Mapping Subpopulations of Cancer Cell-Derived Extracellular

Subscriber access provided by Nottingham Trent University

Article

Mapping Subpopulations of Cancer Cell-Derived Extracellular Vesicles and Particles by Nano-Flow Cytometry Dongsic Choi, Laura Montermini, Hyeonju Jeong, Shivani Sharma, Brian Meehan, and Janusz Rak ACS Nano, Just Accepted Manuscript • DOI: 10.1021/acsnano.9b04480 • Publication Date (Web): 30 Aug 2019 Downloaded from pubs.acs.org on August 30, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Mapping Subpopulations of Cancer Cell-Derived Extracellular Vesicles and Particles by Nano-Flow Cytometry

Dongsic Choi1, Laura Montermini1, Hyeonju Jeong1, Shivani Sharma2, Brian Meehan1, and Janusz Rak1, *

1Research Institute of the McGill University Health Centre, Glen Site, McGill University, Montreal,

Quebec, H4A 3J1, Canada; 2California Nanosystems Institute, University of California at Los Angeles, Los Angeles, CA 90095

*To whom Correspondence should be addressed: Department of Pediatrics, McGill University, The Research Institute of the McGill University Health Centre, Montreal Children's Hospital, 1001 Decarie Blvd, Montreal, Quebec, Canada, Tel: +1-514-412-4400 (ex: 76240); Fax: +1-514- 4124331; E-mail: [email protected]

1 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT The elusive complexity of membranous extracellular vesicle (EVs) and membrane-less extracellular particle (EPs) populations released from various cellular sources contains clues as to their biological functions and diagnostic utility. In this study, we employed optimized multicolor nano-flow cytometry, structured illumination (SIM) and atomic force microscopy (AFM) to bridge sensitive detection at the single EV/EP level and high throughput analysis of cancer cell secretomes. We applied these approaches to particles released from intact cells driven by several different transforming mechanisms, or to cells under therapeutic stress imposed by pharmacological inhibition of their oncogenic drivers, such as epidermal growth factor receptor (EGFR). We demonstrate a highly heterogeneous distribution of biologically relevant elements of the EV/EP cargo, including oncoproteins (EGFR), clotting factors (tissue factor), pro-metastatic integrins (ITGA6, ITGA4), tetraspanins (CD63) and genomic DNA across the entire particulate secretome of cancer cells. We observed that targeting EGFR activity with irreversible kinase inhibitors (dacomitinib) triggers emission of DNA containing EP/EV subpopulations, including particles (chromatimeres) harboring both EGFR and DNase-resistant chromatin. While nano-flow cytometry enables quantification of these changes across the entire particular secretome, SIM reveals individual molecular topography of EV/EP subsets and AFM exposes some of their physical properties, including the presence of nanofilaments and other substructures. We describe differential uptake rates of distinct EV subsets, resulting in preferential internalization of exosomelike small EVs by cancer cells to the exclusion of larger EVs. Thus, our study illustrates the potential of nano-flow cytometry coupled with high resolution microscopy to explore the cancerrelated EV/EP landscape.


Page 2 of 39

Page 3 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

KEYWORDS: exosomes, ectosomes, extracellular DNA, single particles, nano- flow cytometry, heterogeneity


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Malignant transformation, along with microenvironmental and therapeutic stresses profoundly impact the particulate secretome of cancer cells.1,2 The constituent extracellular particles (EPs) and membranous vesicles (EVs) are actively shed from tumor cells reflecting their identity and state. In so doing, EVs/EPs also become central mediators of the molecular flux between cellular interior and exterior and may serve as conduits of information transfer between cells.3-5 In the case of EVs the molecular content (proteins, nucleic acids) is surrounded by a lipid bilayer decorated with proteins involved in diverse processes associated with vesicle biogenesis.6 These processes include direct budding of the cellular plasma membrane to form variable, but usually larger EVs (> 150 nm in diameter), often referred to as microvesicles (MVs), or ectosomes. Exocytosis of small intraluminal vesicles (5-fold) under-estimation by nano-flow cytometry (Figure 1E). Comparing with the NTA, nano-flow cytometry detected aproximately 10.3% of 100 nm standardized microspheres (Figure 1F) and approximately 5.3% of A431 EVs (Figure 1G). These results suggest that detected concentrations of homogeneous 100 nm polystyrene beads and heterogeneous EVs depend on their characteristics including size distribution and refractive indices, all of which determine the detection sensitivity of particles by NTA and nano-flow cytometry. We observed that CD63-GFP EVs were detectable after as little as 1 h of medium conditioning in the presence of cells, with subsequent time-dependent signal increase at relatively stable MFI values (Figure 1H–I), implying a high sensitivity of nano-flow cytometry for single EV/EP detection. Based on cell numbers, it could be calculated that a single A431-CD63/GFP cell releases approximately 38.9 EVs/hour and 25.4 CD63/GFP EVs/hour. These are net numbers that do not account for a possible re-uptake of EVs during 24 h culture under serum-free condition. It should be emphasized that A431-CD63/GFP cells are a variant of their parental A431 counterparts which have been engineered to over express a GFP tagged CD63 tertraspanin for easier EV tracking. While this manipulation enables florescent mapping and analysis of the EV output it also affects the release rate and composition of the resulting EVs (Figure S3A).

Nano-flow cytometry detection of exosome-like and ectosome-like vesicle populations. Using the aforementioned tools we subjected the A431 secretome to standard differential centrifugation aiming to purify large and small EVs at 10,000g (10K) and 110,000g (110K) sedimentation forces, respectively (Figure 2A). This separation revealed a predictable pattern of enrichment in CD9, 8 ACS Paragon Plus Environment

Page 8 of 39

Page 9 of 39

syntenin-1 and ALIX for the small (exosomal-like) EVs contained in the 110K fraction versus A

B Cell culture media - EV-depleted media - 3-day

A431 EVs (2.5E5 cells)

A431 EVs (2.5E5 cells)

Cell 10K 110K

Cell 10K 110K

24

Syntenin-1

102 76 250

GAPDH

102 76

EGFR

Calnexin

150

110K - 110,000g for 1 h

C

D 10K 110K

8×106

Actin

38 38 31

ALIX

10K - 10,000g for 30 min

ITGA6

102 52

38 31

Pre-clearing - 400g - 2,000g

150

CD9

18

Concentration (particles/mL)

Gigamix polystyrene beads

110K

10K

200

6×106

9638 ± 497 events/s

6175 ± 342 events/s 4×106

160 2×106

100 0

0

200

400

600

800

240 300 900 500

4719 ± 344 events/s

3120 ± 178 events/s

1000

Size (nm)

E

ITGA6 10K

ITGB4 110K

10K

110K

30.03%

7.05%

18.02%

4.32%

9.81%

5.53%

3.94%

3.14%

V-SSC-H

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

ITGA6-FITC

ITGB4-PE

Figure 2. Nano-flow cytometry differentiates EV fractions sedimented at different ultracentrifugation speeds. The corresponding fractions were obtained after 10,000g (10K) and 110,000g (110K) ultracentrifugation. (A) Experimental schema indicating steps in the isolation of 10K and 110K fractions for nano-flow cytometry. (B) Western blotting of 10K and 110K shows different molecular composition, including enrichment in exosomal maker proteins CD9, syntenin-1, ALIX in 110K but integrin (ITGA6) and cytosolic proteins (actin, GAPDH) enriched in 10K. (C) NTA analyses of 10K and 110K fractions shows the heterogeneous size distribution (10K: 361.4 ± 165.1 nm by 6374 completed tracks and 415 valid tracks, 110K: 262.3 ± 100.1 nm by 3215 completed tracks and 403

Figure 2

valid tracks). Experiments were conducted with three technical replicates. Calibration data with diluted beads and EVs for concentration and size are presented in Figure S5. (D) Nano-flow cytometry representation of the numerical excess of 10K EVs versus the 110K fraction in the gated region >100 nm of polystyrene beads; 4719 ± 344 events/s (43.3 ± 0.5%) in total 10894 ± 684 events/s for 10K and 3120 ± 178 events/s (24.5 ± 0.1%) in total 12758 ± 674 events/s for 110K. Experiments were conducted with


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

three technical replicates. (E) The differential size versus integrin (ITGA6 or ITGB4) distribution among EVs in the 10K and 110K fractions. Antigen positive regions were gated by same SEC fraction of IgG control (Figure S6).

larger (ectosomal-like) EVs.7 There was a more even distribution of EGFR and CD63 between 110K and 10K EVs, with comparable EV loading based on the same cell number (Figure 2B and S3A–B). Also, in the case of pro-metastatic integrins (ITGA6, ITGB4) their presence was evident in small EVs, as reported earlier,19 but surprisingly, more abundant in larger EVs (10K fraction) of the A431 conditioned media (Figure 2B). It should be mentioned that separation of EVs into the 10K and 110K fractions and the related nomenclature (exosome-like, ectosome-like) does not reflect the true heterogeneity of the particulate secretome. To extend this analysis to the single EV level, we first used transmission electron microscopy (TEM) to ascertain the expected larger EV sizes in the 10K fraction relative to their 110K counterparts (Figure S4A–B). Quantitative NTA profiles of this material showed a more complex pattern, with multiple peaks for both 110K and 10K preparations indicative of a broader size distribution of EV subpopulations, with 262.3 ± 100.1 nm and 361.4 ± 165.1 nm mean diameters, respectively (Figure 2C), consistent at different dilutions (Figure S5). Nano-flow cytometry gated for size detection (V-SSC) above 100 nm polystyrene beads reinforced this observation by documenting the larger sizes and broader size distributions of the 10K EV population versus EVs contained in the 110K fraction (Figure 2D). While nano-flow cytometry visualized differential sizes of EV subpopulation, those cannot be directly inferred from the calibration. Polystyrene beads have the higher refractive index than EVs affecting the detection by nano-flow cytometry.24,25 Although 100 nm polystyrene beads do not represent the actual size of EVs, they could provide a useful guidance as to detecting size distribution within EV/EP populations. This is illustrated by combined results of our NTA (Figure 2C) and TEM (Figure S4A–B) studies, as well as previous reports7,26 pointing to differential sizes 10 ACS Paragon Plus Environment

Page 10 of 39

Page 11 of 39

of EVs isolated under aforementioned ultracentrifugation conditions, which we suggest could be captured by nano-flow cytometry. Interestingly, staining of the respective EV preparations for ITGA6 or ITGB4, while congruent with bulk analysis, revealed additional diversity. Thus, ITGA6 and ITGB4 staining intensity was more pronounced among 10K EVs (~39.8% for ITGA6 and ~22.0% for ITGB4) than among 110K EVs (~12.6% for ITGA6 and ~7.5% for ITGB4), with both populations also containing relatively integrin-negative EVs of varying sizes (V-SSC; Figure 2E; Figure S6). A 10K/PKH26

110K/PKH67

10K/PKH26 110K/PKH67

10 µm

B

10 µm

110K/PKH26

10K/PKH67 110K/PKH26

10 µm

C

10K/PKH26 110K/PKH67 Hoechst

10 µm

10K/PKH67

10 µm

D

***

10 µm

10 µm

10 µm

10 µm

10K/PKH26 110K/PKH67 Hoechst

10 µm

14

10K/PKH67

110K/PKH26

***

12

*

10 Spots per cell

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

*

8 6

10 µm

10 µm

4 2 0 1

2

3

110K/PKH26

1

2

3

10K/PKH67

1

2

3

110K/PKH67

1

2

3

10K/PKH26

Co-treatment (n=3) of Co-treatment (n=3) of 110K/PKH26 and 10K/PKH67 110K/PKH67 and 10K/PKH26

10 µm 10 µm

Figure 3. Differential uptake of EV subsets by homologous cancer cells. (A, B) 10K and 110K EVs were isolated from 2  106 of PKH26- or PKH67-labeled A431 cells. From 1 mL of isolated EVs, the aliquot of 20 µL used for treatment of A431 recipients was equivalent to the output of 4 × 105 of A431 cells, for both 10K/PKH26 and 110K/PKH67 EVs (A) (or for 10K/PKH67 and 110K/PKH26 EVs in panel B). EVs were added to A431 cultures containing 104 cells in 400 µL of media for 18-h at: ~3.33  108 for


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

10K/PKH26 and ~2.95  108 for 110K/PKH26, and at ~3.50  108 for 10K/PKH67 and ~2.95  108 particles for 110K/PKH67. Panels A and B illustrate the preferential uptake of 110K EVs and different subcellular localization of EV subsets in recipient cells. (C) Internalized EVs from 10K/PKH26 and 110K/PKH67 (or 10K/PKH67 and 110K/PKH26) fractions were quantified by the total number of the particle spots per cell. Small 110K EVs were more readily taken up by recipient A431 cells. * and *** are the p-value < 0.05 and 0.001, respectively. Experiments were conducted with three biological replicates, each composed of 10 randomly taken images of individual cells. (D) Three-dimensional features of EV internalization involving 10K/PKH67 and 110K/PKH26 preparations were analyzed by confocal Z-stack comped of 7 images separated by 1 μm.

Differential cellular uptake of distinct EV subpopulations. EVs mediate intercellular transfer of molecular information between cancer and normal cell subsets,14,27,28 a process that relies on integrins and other receptors for target cell recognition.15,19,29 To determine whether EV heterogeneity affects their ability to interact with recipient cells we labelled 10K and 110K EV fractions with different fluorescent dyes (PKH26 and PKH67) in alternating combinations and incubated them with homologous cellular recipients (A431 cells) followed by high resolution confocal imaging (Figure 3). We validated these labelling techniques against alternative PKH26 and CD63 tags with some, but incomplete, overlap between them, further suggesting EV heterogeneity (Figure S4C). While smaller (110K) EVs were readily internalized, as indicated by characteristic accumulation of fluorescent spots in the perinuclear regions of recipient cells, the equivalent amounts of 10K EVs were not taken up efficiently (Figure 3A-D). This is consistent with the reported size-dependent uptake of polystyrene beads30 and it may also imply salient differences in corresponding biological activities.

Profiling complex immunophenotypes of particle populations in different cancer cell types. To gain further insights into the EV/EP heterogeneity we performed bulk (Western) and nano-flow cytometry analysis to compare EVs fractions released by tumor cells representing lung (A459), breast (MDA-MB-231), and epidermoid (A431) cancers. These cell populations co-express 12 ACS Paragon Plus Environment

Page 12 of 39

Page 13 of 39

different levels of two biologically important cell surface receptors, EGFR and tissue factor (TF/F3), endowed with potent oncogenic and procoagulant activities, respectively.31 Both TF and EGFR are known to undergo EV mediated emission and intercellular transfer, whereby they contribute to cancer progression.15,32 Whether these receptors are present on the same or different EV populations (with different functions) cannot be determined using bulk analysis32 (Figure 4A). Cell

1 23 B-M 49 DA 31 A5 M A4

B

EVs

1 23 B-M 49 DA 31 A5 M A4

CD63

Isotype control

TF/F3

Isotype control

V-SSC-H

A

EGFR

PE

SDCBP1

SDCBP1 (overexposure) GAPDH

C

A549

V-SSC-H

TF/F3

PE

MDA-MB-231

A431

EGFR-APC

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

TF/F3-PE

Figure 4. Mapping heterogeneity of EV landscapes among cancer cell populations. (A) Western blotting for epidermal growth factor receptor (EGFR), tissue factor (TF/F3) and EV marker syndecan binding protein 1/syntenin 1 (SDCBP1). indicative of different EGFR and TF/F3 expression patterns in lung (A549), breast (MDA-MB-231), and epidermoid (A431) cancer cells and their bulk EVs. (B) CD63- and TF/F3-positive EV population in A431 cancer cell conditioned media. EVs were isolated from 1 mL of conditioned medium collected after 24-h of incubation with cells. (C) Nano-flow cytometry analysis of EV subsets with different expression patterns of TF/F3 and EGFR: EVs from A549 cells were mostly double negative, from MDA-MB-231 breast cancer cells - mostly TF/F3- positive and EGFR-negative, and from A431 epidermoid cancer - partially double positive. Antigen positive regions were gated by same SEC fraction of IgG control (Figure S8).

13 Figure 4 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

To address this question, we first developed single EV profiles of exosomal (CD63), or ectosomal (CD147) markers (notwithstanding the more complex identity of the respective EVs),33 along with TF levels, for each of which we observed a robust signal (Figure 4B and S3C–D). To render these estimates more quantitative we calculated the absolute intensity of PE molecules linked to EV surfaces by the respective antibodies (Figure S7). The resulting average numbers of antigens per EV were in the range of 127–254 for CD63, and between 256 and 513 for TF/F3. For ITGB4 in Figure 2, the averages of 138–277 and 86–173 antigens were calculated for 10K and 110K EV fractions, respectively (Figure S7). We subsequently performed two color mapping of TF and EGFR expression patterns among EV subpopulations of the respective cancer cell lines (Figure 4C). Interestingly, while this analysis was consistent with the overall expression of EGFR and TF by tumor cell EVs, it also revealed the existence of distinct EV subpopulations. Thus, while EVs of A549 stained weakly for TF and EGFR, MBA-MD-231 EVs were largely positive (stained strongly) for TF and mostly negative for EGFR even though this receptor is present in cellular lysates (Figure 4A). A431 cells were positive for both receptors, while their EVs either co-expressed TF and EGFR, or carried only one of these receptors in a detectable abundance. This suggests that the same receptor may be presented in different molecular contexts of specific EV/EP subpopulations potentially resulting in different biological activities.

Changes in particle immunoreactivity and DNA content under therapeutic stress. Cancer cells profoundly alter their EV emission profile and activity in response to therapeutic agents.12,34,35 For example, anticancer effect of agents blocking oncogenic EGFR, such dacomitinib (PF-00299804) 14 ACS Paragon Plus Environment

Page 14 of 39

Page 15 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

or canertinib (CI-1033), result in increased emission of EVs/EPs harboring EGFR and genomic DNA.12 Whether these particles represent DNA-containing exosomes,36,37 other EVs,38,39 apoptotic bodies,12 or non-membranous EPs40 remains controversial. DNA containing EVs/EPs are also spontaneously released from viable cancer cells driven by oncogenic RAS16,37,38,41 (Figure S9).


ACS Nano

Control

PF-00299804

ZVAD

ZVAD+ PF00299804

B

C 30

***

25 % of DNA+ EVs

% of control (total events of DNA+ EVs)

A

V-SSC-H

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 39

***

20 15

*

10 5 0

PF-00299804 ZVAD

Picogreeen

D

Anti-CD63

CD63/GFP

10 µm

– –

+ –

– +

+ +

***

300

*** 200

100

**

0

PF-00299804 ZVAD

– –

+ –

– +

+ +

Merge

10 µm

10 µm

1 µm

1 µm

1 µm

10 µm

1 µm

1 µm

1 µm

10 µm

1 µm

1 µm

1 µm

10 µm

1 µm

1 µm

1 µm

10 µm

1 µm

1 µm

1 µm

E Anti-CD63

PicoGreen

10 µm

Merge

10 µm

Anti-EGFR

PicoGreen

10 µm

Merge

10 µm

F Anti-EGFR

CD63-FITC

10 µm

TF

Merge

10 µm

Anti-EGFR

10 µm

Merge

10 µm

Figure 5 to therapeutic inhibition of oncogenic EGFR. EVs/EPs Figure 5. Alteration of DNA positive particle emission profiles in response reveal the role of apoptosis in formation of particulate secretome of cancer cells. (A) Extracellular particle profiles in cultures of A431 cells either intact or treated with dacomitinib (PF-00299804), an irreversible inhibitor of EGFR. Events released from cells treated with 5 µM or PF-00299804 and/or 20 µM ZVAD were recorded by nano-flow cytometry. DNA positive particles (including EVs) were detected using membrane permeable PicoGreen dye. Antigen positive regions were gated by same SEC fraction of no


Page 17 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

PicoGreen control (Figure S11). (B) DNA-positive particles in conditioned media. The output of DNA-containing particles increased markedly in PF-00299804 treated cultures (from 12.3 ± 0.3% to 20.4 ± 1.1%), while caspase inhibitor, ZVAD, inhibited such release (to 12.2 ± 0.7%). (C) DNA positive particle subsets increased by approximately 2.3-fold in PF-00299804 treated cultures, but their upregulation was inhibited by ZVAD. *, **, and ***, are the p-value < 0.05, 0.01, and 0.001, respectively. (D) SIM image of single A431 particles (largely EVs) using dual labelling with anti-CD63 antibody and the genetic CD63-GFP tag reveals congruence of these techniques and structural complexity of individual EVs, containing domains enriched for CD63 labelled with either antibody or GFP, or both. (E) DNA positive particles were labeled with PicoGreen and either anti-CD63 or anti-EGFR antibodies. DNA positive EVs were more enriched in EGFR than CD63 suggesting different biogenesis. (F) Numerous EGFR positive EVs were also TF positive (see Figure 4C). A–C, experiments were conducted with three biological replications. E–F, arrow head indicates the double positive EV. High magnification images of single EVs for figure 5D and 5E were represented in Figure S13B–C. Quantitation of double positive EVs were indicated in Figure S8D.total number of small EVs/EPs post treatment as well as the emergence of a distinct population Figure 4. Mapping heterogeneity of EV landscapes among cancer cell populations.

Indeed, bulk analysis does not permit a conclusive determination as to whether DNA is associated with all, or some EVs (or EP) subsets a circumstance that obscures both the diagnostic (liquid biopsy) and functional properties of this material. To address this question, we employed nanoflow cytometry to examine, at a single EV/EP level, the DNA content of particles released from EGFR-driven A431 cells treated for 24 hours with 5 µM of PF-00299804, according to the previously validated protocol.12 The cells were incubated in growth media containing 5% of EV depleted FBS and the resulting EV/EPs were collected and labelled with PicoGreen, a membrane permeable fluorescent dye binding to double stranded DNA.42 Both control and inhibitor-treated A431 cells released DNA-positive EVs of different sizes (V-SSC versus PicoGreen; Figure 5A; Figures S10–S17), but the total number of the DNA-carrying particles was dramatically increased following PF-00299804 exposure (Figure 5A). This included an increase in the total number of small EVs/EPs post treatment, as well as the emergence of another population of DNA positive particles (Figure 5B-C; Figure S13). Similar data were also obtained with another EGFR inhibitor, CI-1033 (Figure S10). Notably, the release of DNA positive particles was blocked by pre-treatment with the caspase inhibitor, ZVAD, implying a role of the apoptotic vesiculation pathway (Figure 5A). Particulate DNA released from drug treated A431 cells was protected from exogenous DNase 17 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

I digestion and affected by 0.1% triton X-treatment (Figure S12) suggesting that this material, while heterogenous, represents mostly small apoptotic vesicles containing internal (luminal) chromatin, rather than free nucleosomes (Figure S12A), as recently suggested.40

Chromatimeres. To further explore the nature of DNA positive particles at the single EP level, we employed structured illumination microscopy (SIM) and atomic force microscopy (AFM)43 imaging. SIM resolution was validated by a complete co-localization between genetic tag-based (CD63-GFP) and immunofluorescent imaging for the CD63, an established EV marker, in several A431 EV/EP isolates. Of note was the distinction between the luminal (GFP) and surface fluorescence (antibody) associated with CD63 signals localized to individual EVs/EPs and suggesting internal complexity of these particles (Figure 5D; Figure S13). Again, in this setting both PF-00299804 and CI-1033 treatments led to the release of increased numbers of DNA positive EVs/EPs from A431 cells (Figure S10). Interestingly, the majority of these EVs were CD63-negative, but a large proportion stained for EGFR (Figure 5E). Moreover, EGFR positive EVs were also TF positive, but fewer carried CD63 (Figure 5F). AFM imaging enforced the heterogeneity of EV/EP populations and complexity of individual particles, including formation of nanofilaments attached to individual EPs/EVs43 (Figure S14-S16). Moreover, a large proportion of PicoGreen positive particles also stained for the cytoplasmic dye CellTracer Far Red and lipid binding dye DiD which suggests that these structures may contain cytoplasmic lumen and lipid plasma membrane, both attributed to EVs and not EPs (Figure S17). However, we cannot exclude a possibility that chromatin and proteins could also be packaged into solid EPs. Nonetheless, collectively these results suggest that DNA positive EVs/EPs may not be released through canonical exosomal,40 or EV biogenesis 18 ACS Paragon Plus Environment

Page 18 of 39

Page 19 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

pathways, but instead they may contain both protected chromatin and cell membrane proteins, such as EGFR. Due to these features we refer to these EVs/EPs as chromatimeres as their properties differ from known EV subtypes and require a more extensive analysis. In this study we sought to explore the use nano-flow cytometry and single particle imaging technologies to map EV/EP populations released from cancer cells, either spontaneously or upon therapeutic stress. Flow cytometry has recently become an increasingly reliable tool in dissecting21,23,44-47 and high volume sorting of EVs beyond the 100 nm size limit.21,22,48 We adapted these capacities to interrogate EVs/EPs released from oncogene-driven cancer cells. Our report points to intrinsic complexities of EV/EP subsets hitherto defined by physical bulk isolation and characterization methods and described as either small, exosome-like, EVs or larger MVs (ectosomes).4,7,49 We observed a much larger EV/EP diversity. Notably, cancer cells uniformly expressing surface-associated oncogenes, such as EGFR produce EVs enriched or depleted for this receptor, an observation suggestive of diverse biogenetic pathways and functions of such vesicles. This gives further credence to our earlier suggestion that it is the oncogenecontaining EV subpopulations, which we termed oncosomes,50 that may possess quasitransforming activities upon interaction with indolent cellular populations,14 while their oncogeneless counterparts released from the same cells may exhibit other activities. Interestingly, nano-flow cytometry provides valuable insights into the diversity of molecular contexts in which EGFR and other functionally important receptors are presented within individual EVs and their subpopulations. For example, A431 cells produce EVs double positive for EGFR and TF, but also EVs expressing either receptor alone. EV-associated TF is capable of transmitting the procoagulant activity between cells32,51 and has been implicated as an effector of cancer associated thrombosis (CAT).52 Indeed, it is through such EV-related export of TF into the blood stream that 19 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cancer cells may trigger a prothrombotic state.53 The co-expression of TF and EGFR in a subset of EVs may signify the existence of cellular microdomains where these receptors are both present. This is consistent with the reported ability of TF to transactivate EGFR in certain settings,54 a circumstance that may also impact the biological roles of single- or double-positive EV/EP subpopulations. Although nano-flow cytometry is capable of detecting single fluorescent EV, the measurable range of such ‘positivity’ is limited by size. We estimated that EV may carry 80–500 antigen molecules (Figure S7), which is much lower than estimated for cells (~100,000 antigens).24,55 Consequently the range of molecular representation (positive to negative) per flow cytometry event is much smaller for EVs. This suggests that nano-flow cytometry of EVs is intrinsically more dependent on instrument sensitivity and fluorophore intensity than conventional flow cytometry. Given the average background of mean fluorescence (PE-H) intensity of ~800, as observed in the present study, we gated the positive population upward of ~1800 units of PE-H intensity, which corresponds to the presence of approximately 30 additional PE molecules per EV defined as positive (30-60 additional epitopes). Since PE is brighter than other conventional fluorophores such as FITC and APC (see https://www.biolegend.com/en-us/brightness-index) these parameters may require reconsideration. Thus, assay calibration through measurement of absolute fluorophore content could improve definition of positive or negative EV/EP staining patterns. In this study we have also demonstrated that acute and irreversible blockade of the oncogenic EGFR drives cellular emission of genomic DNA through increased production of a wide spectrum of EVs/EPs. While earlier studies suggested that this may be a caspase-dependent process ultimately leading to apoptosis,12 the nature of different DNA containing EV or EP subpopulations 20 ACS Paragon Plus Environment

Page 20 of 39

Page 21 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

revealed by nano-flow cytometry is more complex and remains to be studied, to further distinguished these particles from free nucleosomes.40 We suggest that some of these questions may be addressed by combining nano-flow cytometry and super-resolution microscopy (SIM or AFM), which my reveal nano-domains and structural features within individual EV/EPs and shed more light on their origin and composition. Indeed, an improving resolution of diverse EV/EP subsets through the use of nano-flow cytometry raises questions as to whether a similar diversity also exists in their biological functions. In this regard, our studies point to a dramatically different cellular uptake of small exosome-like EVs versus larger MV from the same preparation. The poor uptake of larger EVs is surprising given

their higher expression levels of integrins implicated in EV-cell interactions.19 EV uptake

is controlled by a number of mechanisms including membrane fusion, endocytosis and macropinocytosis29,56,57 and it is of considerable interest to understand how these or other processes may account for the aforementioned differences. Differential EV/EP internalization processes are thought to be regulated by recipient cells, for example as a function of oncogenic transformation,16 surface properties29 and phagocytic phenotype.58 However, clearly, the properties of EVs/EPs themselves also play a role.19,59 The latter mandates a better grasp of the inner complexity of EV/EP subpopulations, for which, as our study documents, nano-flow cytometry in tandem with high resolution microscopy may offer an attractive solution.

CONCLUSIONS Nano-flow cytometry combined with high resolution microscopy offers insights into molecular, structural and functional diversity of the particulate secretome of cancer cells


ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

METHODS/EXPERIMENTAL Cell culture. A431, MDA-MB-231, and A549 cells were grown in Dulbecco’s modified essential medium (DMEM; Wisent, Canada) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Wisent, Canada) and 1% penicillin-streptomycin (Gibco-Life Technologies, Grand Island, NY) and RAS3 cells, tumorigenic variant of rat intestinal epithelial IEC18 cells transfected with the V12 mutant c-H-ras (HRAS) human oncogene, were grown in Alpha MEM medium (AMEM; Wisent, Canada) supplemented with 5% heat-inactivated FBS, 20 mM D-glucose, 4 mM L glutamine, and 10 µg/mL insulin, and 1% penicillin-streptomycin at 37ºC in 5% CO2.

Isolation of EV/EPs. Size exclusion chromatography (SEC) was applied to A431 CFSE EVs and CD63/GFP EVs. The conditioned medium was collected from cells grown for 72-h in culture media containing EV-depleted FBS (generated by centrifugation at 150,000g for 18-h at 4ºC). Collected conditioned medium was centrifuged once at 400g and 2000g for 10 min. The resulting supernatant was concentrated using Amicon Ultra-15 Centrifugal Filter Unit (EMD Millipore, Billerica, MA) with 100,000 NMWL molecular cut-off. Carboxyfluorescein succinimidyl ester (CFSE) was added at a concentration of 50 µM and incubated for 2-h at room temperature in the dark. To remove unlabeled CFSE, qEVsingle SEC column (Izon Science, UK) was applied; 1) 100 µL of sample was loaded, 2) 900 µL of PBS was added and 200 µL of fractions were collected (F1 to F5), 3) 600 µL of EV-enriched eluent was collected (F6–F8). Characterization of each fraction was conducted as in Figure S2. A431 CD63/GFP EVs/EPs were isolated using the same procedure without CFSE addition. For EV isolation through ultracentrifugation cells were grown for 72-h in the culture media containing 10% of EV-depleted FBS. Collected conditioned medium was centrifuged once at 400g and 2000g for 10 min for pre-clearing. The resulting supernatant was centrifuged at 22 ACS Paragon Plus Environment

Page 22 of 39

Page 23 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

110,000g for 1-h and the pellet was resuspended in PBS for further analyses. For the 10K and 110K EVs, the supernatant after pre-clearing was centrifuged at 10,000g for 30 min and 10K pellet was resuspended in PBS. The supernatant was further centrifuged at 110,000g for 1-h and 110K pellet was resuspended in PBS before use.

EV labeling with antibodies and analyses by nano-flow cytometry. A431 cells were plated in 12-well plate for 24-h at a concentration of 100,000 cells/mL overnight. Growth media was then replaced with 1 mL of serum-free media and incubated with cells for 24-h. Collecting conditioned medium was accomplished by centrifugation once at 400g and then at 2000g for 10 min. The resulting supernatant was concentrated upto 100 µL volume using Amicon Ultra-0.5 Centrifugal Filter Unit (EMD Millipore) with 100,000 NMWL molecular cut off. Concentrated medium or purified EVs were incubated with the indicated fluorophore-conjugated antibodies for 2-h at room temperature in the dark. To remove unbound antibodies, EVs were further isolated by SEC as indicated above. All experiments were conducted together with isotype controls matched with the corresponding antibodies. All fluorophore-conjugated antibodies were purchased from BioLegend (UK), including mouse anti-CD63 (PE and APC), mouse anti-CD9 (APC), mouse anti-TF/F3 (PE), mouse anti-CD147 (FITC), mouse anti-EGFR (APC), rat anti-ITGA6 (FITC), and mouse antiITGB4 (PE).

EV-DNA labeling with PicoGreen. A431 cells were plated in 12-well cluster plates for 24-h at a concentration of 100,000 cells/mL and starved with serum-free media overnight. The cells were then treated with 5 µM PF-00299804, 5 µM CI-1033, and/or 20 µM ZVAD in DMEM media containing 5% EV-depleted FBS, for 24-h to collect conditioned medium. The conditioned medium 23 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

was then centrifuged once at 400g and ten at 2000g for 10 min each. The resulting supernatant was concentrated upto the 50 µL volume using Amicon Ultra-0.5 Centrifugal Filter Unit (EMD Millipore, Billerica, MA) with 100,000 NMWL molecular cut off. For the DNase I treatment, additional step was added in that 1 µL of DNase I (2 units/µL) from TURBO DNA-free™ Kit (Thermo Fisher Scientific, San Jose, CA) was added in 50 µL of concentrated medium for 30 min at 37ºC. To label the dsDNA, 1 µL of Quant-iT™ PicoGreen™ dsDNA Reagent (PicoGreen; Thermo Fisher Scientific) was diluted in 50 µL of PBS, added into 50 µL of concentrated medium and incubated for 2-h at room temperature in the dark. EVs were further isolated by SEC as indicated above. For the Triton X-100 treatment, additional step was added in that 0.5 µL of 10% of Triton X-100 added to 50 µL of concentrated medium, final 0.1% Triton X-100, for 10 min at RT. Next, DNase I treatment or EV isolation by SEC were conducted for nano-flow cytometry analysis.

Nanoparticle tracking analysis. For the concentration and size distribution of 100 nm beads and EVs, NTA was carried out using NanoSight NS500 instrument 532 nm laser (NanoSight Ltd., UK). Three recordings of 30 sec at 37ºC were obtained and processed using NTA software (version 3.0).

Nano-flow cytometry. Nano-flow cytometry was performed using CytoFLEX system (Beckman Coulter, Pasadena, CA) equipped with 3 lasers (405, 488, and 640 nm wavelength). Detailed parameters are indicated in Table S1. The 405 nm violet laser for SSC (V-SSC) was selected with 1800 of manual threshold setting in V-SSC height channel and 100 of gain of V-SSC signal in the acquisition setting. Samples were loaded and run with slow flow rate (10 µL/min) for 1 minute until the event/s rate became stable, and then 20 second acquisition run was saved. Calibrating the 24 ACS Paragon Plus Environment

Page 24 of 39

Page 25 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Sample Flow Rate was conducted as followed in CytoFLEX Instructions by water weigh difference during 18 min acquisition with slow flow rate. Data were acquired and analyzed using CytExpert 2.0 software (Beckman Coulter) with events/s and events/mL. For events/mL calculation, background signal of control was subtracted. Percent of the gated region were calculated with the denominator of total events/s. The Gigamix beads are mixture of the equal volume of fluorescent Megamix-Plus SSC (BioCytex, France) and Megamix-Plus FSC beads (BioCytex) which have different sizes: 100, 160, 200, 240, 300, 500, and 900 nm. For the 100 nm and 200 nm beads, standard fluorescent polystyrene beads of 100 nm in diameter (NanoSight Ltd., UK) for NTA were used as callibrator. To compare the detected particle concentration between NTA and CytoFLEX, standard 100 nm Fluoresbrite® YG Microspheres (100 nm Microspheres) were used, supplied at known concentration of 4.55  1013 particles/mL, calculated by (6W × 1012)/(ρ × 𝝅 × 𝝋3) [W = grams of polymer per ml in latex (0.025g for a 2.5% latex); 𝝋 = diameter in microns of latex particles (consult label); ρ = density of polymer in grams per ml (1.05 for polystyrene)].

Western blotting. Cell lysates (10 µg) and proteins of 10K and 110K EV released from 2.5 × 105 cells for 3-day resolved by SDS-PAGE and then transferred to a polyvinylidene difluoride membrane. The membrane was blocked, incubated with primary antibody followed by the secondary antibody conjugated with horseradish peroxidase, and subjected to the enhanced chemiluminescence. All images were acquired by a ChemiDoc MP imager (Bio-Rad, Hercules, CA). Rabbit anti-EGFR, rabbit anti-ITGA6, mouse anti-ALIX, and goat anti-rabbit antibodies were purchased from Cell Signaling Technology (Beverly, MA). Rabbit anti-CANX, rabbit anti-CD9, rabbit anti-GAPDH, rabbit anti-syntenin-1 antibodies were purchased from Abcam (Cambridge, MA). Mouse anti-TF/F3 antibody was purchased from Sekisui Diagnostics (Stamford, CT). Mouse 25 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

anti-actin and goat anti-mouse IgG were purchased from Sigma (St. Louis, MO).

EV labeling with fluorescent dyes. A431 cells were resuspended in 1 mL of Diluent C (Sigma), mixed with 1 mL of 4 µM of PKH26 or PKH67 (Sigma) in Diluent C, and incubated for 5 min at room temperature in the dark. To stop the labeling, 2 ml of FBS was added to the mixture, incubated for 1 min and washed with PBS. Cells were grown in culture media supplemented with 10% of EV-depleted FBS for 72-h and conditioned medium was further processed as above, according to the procedure for isolation of 10K and 110K EVs. Equal portion of fluorophore labeled 10K and 110K EVs from 4 × 104 cell number were added to 10,000 of 431 cells previously seeded in µSlide 8-Well ibiTreat chambered coverslips (ibidi, Germany) and incubated for 18-h. For immunofluorescence, cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% tween-20 in PBS. The cells were blocked with 1% of BSA whereas the nuclei were labeled with Nucblue DNA binding dye (Thermo Fisher Scientific). Images were collected using LSM780 confocal microscope (Carl Zeiss, Thornwood, NY) with the 63×/1.40 objective. To quantify the EV uptake per cells, EV internalization from 10 randomly selected images in three biologcail replicates was quantified by using the ‘Analyze Particles’ feature in Fiji (https://fiji.sc). In each RAW file, single channel images were created by split channel command. Cell numbers were manually counted in a channel image of Nucblue DNA binding dye. The channel images of PKH26 and PKH67 were adjusted in Threshold command from 1,200 to 65,535 and Watershed command. Total particle numbers in a channel image were counted by Analyze Particles command with these options: Size (µm^2), 0.1–0.4; Circularity, 0.01–1.00.

Structured illumination microscopy. Purified EVs by SEC were loaded on ibiTreat chambered 26 ACS Paragon Plus Environment

Page 26 of 39

Page 27 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

coverslips (ibidi) and incubated at 37ºC for overnight. The EVs on the coverslips were blocked with 1% of BSA in PBS for 1-h at RT and incubated with indicated antibody or/and PicoGreen at RT for 2-h. Unbound antibody or PicoGreen were washed with PBS, 3 times. Images were collected using LSM880 ElyraPS1 super-resolution microscope (Carl Zeiss) with the 63×/1.40 objective.

PCR. DNA was extracted from the different fractions adding 1 Volume of 2× Lysis Buffer (0.2M Tris pH 8.0, 0.4M NaCl, 10mM EDTA, 0.4% SDS), 0.1 mg/ml of proteinase K, and incubated at 37°C for 2-h. Following isopropanol precipitation, the DNA was resuspended in 50 µL of distilled water. DNA isolated (5 µL) from each fraction was amplified using human specific H-ras primers (H-ras

For:

5’-GCAGGAGACCCTGTA

TGGCACCTGGACGGCGGCGCCAG-3’)

GGAGGACCC-3’ human

beta-actin

and

H-ras

primers

Rev: (Act

5’For:

5’GCACCACACCTTCTACAATGA and Act Rev: TCATCTTCTCGCGGTTGGC), human GAPDH primers (GAPDH For: 5’AAGGGCCCTGACAACTCTTTT and GAPDH Rev: 5’ CTGGTGGTCCAGGGGTCTTA),

or

rat

beta-actin

primers

(Act

For:

5’-

ACCCCAGCCATGTACGTAG and Act Rev: 5’- AGCGCGTAACCCTCATAGAT). The PCR cycling conditions were as follows: 1 × (95°C for 10 min), 35 × (95°C for 30 s, 64°C for 30 s, 72°C for 30 s), 1 × (72°C for 5 min, 4°C hold). Amplified PCR products were resolved on 2% Agarose gel and the DNA bands are visualized using ultraviolet (UV) transilluminator gel documentation system.

ASSOCIATED CONTENT Supporting Information 27 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Supplementary Figures S1−S17 and Extended Methods contain additional control, quantification and imaging experiments that strengthen the content of the manuscript and are cited in the text. This material is available via the Internet access at http://pubs.acs.org.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected]. Tel: +1-514-412-4400 (ex: 76240).

Author Contributions D.C., L.M., and J.R. conceived and designed the experiments; D.C., L.M., H.J., S.S., and B.M. performed all the experiments. D.C., L.M., S.S., and J.R. analyzed and discussed the data and wrote the paper. All authors have given approval to the final version of the manuscript.

ACKNOWLEDGMENTS This work was supported by the Foundation Grant (FDN 143322) from Canadian Institutes for Health Research to J. Rak, who is also a recipient of the Jack Cole Chair in Pediatric Hematology/Oncology. Infrastructure funds were also provided by the Fonds de Recherche en Santé du Quebec (FRSQ). We are especially grateful to the Montreal Children’s Hospital Foundation and Donors for supporting our purchase of the Nano-flow cytometry Instrument. We thank the Immunophenotyping Platform for nano-flow cytometry and Molecular Imaging Platform support during imaging analyses conducted at the RI-MUHC. REFERENCES 1.

Choi, D.; Lee, T. H.; Spinelli, C.; Chennakrishnaiah, S.; D'Asti, E.; Rak, J., Extracellular 28 ACS Paragon Plus Environment

Page 28 of 39

Page 29 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Vesicle Communication Pathways as Regulatory Targets of Oncogenic Transformation. Semin. Cell Dev. Biol. 2017, 67, 11–22. 2.

Rak, J., Extracellular Vesicles - Biomarkers and Effectors of the Cellular Interactome in

Cancer. Front. Pharmacol. 2013, 4, 21. 3.

van Niel, G.; D'Angelo, G.; Raposo, G., Shedding Light on the Cell Biology of

Extracellular Vesicles. Nat. Rev. Mol. Cell Biol. 2018, 19, 213–228. 4.

Zhang, H.; Freitas, D.; Kim, H. S.; Fabijanic, K.; Li, Z.; Chen, H.; Mark, M. T.; Molina,

H.; Martin, A. B.; Bojmar, L.; Fang, J.; Rampersaud, S.; Hoshino, A.; Matei, I.; Kenific, C. M.; Nakajima, M.; Mutvei, A. P.; Sansone, P.; Buehring, W.; Wang, H.; et al. Identification of Distinct Nanoparticles and Subsets of Extracellular Vesicles by Asymmetric Flow Field-Flow Fractionation. Nat. Cell Biol. 2018, 20, 332–343. 5.

Thery, C.; Witwer, K. W.; Aikawa, E.; Alcaraz, M. J.; Anderson, J. D.; Andriantsitohaina,

R.; Antoniou, A.; Arab, T.; Archer, F.; Atkin-Smith, G. K.; Ayre, D. C.; Bach, J. M.; Bachurski, D.; Baharvand, H.; Balaj, L.; Baldacchino, S.; Bauer, N. N.; Baxter, A. A.; Bebawy, M.; Beckham, C.; et al. Minimal Information for Studies of Extracellular Vesicles 2018 (MISEV2018): a Position Statement of the International Society for Extracellular Vesicles and Update of the MISEV2014 Guidelines. J. Extracell. Vesicles 2018, 7, 1535750. 6.

Colombo, M.; Raposo, G.; Thery, C., Biogenesis, Secretion, and Intercellular Interactions

of Exosomes and Other Extracellular Vesicles. Annu. Rev. Cell Dev. Biol. 2014, 30, 255–289. 7.

Kowal, J.; Arras, G.; Colombo, M.; Jouve, M.; Morath, J. P.; Primdal-Bengtson, B.; Dingli, 29 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

F.; Loew, D.; Tkach, M.; Thery, C., Proteomic Comparison Defines Novel Markers to Characterize Heterogeneous Populations of Extracellular Vesicle Subtypes. Proc. Natl. Acad. Sci. U. S. A. 2016, 113, E968–E977. 8.

Choi, D.; Spinelli, C.; Montermini, L.; Rak, J., Oncogenic Regulation of Extracellular

Vesicle Proteome and Heterogeneity. Proteomics 2019, 19, e1800169. 9.

Spinelli, C.; Adnani, L.; Choi, D.; Rak, J., Extracellular Vesicles as Conduits of Non-

Coding RNA Emission and Intercellular Transfer in Brain Tumors. Non-coding RNA 2018, 5, 1. 10.

Takamori, S.; Holt, M.; Stenius, K.; Lemke, E. A.; Gronborg, M.; Riedel, D.; Urlaub, H.;

Schenck, S.; Brugger, B.; Ringler, P.; Muller, S. A.; Rammner, B.; Grater, F.; Hub, J. S.; De Groot, B. L.; Mieskes, G.; Moriyama, Y.; Klingauf, J.; Grubmuller, H.; Heuser, J.; Wieland, F.; Jahn, R., Molecular Anatomy of a Trafficking Organelle. Cell 2006, 127, 831–846. 11.

Arraud, N.; Linares, R.; Tan, S.; Gounou, C.; Pasquet, J. M.; Mornet, S.; Brisson, A. R.,

Extracellular Vesicles from Blood Plasma: Determination of Their Morphology, Size, Phenotype and Concentration. J. Thromb. Haemostasis 2014, 12, 614–27. 12.

Montermini, L.; Meehan, B.; Garnier, D.; Lee, W. J.; Lee, T. H.; Guha, A.; Al-Nedawi,

K.; Rak, J., Inhibition of Oncogenic Epidermal Growth Factor Receptor Kinase Triggers Release of Exosome-Like Extracellular Vesicles and Impacts Their Phosphoprotein and DNA Content. The J. Biol. Chem. 2015, 290, 24534–24546. 13.

Garnier, D.; Meehan, B.; Kislinger, T.; Daniel, P.; Sinha, A.; Abdulkarim, B.; Nakano, I.;

Rak, J., Divergent Evolution of Temozolomide Resistance in Glioblastoma Stem Cells is Reflected 30 ACS Paragon Plus Environment

Page 30 of 39

Page 31 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

in Extracellular Vesicles and Coupled with Radiosensitization. Neuro Oncol. 2018, 20, 236–248. 14.

Al-Nedawi, K.; Meehan, B.; Micallef, J.; Lhotak, V.; May, L.; Guha, A.; Rak, J.,

Intercellular Transfer of the Oncogenic Receptor EGFRvIII by Microvesicles Derived from Tumour Cells. Nat. Cell Biol. 2008, 10, 619–624. 15.

Al-Nedawi, K.; Meehan, B.; Kerbel, R. S.; Allison, A. C.; Rak, J., Endothelial Expression

of Autocrine VEGF upon the Uptake of Tumor-Derived Microvesicles Containing Oncogenic EGFR. Proc. Natl. Acad. Sci. U. S. A. 2009, 106, 3794–3799. 16.

Lee, T. H.; Chennakrishnaiah, S.; Meehan, B.; Montermini, L.; Garnier, D.; D'Asti, E.;

Hou, W.; Magnus, N.; Gayden, T.; Jabado, N.; Eppert, K.; Majewska, L.; Rak, J., Barriers to Horizontal Cell Transformation by Extracellular Vesicles Containing Oncogenic H-ras. Oncotarget 2016, 7, 51991–52002. 17.

Ricklefs, F. L.; Alayo, Q.; Krenzlin, H.; Mahmoud, A. B.; Speranza, M. C.; Nakashima,

H.; Hayes, J. L.; Lee, K.; Balaj, L.; Passaro, C.; Rooj, A. K.; Krasemann, S.; Carter, B. S.; Chen, C. C.; Steed, T.; Treiber, J.; Rodig, S.; Yang, K.; Nakano, I.; Lee, H.; et al. Immune Evasion Mediated by PD-L1 on Glioblastoma-Derived Extracellular Vesicles. Sci. Adv. 2018, 4, eaar2766. 18.

Peinado, H.; Aleckovic, M.; Lavotshkin, S.; Matei, I.; Costa-Silva, B.; Moreno-Bueno, G.;

Hergueta-Redondo, M.; Williams, C.; Garcia-Santos, G.; Ghajar, C. M.; Nitadori-Hoshino, A.; Hoffman, C.; Badal, K.; Garcia, B. A.; Callahan, M. K.; Yuan, J.; Martins, V. R.; Skog, J.; Kaplan, R. N.; Brady, M. S.; et al. Melanoma Exosomes Educate Bone Marrow Progenitor Cells Toward a Pro-Metastatic Phenotype through MET. Nat. Med. 2012, 18, 833–891. 31 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

19.

Hoshino, A.; Costa-Silva, B.; Shen, T. L.; Rodrigues, G.; Hashimoto, A.; Tesic, M. M.;

Molina, H.; Kohsaka, S.; Di, G. A.; Ceder, S.; Singh, S.; Williams, C.; Soplop, N.; Uryu, K.; Pharmer, L.; King, T.; Bojmar, L.; Davies, A. E.; Ararso, Y.; Zhang, T.; et al. Tumour Exosome Integrins Determine Organotropic Metastasis. Nature 2015, 527, 329–335. 20.

Nolan, J. P., Flow Cytometry of Extracellular Vesicles: Potential, Pitfalls, and Prospects.

Curr. Protoc. Cytom. 2015, 73, 13.14.1–16. 21.

Higginbotham, J. N.; Zhang, Q.; Jeppesen, D. K.; Scott, A. M.; Manning, H. C.; Ochieng,

J.; Franklin, J. L.; Coffey, R. J., Identification and Characterization of EGF Receptor in Individual Exosomes by Fluorescence-Activated Vesicle Sorting. J. Extracell. Vesicles 2016, 5, 29254. 22.

van der Vlist, E. J.; Nolte-'t Hoen, E. N.; Stoorvogel, W.; Arkesteijn, G. J.; Wauben, M.

H., Fluorescent Labeling of Nano-Sized Vesicles Released by Cells and Subsequent Quantitative and Qualitative Analysis by High-Resolution Flow Cytometry. Nat. Protoc. 2012, 7, 1311–1326. 23.

van der Pol, E.; van Gemert, M. J.; Sturk, A.; Nieuwland, R.; van Leeuwen, T. G., Single

vs. Swarm Detection of Microparticles and Exosomes by Flow Cytometry. J. Thromb. Haemostasis 2012, 10, 919–930. 24.

Welsh, J. A.; Kepley, J.; Rosner, A.; Horak, P.; Berzofsky, J. A.; Jones, J. C., Prospective

Use of High-Refractive Index Materials for Single Molecule Detection in Flow Cytometry. Sensors 2018, 18, 2461. 25.

van der Pol, E.; Sturk, A.; van Leeuwen, T.; Nieuwland, R.; Coumans, F., Standardization

of Extracellular Vesicle Measurements by Flow Cytometry through Vesicle Diameter 32 ACS Paragon Plus Environment

Page 32 of 39

Page 33 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Approximation. J. Thromb. Haemostasis 2018, 16, 1236–1245. 26.

Muralidharan-Chari, V.; Clancy, J.; Plou, C.; Romao, M.; Chavrier, P.; Raposo, G.; Souza-

Schorey, C., ARF6-Regulated Shedding of Tumor Cell-Derived Plasma Membrane Microvesicles. Curr. Biol. 2009, 19, 1875–1885. 27.

Koch, R.; Demant, M.; Aung, T.; Diering, N.; Cicholas, A.; Chapuy, B.; Wenzel, D.;

Lahmann, M.; Guntsch, A.; Kiecke, C.; Becker, S.; Hupfeld, T.; Venkataramani, V.; Ziepert, M.; Opitz, L.; Klapper, W.; Trumper, L.; Wulf, G. G., Populational Equilibrium through ExosomeMediated Wnt Signaling in Tumor Progression of Diffuse Large B-Cell Lymphoma. Blood 2014, 123, 2189–2198. 28.

Ricklefs, F.; Mineo, M.; Rooj, A. K.; Nakano, I.; Charest, A.; Weissleder, R.; Breakefield,

X. O.; Chiocca, E. A.; Godlewski, J.; Bronisz, A., Extracellular Vesicles from High-Grade Glioma Exchange Diverse Pro-Oncogenic Signals that Maintain Intratumoral Heterogeneity. Cancer Res. 2016, 76, 2876–2881. 29.

Christianson, H. C.; Svensson, K. J.; van Kuppevelt, T. H.; Li, J. P.; Belting, M., Cancer

Cell Exosomes Depend on Cell-Surface Heparan Sulfate Proteoglycans for Their Internalization and Functional Activity. Proc. Natl. Acad. Sci. U. S. A. 2013, 110, 17380–17385. 30.

Foged, C.; Brodin, B.; Frokjaer, S.; Sundblad, A., Particle Size and Surface Charge Affect

Particle Uptake by Human Dendritic Cells in an In Vitro Model. Int. J. Pharm. 2005, 298, 315– 322. 31.

Magnus, N.; Garnier, D.; Meehan, B.; McGraw, S.; Lee, T. H.; Caron, M.; Bourque, G.; 33 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Milsom, C.; Jabado, N.; Trasler, J.; Pawlinski, R.; Mackman, N.; Rak, J., Tissue Factor Expression Provokes Escape from Tumor Dormancy and Leads to Genomic Alterations. Proc. Natl. Acad. Sci. U. S. A. 2014, 111, 3544–3549. 32.

Garnier, D.; Magnus, N.; Lee, T. H.; Bentley, V.; Meehan, B.; Milsom, C.; Montermini,

L.; Kislinger, T.; Rak, J., Cancer Cells Induced to Express Mesenchymal Phenotype Release Exosome-Like Extracellular Vesicles Carrying Tissue Factor. J. Biol. Chem. 2012, 287, 43565– 43572. 33.

Choi, D.; Montermini, L.; Kim, D. K.; Meehan, B.; Roth, F. P.; Rak, J., The Impact of

Oncogenic EGFRvIII on the Proteome of Extracellular Vesicles Released from Glioblastoma Cells. Mol. Cell. Proteomics 2018, 17, 1948–1964. 34.

Keklikoglou, I.; Cianciaruso, C.; Guc, E.; Squadrito, M. L.; Spring, L. M.; Tazzyman, S.;

Lambein, L.; Poissonnier, A.; Ferraro, G. B.; Baer, C.; Cassara, A.; Guichard, A.; Iruela-Arispe, M. L.; Lewis, C. E.; Coussens, L. M.; Bardia, A.; Jain, R. K.; Pollard, J. W.; De Palma, M., Chemotherapy Elicits Pro-Metastatic Extracellular Vesicles in Breast Cancer Models. Nat. Cell Biol. 2019, 21, 190–202. 35.

Yu, X.; Harris, S. L.; Levine, A. J., The Regulation of Exosome Secretion: a Novel

Function of the P53 Protein. Cancer Res. 2006, 66, 4795–4801. 36.

Balaj, L.; Lessard, R.; Dai, L.; Cho, Y. J.; Pomeroy, S. L.; Breakefield, X. O.; Skog, J.,

Tumour Microvesicles Contain Retrotransposon Elements and Amplified Oncogene Sequences. Nat. Commun. 2011, 2, 180. 34 ACS Paragon Plus Environment

Page 34 of 39

Page 35 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

37.

Kahlert, C.; Melo, S. A.; Protopopov, A.; Tang, J.; Seth, S.; Koch, M.; Zhang, J.; Weitz,

J.; Chin, L.; Futreal, A.; Kalluri, R., Identification of Double-Stranded Genomic DNA Spanning All Chromosomes with Mutated KRAS and P53 DNA in the Serum Exosomes of Patients with Pancreatic Cancer. J. Biol. Chem. 2014, 289, 3869–3875. 38.

Lee, T. H.; Chennakrishnaiah, S.; Audemard, E.; Montermini, L.; Meehan, B.; Rak, J.,

Oncogenic Ras-Driven Cancer Cell Vesiculation Leads to Emission of Double-Stranded DNA Capable of Interacting with Target Cells. Biochem. Biophys. Res. Commun. 2014, 451, 295–301. 39.

Lazaro-Ibanez, E.; Sanz-Garcia, A.; Visakorpi, T.; Escobedo-Lucea, C.; Siljander, P.;

yuso-Sacido, A.; Yliperttula, M., Different gDNA Content in the Subpopulations of Prostate Cancer Extracellular Vesicles: Apoptotic Bodies, Microvesicles, and Exosomes. Prostate 2014, 74, 1379–1390. 40.

Jeppesen, D. K.; Fenix, A. M.; Franklin, J. L.; Higginbotham, J. N.; Zhang, Q.;

Zimmerman, L. J.; Liebler, D. C.; Ping, J.; Liu, Q.; Evans, R.; Fissell, W. H.; Patton, J. G.; Rome, L. H.; Burnette, D. T.; Coffey, R. J., Reassessment of Exosome Composition. Cell 2019, 177, 428– 445. 41.

Thakur, B. K.; Zhang, H.; Becker, A.; Matei, I.; Huang, Y.; Costa-Silva, B.; Zheng, Y.;

Hoshino, A.; Brazier, H.; Xiang, J.; Williams, C.; Rodriguez-Barrueco, R.; Silva, J. M.; Zhang, W.; Hearn, S.; Elemento, O.; Paknejad, N.; Manova-Todorova, K.; Welte, K.; Bromberg, J.; Peinado, H.; Lyden, D., Double-Stranded DNA in Exosomes: a Novel Biomarker in Cancer Detection. Cell Res. 2014, 24, 766–769. 42.

Singer, V. L.; Jones, L. J.; Yue, S. T.; Haugland, R. P., Characterization of PicoGreen 35 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Reagent and Development of a Fluorescence-Based Solution Assay for Double-Stranded DNA Quantitation. Anal. Biochem. 1997, 249, 228–238. 43.

Sharma, S.; Rasool, H. I.; Palanisamy, V.; Mathisen, C.; Schmidt, M.; Wong, D. T.;

Gimzewski, J. K., Structural-Mechanical Characterization of Nanoparticle Exosomes in Human Saliva, Using Correlative AFM, FESEM, and Force Spectroscopy. ACS Nano 2010, 4, 1921–1926. 44.

Williams, K. C.; Cepeda, M. A.; Javed, S.; Searle, K.; Parkins, K. M.; Makela, A. V.;

Hamilton, A. M.; Soukhtehzari, S.; Kim, Y.; Tuck, A. B.; Ronald, J. A.; Foster, P. J.; Chambers, A. F.; Leong, H. S., Invadopodia are Chemosensing Protrusions that Guide Cancer Cell Extravasation to Promote Brain Tropism in Metastasis. Oncogene 2019, 38, 3598–3615. 45.

Padda, R. S.; Deng, F. K.; Brett, S. I.; Biggs, C. N.; Durfee, P. N.; Brinker, C. J.; Williams,

K. C.; Leong, H. S., Nanoscale Flow Cytometry to Distinguish Subpopulations of Prostate Extracellular Vesicles in Patient Plasma. Prostate 2019, 79, 592–603. 46.

Stoner, S. A.; Duggan, E.; Condello, D.; Guerrero, A.; Turk, J. R.; Narayanan, P. K.; Nolan,

J. P., High Sensitivity Flow Cytometry of Membrane Vesicles. Cytometry, Part A 2016, 89, 196– 206. 47.

Morales-Kastresana, A.; Telford, B.; Musich, T. A.; McKinnon, K.; Clayborne, C.; Braig,

Z.; Rosner, A.; Demberg, T.; Watson, D. C.; Karpova, T. S.; Freeman, G. J.; DeKruyff, R. H.; Pavlakis, G. N.; Terabe, M.; Robert-Guroff, M.; Berzofsky, J. A.; Jones, J. C., Labeling Extracellular Vesicles for Nanoscale Flow Cytometry. Sci. Rep. 2017, 7, 1878. 48.

Higginbotham, J. N.; Demory, B. M.; Gephart, J. D.; Franklin, J. L.; Bogatcheva, G.; 36 ACS Paragon Plus Environment

Page 36 of 39

Page 37 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Kremers, G. J.; Piston, D. W.; Ayers, G. D.; McConnell, R. E.; Tyska, M. J.; Coffey, R. J., Amphiregulin Exosomes Increase Cancer Cell Invasion. Curr. Biol. 2011, 21, 779–786. 49.

Lee, T. H.; D'Asti, E.; Magnus, N.; Al-Nedawi, K.; Meehan, B.; Rak, J., Microvesicles as

Mediators of Intercellular Communication in Cancer - the Emerging Science of Cellular 'Debris'. Semin. Immunopathol. 2011, 33, 455–467. 50.

Meehan, B.; Rak, J.; Di Vizio, D., Oncosomes - Large and Small: What are They, Where

They Came from? J. Extracell. Vesicles 2016, 5, 33109. 51.

Yu, J. L.; Rak, J. W., Shedding of Tissue Factor (TF)-Containing Microparticles rather

than Alternatively Spliced TF is the Main Source of TF Activity Released from Human Cancer Cells. J. Thromb. Haemost. 2004, 2, 2065–2067. 52.

Geddings, J. E.; Mackman, N., Tumor-Derived Tissue Factor-Positive Microparticles and

Venous Thrombosis in Cancer Patients. Blood 2013, 122, 1873–1880. 53.

Hisada, Y.; Mackman, N., Mouse Models of Cancer-Associated Thrombosis. Thromb. Res.

2018, 164 Suppl 1, S48–S53. 54.

Wiiger, M. T.; Prydz, H., The Epidermal Growth Factor Receptor (EGFR) and Proline

Rich Tyrosine Kinase 2 (PYK2) are Involved in Tissue Factor Dependent Factor VIIa Signalling in HaCaT Cells. Thromb. Haemost. 2004, 92, 13–22. 55.

Morales-Kastresana, A.; Jones, J. C., Flow Cytometric Analysis of Extracellular Vesicles.

Methods Mol. Biol. 2017, 1545, 215–225. 37 ACS Paragon Plus Environment

ACS Nano 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

56.

Mulcahy, L. A.; Pink, R. C.; Carter, D. R., Routes and Mechanisms of Extracellular

Vesicle Uptake. J. Extracell. Vesicles 2014, 3, 24641. 57.

French, K. C.; Antonyak, M. A.; Cerione, R. A., Extracellular Vesicle Docking at the

Cellular Port: Extracellular Vesicle Binding and Uptake. Semin. Cell Dev. Biol. 2017, 67, 48–55. 58.

Chennakrishnaiah, S.; Meehan, B.; D'Asti, E.; Montermini, L.; Lee, T. H.; Karatzas, N.;

Buchanan, M.; Tawil, N.; Choi, D.; Divangahi, M.; Basik, M.; Rak, J., Leukocytes as a Reservoir of Circulating Oncogenic DNA and Regulatory Targets of Tumor-Derived Extracellular Vesicles. J. Thromb. Haemost. 2018, 16, 1800–1813. 59.

Spinelli, C.; Montermini, L.; Meehan, B.; Brisson, A. R.; Tan, S.; Choi, D.; Nakano, I.;

Rak, J., Molecular Subtypes and Differentiation Programmes of Glioma Stem Cells as Determinants of Extracellular Vesicle Profiles and Endothelial Cell-Stimulating Activities. J. Extracell. Vesicles 2018, 7, 1490144.


Page 38 of 39

Page 39 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

TOC GRAPHIC


Mapping Subpopulations of Cancer Cell-Derived Extracellular

Recommend Documents