Article pubs.acs.org/JAFC
Maternal Betaine Supplementation during Gestation Enhances Expression of mtDNA-Encoded Genes through D‑Loop DNA Hypomethylation in the Skeletal Muscle of Newborn Piglets Yimin Jia, Haogang Song, Guichao Gao, Demin Cai, Xiaojing Yang, and Ruqian Zhao* Key Laboratory of Animal Physiology and Biochemistry, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing, Jiangsu 210095, People’s Republic of China ABSTRACT: Betaine has been widely used in animal and human nutrition to promote muscle growth and performance, yet it remains unknown whether maternal betaine supplementation during gestation affects the metabolic characteristics of neonatal skeletal muscles. In the present study, feeding sows with betaine-supplemented diets throughout gestation significantly upregulated the expression of mtDNA-encoded OXPHOS genes (p < 0.05), including COX1, COX2, and ND5, in the muscle of newborn piglets, which was associated with enhanced mitochondrial COX enzyme activity (p < 0.05). Concurrently, maternal betaine supplementation increased the plasma betaine concentration and muscle expression of methyl transfer enzymes (p < 0.05), BHMT and GNMT, in offspring piglets. Nevertheless, Dnmt3a was downregulated at the level of both mRNA and protein, which was associated with a hypomethylated mtDNA D-loop region (p < 0.05). These results suggest that maternal betaine supplementation during gestation enhances expression of mtDNA-encoded genes through D-loop DNA hypomethylation in the skeletal muscle of newborn piglets. KEYWORDS: betaine, hypomethylation, mtDNA-encoded gene, piglets, skeletal muscle
■
metabolism via enhancing BHMT expression in the liver4 and the hippocampus3 of newborn piglets. Skeletal muscles, which make up about 40% of the body weight, are among the most active organs for methyl group metabolism. Betaine is detectable in the skeletal muscle of pigs fed a betaine-supplemented diet,11 and an in vitro study in murine myoblasts indicated that betaine could promote muscle fiber differentiation and increase myotube size.12 Alterations in DNA methylation are associated with myotube maturation,13 muscle growth,14 and atrophy,15 yet whether betaine affects muscle energy metabolism through modifying DNA methylation remains elusive. Mitochondria play a critical role in the determination of muscle fiber type and the homeostasis of energy metabolism; thus, maintaining skeletal muscle mitochondrial content and function is important for animal health and growth. Mitochondria produce the majority of cellular energy through oxidative phosphorylation (OXPHOS), and 13 OXPHOSrelated proteins are encoded by mitochondrial DNA (mtDNA). The circular mitochondrial DNA contains a non-coding area, which is called the control region or D-loop region. The region contains promoters for the transcription of RNA from the two strands of mitochondrial DNA. There are two major transcription initiation sites in the D-loop region, which control transcription of mtDNA-encoded genes, including 13 proteincoding genes, 22 tRNA genes, and 2 rRNA genes.16 Both Dnmt117 and Dnmt3a18 are reported to be present in mitochondria to catalyze the mtDNA methylation. Our
INTRODUCTION Betaine, a methyl donor, has been widely used in human and animal nutrition to improve sports performance in endurance and strength-based exercise and to promote body composition and muscle growth in pigs and chickens.1 Betaine is critical for fetal development, because betaine deficiency can disturb the epigenetic reprogramming during the embryonic stage and, thus, exerts long-lasting effects on development, metabolism, and health.2 Recently, we showed that maternal betaine supplementation modifies the pattern of gene expression in the hippocampus3 and the liver of neonatal offspring piglets4,5 via epigenetic modifications, including DNA and histone methylations. However, whether and how maternal betaine affects the offspring skeletal muscle has not been elucidated. Betaine participates in the methionine−homocysteine cycle, which involves four key enzymes, including betaine homocysteine methyltransferase (BHMT), methionine adenosyltransferase II, β (MAT2B), glycine N-methyltransferase (GNMT), and adenosylhomocysteinase-like 1 (AHCYL1).6 BHMT catalyzes the transfer of a methyl group from betaine to homocysteine to produce methionine. Methionine is then converted to S-adenosylmethionine by MAT2B. GNMT is an important methyltransferase producing methyl groups through conversion of S-adenosylmethionine to S-adenosylhomocysteine.7 The methyl groups are then transferred by the DNA methyltransferases (DNMTs), including Dnmt1, Dnmt3a, and Dnmt3b, to cytosine residues on CpGs of gene promoters to regulate gene expression.8 Previous studies demonstrated that betaine supplementation enhances the activity of the methionine−homocysteine cycle by activating GNMT gene expression9 and increasing BHMT protein content10 in the liver of rats. Moreover, maternal betaine supplementation during gestation was found to promote methionine−homocysteine © 2015 American Chemical Society
Received: Revised: Accepted: Published: 10152
September 10, 2015 November 2, 2015 November 2, 2015 November 2, 2015 DOI: 10.1021/acs.jafc.5b04418 J. Agric. Food Chem. 2015, 63, 10152−10160
Article
Journal of Agricultural and Food Chemistry
gestation and had free access to water. One male piglet of the average body weight of all of the littermates was selected per litter and killed before suckling. Blood was collected immediately, and the longissimus dorsi muscle (LM) was collected from each piglet between the third and sixth ribs within 20 min, with visible fat and connective tissue removed, snap-frozen in liquid nitrogen, and stored at −80 °C for further analysis. The experimental protocol was approved by the Animal Ethics Committee of Nanjing Agricultural University, under Project 2012CB124703. The slaughter and sampling procedures complied with the “Guidelines on Ethical Treatment of Experimental Animals” (2006) number 398 set by the Ministry of Science and Technology, China. Determination of the Betaine Content. The betaine concentrations in plasma24 and muscle25 were measured according to previous publications with a liquid chromatography (Agilent Technologies, Foster City, CA)−mass spectrometry (AB Sciex, Framingham, MA) system. Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR) for mRNA Quantification. Total RNA was isolated from LM samples using TRIzol Reagent (Invitrogen, Shanghai, China) according to the instructions of the manufacturer and reversetranscribed with the PrimeScript First Strand cDNA Synthesis Kit (Takara, Dalian, Liaoning, China). A total of 2 μL of diluted cDNA (1:20) were used in each real-time PCR assay by Mx3000P (Stratagene, Foster City, CA). mRNA level of ATP8 could not be determined through real-time PCR because of no available primers. Peptidylprolyl isomerase A (PPIA) was chosen as a reference gene, because it is expressed in abundance comparable to the genes of interest and its expression was not affected by the treatment. All primers were synthesized by Genewiz, Inc. (Suzhou, Jiangsu, China) and listed in Table 2. Western Blotting for Protein Quantification. LM samples were homogenized at 4 °C in 50 mM Tris−HCl buffer (pH 7.4) containing 150 mM NaCl, 1% NP40, 0.5% Na deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and protease inhibitor cocktail (Roche, Shanghai, China), using a polytron homogenizer (Kinematica, Luzern, Switzerland). A Pierce BCA Protein Assay Kit (Thermo Fisher, Shanghai, China) was used to determine the protein concentration. Western blot analysis was carried out according to manual instructions provided by the primary antibody suppliers. Polyclonal antibodies against BHMT (Proteintech, Chicago, IL), GNMT (Proteintech, Chicago, IL), MAT2B (Proteintech, Chicago, IL), and AHCYL1 (Proteintech, Chicago, IL) were used in western blot analysis, and βactin−horseradish peroxidase (HRP) (KangChen Biotech, Shanghai, China) was selected as a loading control. Determination of the mtDNA Copy Number. Total genomic DNA was isolated from LM samples, and the mtDNA copy number was determined using real-time PCR as previously described, with some modifications.26 Primers specific for the control region of mitochondrial DNA were used for the quantification of the mtDNA molecules, whereas primers specific for the nuclear glucose-6phosphatase gene were used for standardization (Table 2). The relative mtDNA copy number was calculated using the 2−ΔΔCt method.27 COX Enzyme Activity Assay. LM mitochondria were isolated according to a previously described protocol, with some modifications.28 Briefly, 500 mg of frozen LM samples was homogenized in a Dounce homogenizer with 10 strokes using the isolation buffer 1 (1:10, w/v) containing 67 mM sucrose, 50 mM Tris−HCl (pH 7.4), 50 mM KCl, 10 mM ethylenediaminetetraacetic acid (EDTA), and 0.2% bovine serum albumin (BSA). The homogenates were centrifuged at 700g for 10 min at 4 °C. The supernatant was collected and then centrifuged at 8000g for 10 min at 4 °C. The supernatant was discarded, and the pellet was resuspended in the isolation buffer 2 containing 250 mM sucrose, 3 mM EGTA−Tris, and 10 mM Tris− HCl (pH 7.4). The suspensions were centrifuged at 8000g for 10 min at 4 °C. The final washed mitochondrial pellet was dispersed with the isolation buffer 2 and stored at −80 °C until assayed. All operations were carried out on ice.
previous study indicated that a maternal low protein diet during gestation enhanced OXPHOS gene expression in the liver of newborn piglets in association with the hypomethylation of the D-loop region of mtDNA.19 Betaine supplementation was reported to reverse the alcoholic and non-alcoholic liver damage through elevating mitochondrial respiration,20,21 yet it remains unknown whether maternal betaine supplementation during gestation affects mitochondrial OXPHOS gene expression and mtDNA methylation in the muscle of newborn piglets. Therefore, the present study was aimed to investigate the effect of maternal betaine supplementation during gestation on mitochondrial OXPHOS gene expression and mtDNA methylation in the skeletal muscle of newborn piglets.
■
MATERIALS AND METHODS
Animals and Samples. The animal experiment was performed at Shanghai farm, Dafeng, Jiangsu, China. A total of 16 Landrace × Yorkshire crossbred sows in the second parity were artificially inseminated, at the observation of estrus, with a mixture of Duroc semen samples obtained from two littermate boars. After 1 week of the artificial insemination, sows were randomly divided into control and betaine groups (eight per group). The sows in the control group were fed a basal diet without betaine supplementation, while the betaine diet was supplemented with betaine (3 g/kg, 98% purity, Skystone Feed Co., Ltd., Yixing, Jiangsu, China) throughout the gestation (Table 1).
Table 1. Ingredients and Calculated Composition of the Experimental Diets ingredient (g/kg) maize wheat bran soybean meal lignocelluloses CaHPO4 soybean oil premixa betaine calculated composition digestible energy (MJ/kg) crude protein (%) crude fiber (%) calcium (%) phosphorus (%)
control
betaine
370 300 80 170 30 20 8 20 0
370 300 80 170 30 25 8 20 3
13.1 15 4.5 0.84 0.65
13.1 15 4.5 0.84 0.65
a
The premix contains (per kilogram): retinol, 1100 kIU; cholecalciferol, 350 kIU; vitamin K3, 0.4 g; vitamin B1, 0.4 g; vitamin B2, 1640 mg; vitamin B6, 0.65 g; vitamin B12, 4.4 mg; lysine, 72 g; niacin, 4.5 g; pantothenic acid, 2.5 g; D-pantothenic acid, 2 g; folic acid, 5.2 g; biotin, 30 mg; D-biotin, 16 mg; choline chloride, 30 g; vitamin C, 20 g; manganese, 0.8 g; zinc, 7 g; ferrous, 7 g; copper, 2 g; selenium, 20 mg; sodium chloride, 3 g; β-xylanase, 8000 kIU; antioxidant, 0.19 g; and acidifier, 2.5 g. LP, low protein; SP, standard protein. The betaine supplementation level used in the present study was determined according to the previous publications. A number of studies have been carried out to determine the effective inclusion levels of betaine in the diet for pigs as a feed additive to promote growth and improve meat quality. The supplementation level of betaine ranged from 0.8 to 5 g/kg.22 Betaine supplemented at the level of 3 g/kg diet is consistently effective;11,23 therefore, we chose 3 g/kg in this study for maternal dietary betaine supplementation. Sows were fed 3 times a day (500, 1000, and 1700 h) with a ratio of 2.25 kg/day during 10153
DOI: 10.1021/acs.jafc.5b04418 J. Agric. Food Chem. 2015, 63, 10152−10160
Article
Journal of Agricultural and Food Chemistry Table 2. Nucleotide Sequences of Specific Primersa name (accession number) ND1 ND2 COX1 COX2 ATP6 COX3 ND3 ND4L ND4 ND5 ND6 CYTB Dnmt1 (NM_001032355.1) Dnmt3a (NM_001097437.1) Dnmt3b (NM_001162404.1) PPIA (NM_214353.1)
G6PC (NM_001113445.1) D-loop COX1 COX3 ND4
primer sequences Gene Expression F: TCCTACTGGCCGTAGCATTCCT R: TTGAGGATGTGGCTGGTCGTAG F: ATCGGAGGGTGAGGAGGGCTAA R: GTTGTGGTTGCTGAGCTGTGGA F: TGGTGCCTGAGCAGGAATAGTG R: ATCATCGCCAAGTAGGGTTCCG F: GCTTCCAAGACGCCACTTCAC R: TGGGCATCCATTGTGCTAGTGT F: ACTCATTCACACCCACCACACA R: CCTGCTGTAATGTTGGCTGTCA F: GGCTACAGGGTTTCACGGGTTG R: TCAGTATCAGGCTGCGGCTTCA F: AGCACGCCTCCCATTCTCAAT R: TGCTAGGCTTGCTGCTAGTAGG F: GATCGCCCTTGCAGGGTTACTT R: CTAGTGCAGCTTCGCAGGCT F: TCGCCTATTCATCAGTAAGTCA R: GGATTATGGTTCGGCTGTGTA F: CGGATGAGAAGGCGTAGGAA R: GCGGTTGTATAGGATTGCTTGT F: ACTGCTATGGCTACTGAGATGT R: CTTCCTCTTCCTTCAACGCATA F: CTGAGGAGCTACGGTCATCACA R: GCTGCGAGGGCGGTAATGAT F: TCAGGGACCACACTGTAAG R: GCTGCAGCCATTCTTCTTGT F: GGCTCTTCTTTGAGTTCTACCG R: GCGAGATGTCCCTCTTGTCA F: TGAAGAGTCCATCGCTGTTG R: CAATCACCAGGTCAAAGGG F: GACTGAGTGGTTGGATGG R: TGATCTTCTTGCTGGTCTT mtDNA Copy Number and MeDIP F: AAGCCAAGCGAAGGTGTGAGC R: GGAACGGGAACCACTTGCTGAG F: ACACACCCTATAACGCCTTGCC R: GGGTAGGTGCCTGCTTTCGTAG F: TGCCTGAGCAGGAATAGTGG R: ATAGGAAGGATGGTGGAAGT F: ATCTTAAACCTGGAGAAATACG R: GTTCAAGTACAATGGGCATG F: GATGATGACACGGACGAACA R: GAGGGCAATCAGGGATGTAG
product (bp) 165 191 88 154 232 130 172 182 174 103 124 162 176 126 119 116
165 149 263 258 238
a ATP6, ATP synthase F0 subunit 6; COX1, cytochrome c oxidase subunit 1; COX2, cytochrome c oxidase subunit 2; COX3, cytochrome c oxidase subunit 3, CYTB, cytochrome b; Dnmt1, DNA (cytosine-5)-methyltransferase 1; Dnmt3b, DNA (cytosine-5)-methyltransferase 3b; G6PC, glucose-6phosphatase; MP, mitochondrial DNA promoter; ND1, NADH dehydrogenase subunit 1; ND2, NADH dehydrogenase subunit 2; ND3, NADH dehydrogenase subunit 3; ND4, NADH dehydrogenase subunit 4; ND4L, NADH dehydrogenase subunit 4L; ND5, NADH dehydrogenase subunit 5; ND6, NADH dehydrogenase subunit 6; and PPIA, peptidylprolyl isomerase A.
2 μg of mouse normal immunoglobulin G (IgG) (Millipore, Shanghai, China) or anti-5mC antibody (Abcam, Cambridge, U.K.). Precleared Protein A/G Plus Agarose (Santa Cruz, Dallas, TX) was used to immunoprecipitate the antibody/DNA complexes, and the MeDIP DNA was purified. A small aliquot of MeDIP DNA and control input DNA was used to amplify the D-loop, COX1, COX3, and ND4 regions of mtDNA by real-time PCR with specific primers designed with Primer 5 software (Table 2). Statistical Analysis. Data are presented as the mean ± standard error of the mean (SEM). Student’s t test was used to compare the difference between two groups by SPSS 19.0. Results from relative quantifications of mRNA and protein were presented as the fold
The mitochondrial protein concentration was measured with a BCA Protein Assay Kit. COX activity in liver mitochondria was determined according to the instructions provided by a commercial kit (Genmed Scientifics, Shanghai, China). In brief, 1 μg of the mitochondrial protein were incubated with 100 mM reduced ferrocytochrome c, and COX activity was measured at 25 °C by the decrease of reduced cytochrome c in absorption at 550 nm. Mitochondrial 5mC Immunoprecipitation. MeDIP analysis was performed as previously described.19 Purified total genome DNA was sheared to an average length of 300 base pairs (bp). A total of 2 μg of fragmented DNA was heat-denatured to produce single-stranded DNA, and immunoprecipitation was performed overnight at 4 °C with 10154
DOI: 10.1021/acs.jafc.5b04418 J. Agric. Food Chem. 2015, 63, 10152−10160
Article
Journal of Agricultural and Food Chemistry change relative to the mean value of the control group. The differences were considered statistically significant when p < 0.05.
■
RESULTS Sows Performance and Body Weight and Muscle Weight of Newborn Piglets. Although maternal betaine supplementation during gestation did not affect the litter size or the litter weight, it significantly increased the birth weight (p < 0.05) of all of the piglets born alive; also, the same pattern was observed in both male and female piglets. Moreover, the LM weight was 13.1% higher in the betaine group compared to the control group, although the body weight of piglets sacrificed for further analysis did not differ. As a result, the LM weight relative to body weight was significantly increased (p < 0.05) in the betaine group compared to the control group (Table 3). Table 3. Sows Performance and Body Weight and Muscle Weight of Newborn Pigletsa parameter sows performance litter size litter weight (kg) total piglets BW (kg) male piglets BW (kg) female piglets BW (kg) sacrificed piglets BW (kg) LMW (g) LMW/BW
control
betaine
n=8 12.13 ± 0.44 17.76 ± 0.62 n = 97 1.52 ± 0.03 n = 51 1.57 ± 0.04 n = 46 1.45 ± 0.04 n=8 1.64 ± 0.05 23.42 ± 1.16 14.32 ± 0.60
n=8 11.88 ± 0.74 19.37 ± 1.55 n = 95 1.68 ± 0.03 n = 49 1.72 ± 0.05 n = 46 1.64 ± 0.05 n=8 1.69 ± 0.10 28.42 ± 2.80 16.67 ± 0.85
p value 0.78 0.36
