oil was used as the lipid source, such as the 2FO/CH and 5FO/CH groups. In addition, this fish oil-mediated inhibition was dose-dependent, and these results clearly were reflected in the hepatic lipid levels. We confirmed that fish oil exerts ameliorating effects on hepatic lipid accumulation due to dietary cholesterol consumption even with 2 en% fish oil content. Cholesterol and phytosterol from the small intestinal lumen are transported into epithelial cells by NPC1L1 protein on the brush border of epithelial cells, which is critical to the absorption of cholesterol, and cholesterol is released in the lymph duct as chylomicrometers.2529 By contrast, excess cholesterol and plant sterols are transported to the inner cavity of the small intestine by an ABCG5/ABCG8 heterodimer, which is of crucial importance to hepatobiliary cholesterol secretion,3032 thereby promoting net cholesterol removal from the body. In the present study, the hepatic mRNA levels of ABCG5 and ABCG8, which are induced by LXR and involved in biliary sterol excretion, were significantly increased when cholesterol was added irrespective of fish oil consumption. Several studies reported that biliary cholesterol excretion increases due to the upregulation of these genes.8 The increase in ABCG5 and ABCG8 mRNA levels by high cholesterol feeding is required for the maintenance of cholesterol homeostasis. Recent studies reported that fish oil decreases NPC1L1 mRNA levels in the hamster intestine, and cholesterol absorption decreases due to the downregulation of its gene.33 However, in the present study, intestinal NPC1L1 mRNA levels were similar among the diet groups, indicating that 2 or 5 en% fish oil does not modify the absorption of cholesterol. The hepatic mRNA levels of FAS tended to decrease in the fish oil groups irrespective of cholesterol supplementation. However, no significant differences in hepatic SCD1 mRNA levels were induced by fish oil or cholesterol feeding. It has been reported that fish oil feeding decreases SREBP-1c mRNA expression and/or mature protein production and results in the inhibition of SREBP-1c target genes, such as ACC, FAS, and SCD1.15 In this study, different results were observed, suggesting that the inhibitory effect of fish oil on fatty acid biosynthesis inhibitory effect is dose-dependent. The hepatic mRNA expression of PPARα and AOX, genes involved in fatty acid oxidation, were significantly increased in the fish oil groups regardless of the addition of cholesterol. 13357
dx.doi.org/10.1021/jf203761t |J. Agric. Food Chem. 2011, 59, 13353–13359
Journal of Agricultural and Food Chemistry These increases were significant in the 2FO and 5FO groups as compared to their levels in the SO group. These results revealed that low-dose fish oil in high cholesterol diets effectively inhibits hepatic lipid accumulation by inducing fatty acid oxidation rather than reducing fatty acid biosynthesis. Many studies have reported that high cholesterol diets increase fecal cholesterol excretion.34,35 In the present study, fecal cholesterol excretion was increased in all groups when cholesterol was added, and these increases were higher when fish oil was used as the lipid source in the cholesterol-supplemented diets. In conclusion, 2 or 5 en% fish oil consumption, comprising approximately 1025% of the total fat energy, improves lipid metabolism in mice fed with a high cholesterol diet. This low-dose fish oil feeding affects lipid metabolism by modifying the expression of lipid metabolism-related genes in the liver and increasing fecal cholesterol excretion.
’ AUTHOR INFORMATION Corresponding Author
*Tel: 81-49-271-7234. Fax: 81-49-271-7247. E-mail: hyounju@ josai.ac.jp. Funding Sources
This study was supported in part by a grant-in-aid from the Japan Society for the Promotion of Science (JSPS).
’ DISCLOSURE Disclosure summary: The authors have nothing to declare. ’ ACKNOWLEDGMENT We thank Miki Harada for her assistance and NOF Corporation (Tokyo, Japan) for providing FO. ’ ABBREVIATIONS LXR, liver X receptor; SREBPs, sterol regulatory element-binding proteins; CYP7A1, cholesterol 7α-hydroxylase; ABCA1, ATPbinding cassette transporter A1; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; SCD, stearoyl-CoA desaturase; PPAR, peroxisome proliferator-activated receptor; AOX, acyl-CoA oxidase; UCP, uncoupling protein; NPC1L1, NiemannPick C1 like-1; H&E, hematoxylin eosin ’ REFERENCES (1) Lehmann, J. M.; Kliewer, S. A.; Moore, L. B.; Smith-Oliver, T. A.; Oliver, B. B.; Su, J. L.; Sundseth, S. S.; Winegar, D. A.; Blanchard, D. E.; Spencer, T. A.; Willson, T. M. Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway. J. Biol. Chem. 1997, 272, 3137–3140. (2) Schwartz, K.; Lawn, R. M.; Wade, D. P. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem. Biophys. Res. Commun. 2000, 274, 794–802. (3) Repa, J. J.; Liang, G.; Ou, J.; Bashmakov, Y.; Lobaccaro, J. M.; Shimomura, I.; Shan, B.; Brown, M. S.; Goldstein, J. L.; Mangelsdorf, D. J. Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptor, LXRα and LXRβ. Genes Dev. 2000, 14, 2819–2830. (4) Peet, D. J.; Turley, S. D.; Ma, W.; Janowski, B. A.; Lobaccaro, J. M.; Hammer, R. E.; Mangelsdorf, D. J. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXRα. Cell 1998, 93, 693–704.
ARTICLE
(5) Repa, J. J.; Turley, S. D.; Lobaccaro, J. A.; Medina, J.; Li, L.; Lustig, K.; Shan, B.; Heyman, R. A.; Dietschy, J. M.; Mangelsdorf, D. J. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science 2000, 289, 1524–1529. (6) Schultz, J. R.; Tu, H.; Luk, A.; Repa, J. J.; Medina, J. C.; Li, L.; Schwendner, S.; Wang, S.; Thoolen, M.; Mangelsdorf, D. J.; Lustig, K. D.; Shan, B. Role of LXRs in control of lipogenesis. Genes Dev. 2000, 14, 2831–2838. (7) Schwarz, M.; Russell, D. W.; Dietschy, J. M.; Turley, S. D. Alternate pathways of bile acid synthesis in the cholesterol 7α-hydroxylase knockout mouse are not upregulated by either cholesterol or cholestyramine feeding. J. Lipid Res. 2001, 42, 1594–1603. (8) Repa, J. J.; Berge, K. E.; Pomajzl, C.; Richardson, J. A.; Hobbs, H.; Mangelsdorf, D. J. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J. Biol. Chem. 2002, 277, 18793–18800. (9) Baranowski, M. Biological role of liver X receptors. J. Physiol. Pharmacol. 2008, 59, 31–55. (10) Hirako, S.; Kim, H. J.; Arai, T.; Chiba, H.; Matsumoto, A. Effect of concomitantly used fish oil and cholesterol on lipid metabolism. J. Nutr. Biochem. 2010, 21, 573–579. (11) Fabbrini, E.; Sullivan, S.; Klein, S. Obesity and nonalcoholic fatty liver disease: biochemical, metabolic, and clinical implications. Hepatology 2010, 51, 679–689. (12) Rustan, A. C.; Nossen, J. O.; Christiansen, E. N.; Drevon, C. A. Eicosapentaenoic acid reduces hepatic synthesis and secretion of triacylglycerol by decreasing the activity of acyl-coenzyme A:1,2- diacylglycerol acyltransferase. J. Lipid Res. 1988, 29, 1417–1426. (13) Halminski, M. A.; Marsh, J. B.; Harrison, E. H. Differential effects of fish oil, safflower oil and palm oil on fatty acid oxidation and glycerolipid synthesis in rat liver. J. Nutr. 1991, 121, 1554–1561. (14) Nestel, P. J. Effects of N-3 fatty acids on lipid metabolism. Annu. Rev. Nutr. 1990, 10, 149–167. (15) Kim, H. J.; Takahashi, M.; Ezaki, O. Fish oil feeding decreases mature sterol regulatory element-binding protein 1 (SREBP-1) by downregulation of SREBP-1c mRNA in mouse liver. J. Biol. Chem. 1999, 274, 25892–25898. (16) Xu, J.; Teran-Garcia, M.; Park, J. H.; Nakamura, M. T.; Clarke, S. D. Polyunsaturated fatty acids suppress hepatic sterol regulatory element-binding protein-1 expression by accelerating transcript decay. J. Biol. Chem. 2001, 276, 9800–9807. (17) Kim, H. J.; Miyazaki, M.; Ntambi, J. M. Dietary cholesterol opposes PUFA-mediated repression of the stearoyl-CoA desaturase-1 gene by SREBP-1 independent mechanism. J. Lipid Res. 2002, 43, 1750–1757. (18) Arai, T.; Kim, H. J.; Chiba, H.; Matsumoto, A. Interaction of fenofibrate and fish oil in relation to lipid metabolism in mice. J. Atheroscler. Thromb. 2009, 16, 283–291. (19) Nakatani, T.; Kim, H. J; Kaburagi, Y.; Yasuda, K.; Ezaki, O. A low fish oil inhibits SREBP-1 proteolytic cascade, while a high-fish-oil feeding decreases SREBP-1 mRNA in mice liver. J. Lipid Res. 2003, 44, 369–379. (20) Tsuboyama-Kasaoka, N.; Takahashi, M.; Kim, H. J.; Ezaki, O. Up-regulation of liver uncoupling protein-2 mRNA by either fish oil feeding or fibrate administration in mice. Biochem. Biophys. Res. Commun. 1999, 257, 879–885. (21) Nakatani, T.; Tsuboyama-Kasaoka, N.; Takahashi, M.; Miura, S.; Ezaki, O. Mechanism for peroxisome proliferator-activated receptorα activator induced up-regulation of UCP2 mRNA in rodent hepatocytes. J. Biol. Chem. 2002, 277, 9562–9569. (22) Folch, J.; Lees, M.; Sloane Stanley, G. H. A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem. 1957, 226, 497–509. (23) Arai, T.; Kim, H. J.; Chiba, H.; Matsumoto, A. Anti-obesity effect of fish oil and fish oil-fenofibrate combination in female KK mice. J. Atheroscler. Thromb. 2009, 16, 674–683. (24) De Craemer, D.; Vamecq, J.; Roels, F.; Vallee, L.; Pauwels, M.; Van den Branden, C. Peroxisomes in liver, heart, and kidney of mice fed a 13358
dx.doi.org/10.1021/jf203761t |J. Agric. Food Chem. 2011, 59, 13353–13359
Journal of Agricultural and Food Chemistry
ARTICLE
commercial fish oil preparation: Original data and review on peroxisomal changes induced by high-fat diets. J. Lipid Res. 1994, 35, 1241–1250. (25) Altmann, S. W.; Davis, H. R., Jr.; Zhu, L. J.; Yao, X.; Hoos, L. M.; Tetzloff, G.; Iyer, S. P.; Maguire, M.; Golovko, A.; Zeng, M.; Wang, L.; Murgolo, N.; Graziano, M. P. Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science 2004, 303, 1201–1204. (26) Davis, H. R., Jr.; Altmann, S. W. NiemannPick C1 Like 1 (NPC1L1) an intestinal sterol transporter. Biochim. Biophys. Acta 2009, 1791, 679–683. (27) Davis, H. R., Jr.; Zhu, L. J.; Hoos, L. M.; Tetzloff, G.; Maguire, M.; Liu, J.; Yao, X.; Iyer, S. P.; Lam, M. H.; Lund, E. G.; Detmers, P. A.; Graziano, M. P.; Altmann, S. W. Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis. J. Biol. Chem. 2004, 279, 33586–33592. (28) Garcia-Calvo, M.; Lisnock, J.; Bull, H. G.; Hawes, B. E.; Burnett, D. A.; Braun, M. P.; Crona, J. H.; Davis, H. R., Jr.; Dean, D. C.; Detmers, P. A.; Graziano, M. P.; Hughes, M.; Macintyre, D. E.; Ogawa, A.; O’Neill, K.; Iyer, S. P.; Shevell, D. E.; Smith, M. M.; Tang, Y. S.; Makarewicz, A. M.; Ujjainwalla, F.; Altmann, S. W.; Chapman, K. T.; Thornberry, N. A. The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1). Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 8132–8137. (29) Betters, J. L.; Yu, L. NPC1L1 and cholesterol transport. FEBS Lett. 2010, 584, 2740–2747. (30) Berge, K. E.; Tian, H.; Graf, G. A.; Yu, L.; Grishin, N. V.; Schultz, J.; Kwiterovich, P.; Shan, B.; Barnes, R.; Hobbs, H. H. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science 2000, 290, 1771–1775. (31) Yu, L.; Li-Hawkins, J.; Hammer, R. E.; Berge, K. E.; Horton, J. D.; Cohen, J. C.; Hobbs, H. H. Overexpression of ABCG5 and ABCG8 promotes biliary cholesterol secretion and reduces fractional absorption of dietary cholesterol. J. Clin. Invest. 2002, 110, 671–680. (32) Yu, L.; York, J.; von Bergmann, K.; Lutjohann, D.; Cohen, J. C.; Hobbs, H. H. Stimulation of cholesterol excretion by the liver X receptor agonist requires ATP-binding cassette transporters G5 and G8. J. Biol. Chem. 2003, 278, 15565–15570. (33) Mathur, S. N.; Watt, K. R.; Field, F. J. Regulation of intestinal NPC1L1 expression by dietary fish oil and docosahexaenoic acid. J. Lipid Res. 2007, 48, 395–404. (34) Wiersma, H.; Nijstad, N.; de Boer, J. F.; Out, R.; Hogewerf, W.; Van Berkel, T. J.; Kuipers, F.; Tietge, U. J. Lack of Abcg1 results in decreased plasma HDL cholesterol levels and increased biliary cholesterol secretion in mice fed a high cholesterol diet. Atherosclerosis 2009, 206, 141–147. (35) Wang, J.; Einarsson, C.; Murphy, C.; Parini, P.; Bj€ orkhem, I.; Gafvels, M.; Eggertsen, G. Studies on LXR- and FXR-mediated effects on cholesterol homeostasis in normal and cholic acid-depleted mice. J. Lipid Res. 2006, 47, 421–430.
13359
dx.doi.org/10.1021/jf203761t |J. Agric. Food Chem. 2011, 59, 13353–13359
