Mechanism of Juglone-induced Cell Cycle Arrest ... - ACS Publications

Jun 11, 2019 - The molecular mechanism of Juglone-induced cell cycle arrest and apoptosis in human endometrial cancer cell were investigated. Juglone ...
0 downloads 0 Views 5MB Size
Download PDF
Article pubs.acs.org/JAFC

Cite This: J. Agric. Food Chem. 2019, 67, 7378−7389

Mechanism of Juglone-Induced Cell Cycle Arrest and Apoptosis in Ishikawa Human Endometrial Cancer Cells Yuan-Yuan Zhang,† Fan Zhang,† Ying-Shuo Zhang,† Kiran Thakur,† Jian-Guo Zhang,† Yun Liu,‡ Huan Kan,*,‡ and Zhao-Jun Wei*,†,§ †

School of Food and Biological Engineering, Hefei University of Technology, Hefei 230009, People’s Republic of China Key Laboratory for Forest Resources Conservation and Utilization in the Southwest Mountains of China, Ministry of Education, Southwest Forestry University, Kunming 650224, People’s Republic of China § Anhui Province Key Laboratory of Functional Compound Seasoning, Anhui Qiangwang Seasoning Food Company, Ltd., Jieshou 236500, People’s Republic of China

Downloaded via BUFFALO STATE on July 17, 2019 at 12:22:10 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

ABSTRACT: The molecular mechanism of Juglone-induced cell cycle arrest and apoptosis in human endometrial cancer cells was investigated. Juglone was purified from the green husk of Carya cathayensis Sarg and identified by HPLC, LC-MS/MS, and NMR. At an IC50 of 20.81 μM, juglone significantly inhibited Ishikawa cell proliferation, as shown by S phase arrest mediated by inactivation of cyclin A protein (p < 0.05). The ROS levels increased significantly after exposure to juglone, which paralleled increases in the mRNA and protein expression of p21 and decreases in the levels of CDK2, cdc25A, CHK1, and cyclin A. The expression of Bcl-2 and Bcl-xL was significantly down-regulated, whereas the expression of Bax, Bad and cyto c was upregulated, and we later confirmed the involvement of the mitochondrial pathway in juglone-induced apoptosis. Our in vitro results stated that juglone can be studied further as an effective natural anticancer agent. KEYWORDS: juglone, Carya cathayensis Sarg, Ishikawa, cell cycle, apoptosis, reactive oxygen species

■

various tumors models,6 such as leukemia,7 melanoma,8 gastric cancer,9 pancreatic cancer,10 and spontaneous breast cancer in mice.11 The cytotoxic effect of juglone is mainly mediated through the induction of reactive oxygen species (ROS), which causes apoptotic as well as necrotic cell death.6 It has been reported that juglone can be oxidized and reduced to form semiquinone free radicals, which can reduce molecular oxygen to form O2−.12 The disproportionation reaction produces H2O2, which can be converted into O2−, H2O2, and OH−, all of which are ROS and are closely related to cell apoptosis.13 Nevertheless, its comprehensive mechanism has not been studied so far. It is reported that juglone-induced programmed cell death of tumor cells occurs via the induction of oxidative stress reactions inside cells, which causes cell membrane damage and cell lysis.14 Hence, the current study explored the growth inhibition, cell cycle arrest, and induction of apoptosis by juglone in Ishikawa cells and the underlying mechanisms.

INTRODUCTION Human endometrial cancer is one of the most common female reproductive system tumors and is the third most common gynecological malignancy leading to death worldwide.1 In recent years, with the rapid development of economies worldwide, living habits and dietary structure have been constantly changing. With informal hormone replacement therapy and sex hormone abuse, the incidences of endometrial cancer have risen remarkably and pose a serious threat. Presently, surgical treatment and radiotherapy are the clinical treatments for endometrial cancer; however, they are accompanied by greater physical and psychological risk to the patient. On the other hand, conventional treatment of endometrial cancer, such as heat treatment and Chinese medicine treatment cause relatively less harm to patients but their effects are limited. Therefore, it is of great significance to study an effective, natural, and low-toxicity endometrial cancer drug.2 In traditional Chinese medicine, the green husk of Carya cathayensis Sarg, especially the fleshy peel of the immature fruit of C. cathayensis Sarg, is known as a detoxifying, antibacterial, and anticancer agent.3 Globally, there are 16 main components of C. cathayensis Sarg green husk, mainly enamel, juglone, αhydrogen juglone, β-hydrogen juglone, naphthoquinone, βsitosterol, 3,5-dimethoxy-4-hydroxybenzoic acid, regiolon, succinic acid, gallic acid, juglone alkaloids (C10H6O3), and some pigments.4 In recent years, the antitumor activity mechanism of naphthoquinones has been extensively studied.5 Juglone (5-hydroxy-1,4-naphthaquinone) is a kind of naphthoquinone active ingredient that has been widely used as a chemotherapeutic agent in Chinese herbal medicine against © 2019 American Chemical Society

■

MATERIALS AND METHODS

Chemicals. C. cathayensis Sarg fruits were collected from Ningguo City, Anhui, China. Chemical reagents (ethanol, ethyl acetate, formic acid, and formic acid acetonitrile) were procured from Shanghai Sinopharm Chemical Reagent Company, Ltd. (Shanghai, China). Cell culture medium was purchased from Invitrogen (Carlsbad, CA). The caspase 3 and 8 inhibitors were procured from Med Chem Express (Monmouth Junction, NJ). Received: Revised: Accepted: Published: 7378

May 2, 2019 June 10, 2019 June 11, 2019 June 11, 2019 DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry Table 1. List of Primers Used in the Present Study gene cyto c CDK2 cyclin A CHK1 p21 P27 p53 Bad Bcl-xl Bcl-2 Bax PUMA caspase 3 caspase 9 Apaf-1 cdc25A TNF-α FoxO1

primer

sequence

forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward

CAACACCTCTCACATCTTACAGA GGCAAAAGCACCATTCCCAA AACACAGAGGGGGCCATCAAGC CAGGAGCTCGGTACCACAGGGTC GACTGGCTGGTTGAGGTGG GTGGCGGTTTGAGGTAGGT AGATATGAAGCGTGCCGTAG CCAGCGAGCATTGCAGTAAG GCGGAACAAGGAGTCAGACA GAACCAGGACACATGGGGAG TCTACTGCGTGGCTTGTCAG ATTTGGAGGCACAGCAGGAG AGCACTGTCCAACAACACCA CTTCAGGTGGCTGGAGTGAG AGAGTTTGAGCCGAGTGAGC CATCCCTTCGTCGTCCTCC GCATTGTGGCCTTTTTCTCC GCTGCTGCATTGTTCCCATA GGAGCGTCAACAGGGAGATG GATGCCGGTTCAGGTACTCAG ACGGCCTCCTCTCCTACTTT AAACACAGTCCAAGGCAGCT ATGCCTGCCTCACCTTCATC TCAGCCAAAATCTCCCACCC TGGACTGTGGCATTGAGACA CAGGTGCTGTGGAGTATGCA GCTCTTCCTTTGTTCATCTCC CATCTGGCTCGGGGTTACTGC CCTTCTCTGTGGACAGTAC TCCGACCCCTGACTGGAAA GACCACTCCTAGCAAACCTGG GGGCGTCTGGCTGTTTTCA CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG GTATGAACCGCCTGACCCAA

gene TNF-R1 caspase 8 caspase 10 Fas ATM PDK1 TRADD DR3 DR5 PI3K AKT p70s6k AMPK Smac JNK1 JNK2 β-actin

Preparation of Juglone. Juglone was extracted from the green husks of C. cathayensis Sarg as per a previously described method.15,16 First, fresh green C. cathayensis Sarg skin (6 kg) was dried at 40 °C for 48 h and converted into powder. The skin powder was soaked in 500 mL of 85% ethanol (Shanghai Sinopharm Chemical Reagent Company, Ltd., Shanghai, China) for 8 h and then ultrasonically extracted for 40 min, and the extract was centrifuged. The residue was further added to 500 mL of 85% ethanol, ultrasonically extracted for 40 min, and centrifuged, and the two extracts were combined. It was concentrated at 35 °C under reduced pressure using a YRE-2000E rotary evaporator (Hangzhou AIPU Instrument Company, Ltd., Hangzhou, Zhejiang, China). The solvent was removed by rotary evaporation to obtain crude juglone. After dispersion in water, it was extracted with ethyl acetate, the extract was concentrated, the temperature was increased to not more than 40 °C, and the extract was weighed (11.45 g) after being dried. The obtained material was eluted with silica gel column (80−100 mesh) chromatography (chloroform−methanol−n-butanol−water, 10:5:1:4, v/v/v/v) and then purified on a Sephadex LH-20 column (Sigma-Aldrich, St Louis, MO). Thin layer chromatography silica gel G (TLC) was used to trace the same components (chloroform− methanol, 200:1). The fraction was subjected to chromatography on a silica gel column (200−300 mesh), and petroleum ether−acetone (200:1; Shanghai Sinopharm Chemical Reagent Company, Ltd., Shanghai, China) was eluted to obtain purer fractions 1 and 2. One was purified by semipreparative high-performance liquid phase to obtain compound 1 (18 mg). The obtained extract was subjected to

primer

sequence

reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse forward reverse

GCGCTCAATGAACATGCCAT CTCTCCCCTCCTCTCTGCTT GGGTTGAGACTCGGGCATAG TATCCCGGATGGCTGACT GACATCGCTCTCAGGCTC CAGGGGCAGGAAGAGAACAG ACTAGGAAACGCTGCTCCAC AGATTGTGTGATGAAGGACATGG TGTTGCTGGTGAGTGTGCATT TTTTCCCAAAGCGTGCCAG AGCGATCCAGTGATTCCTTGA AACAGGGGAGCTTTGTCTGG GCACTGGACTAACTGCCCAT CAGGGGCAGGAAGAGAACAG ACTAGGAAACGCTGCTCCAC AGATTGTGTGATGAAGGACATGG TGTTGCTGGTGAGTGTGCATT CTGCCACCCCTGAAGAAGAG GCCACTTTCCTCAGCTCCTT CTGCGAAATCTGAAGTGCGG CACCTTGCGCCATTTGAGAC CCTTCTTGGCCTGGGAGAAC CACACGATACCGGCAAAGAA ACTGGAAGCCTTGGAATGGG CCTTGCCGACCACAGTATGT TCCGAGGAAATCAAGGCACC ATTGTGGCTTCTGGTGAGGG TCTCCCGGAAAGCAGAAACC TTCTCGGTGCACAGACAGTC ACATTGAGCAGAGCAGGCAT GTCAGGAGCAGCACCATTCT TCAAGGGCAGAGTCCAGAGA CCTCTCAGTACTGGGGCTCT TGTGATGGTGGGAATGGGTCAG TTTGATGTCACGCACGATTTCC

high-performance liquid chromatography (HPLC) using a Hyper 0DS2 C18 column with an ELSD detector (Agilent, La Jolla, CA). The mobile phase consisted of solution A with 0.1% formic acid and solution B with 0.1% formic acid in acetonitrile (Shanghai Sinopharm Chemical Reagent Company, Ltd., Shanghai, China). For the gradient elution (0 to 3 min, 5−22% B; 3−15 min, 22−60% B; 15−20 min, 60−70% B; 20−28 min, 70−100% B; 29−30 min, 100% B; 30−30.1 min, 100−5% B; 30.1−35 min, 5% B), the flow rate was 0.3 mL/min, and the injection volume was 2 μL. Liquid chromatography−tandem mass spectrometry (LC-MS/MS) was performed in positive scan mode using a TripleTOF 5600+ system (SCIEX, Redwood, CA) with an electrospray ionization (ESI) source (Waters Corporation, Milford, MA). The conditions were set as follows: the ion source voltage was 5500 V, the ion source temperature was 550 °C, the cracking voltage (DP) was 80 V, the collision energy was 35 eV, and the collision energy spread (CES) was 15 eV. Further, nuclear magnetic resonance (NMR) was recorded using a VNMRS600 NMR spectrometer (Agilent, La Jolla, CA). 13C NMR and 1H NMR were used with 151 and 600 MHz as the resonance frequencies, respectively, with tetramethylsilane (TMS) as an internal standard.17 Cell Culture Conditions. A human endometrial cancer cell line (Ishikawa) was obtained from Hefei Nuoruo Biotechnology Company, Ltd. (Hefei, Anhui, China). The cells were subcultured in a 25 cm2 culture dishes using a high glucose DMEM medium (Hyclone, Logan, UT) containing 10% FBS (Hyclone, Logan, UT) in 5% CO2 at 37 °C. The cells were adherently grown until the degree of fusion of the cells reached up to 80−90%. The density of cells used 7379

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry for the tests was 1.8 × 105 cells/well. Trypsin (Hyclone, Logan, UT) digestion was performed to carry out the cell passage. MTT Assay for Cell Proliferation Activity and Growth Inhibition Rate. The 3-(4,5-dimethylthiazole-2)-2,5-diphenyltetrazolium (MTT; Sigma, St. Louis, MO) method is the most commonly used method for measuring the inhibition rate of cell proliferation.18 The cells were exposed to different concentrations of juglone (4, 8, 12, 16, 20, 24, 28, and 32 μM) for 24 h and then incubated with 20 mL of MTT reagent (5 mg/mL) at 37 °C for 4 h. Finally, the medium was removed, and the cells were washed with PBS before 150 mL of DMSO (AMRESCO, Solon, OH) was added. The absorbance was measured at 570 nm, and the inhibitory effect of juglone on Ishikawa cells was evaluated. The survival rate of Ishikawa cells was calculated according to the following formula:

survival rate (%) =

Western Blotting. After treatment with juglone for 24 h, the total protein of different samples was extracted. Once the protein was quantified, 2 × loading buffer was added and boiled for 10 min. Proteins were separated by using 10% SDS-PAGE electrophoresis (Rebio, Shanghai, China) and transferred to polyvinylidene difluoride (PVDF) membrane (Millipore, Darmstadt, Germany); 5% skim milk was used for blocking at room temperature for 2 h. The membrane was incubated with primary antibody (Cell Signaling Technology, Danvers, MA) at 4 °C overnight; this was followed by the addition of secondary antibody. The developed color was detected with ECL luminescence using grayscale analysis (Transgen, Beijing, China).23 βActin was used as an internal reference.21 Statistical Analysis. The obtained data was statistically analyzed using SPSS 13.0 software. Differences between groups were measured using one-way ANOVA at a significance level of p < 0.05. Experiments were repeated three times, and significance was evaluated at ±5% (p ≤ 0.05). Results were expressed as means ± standard deviations.

A570 of juglone group × 100% A570 of negative control group

■

RESULTS Juglone Extraction from C. cathayensis Sarg. According to HPLC analysis, the purity of the product was 98% (Figure 1). The main peak was located at 15.21 min (Figure

The morphological changes of the Ishikawa cells exposed to juglone (10, 15, and 20 μM) were observed within 24 h using an inverted light microscope (Nikon, TS100, Tokyo, Japan). Cell Cycle Analysis. Following a previous study,19 Ishikawa cells at a density of 1.8 × 105 cells/well were cultured overnight and then treated with different concentrations (0, 10, 15, and 20 μM) of juglone for 24 h. The harvested cells were fixed with 70% ethanol at 4 °C overnight, then washed twice with PBS, and resuspended in a cold propidium iodide (PI) solution for 30 min in the dark. Flow cytometry (BD FACS Calibur, Franklin Lakes, NJ) was used for cell cycle analysis. Apoptotic Morphology by Hoechst 33342−PI Staining. Apoptotic morphology was observed by the Hoechst 33342−PI fluorescent staining method (Solarbio, Beijing, China).20 Normal and treated cells after 24 h were collected and placed on glass and washed twice with PBS; this was followed by the addition of 5 μL of Hoechst 33342 and 5 μL PI (Solarbio, Beijing, China). After being mixed, the stained cells were placed in an ice bath or at 4 °C for 20 to 30 min. The cells were pelleted by centrifugation at 1000g for 3 to 5 min at 4 °C. Prior to final analysis, the smear was washed once with PBS, and red fluorescence and blue fluorescence were observed by laser confocal microscopy (Carl Zeiss Microscopy GmbH, Jena, Germany). Detection of Apoptosis. Annexin V-FITC−PI double staining (Beyotime, Shanghai, China) was used to detect the apoptosis of Ishikawa cells. After treatment with juglone (0, 10, 15, and 20 μM) for 24 h, cells were collected by centrifugation (2000 rpm for 5 min). The cells were washed twice with PBS to collect 1.8 × 105 cells. After the addition of 5 μL of Annexin V-FITC, 5 μL of PI (Beyotime, Shanghai, China) was added. The obtained mixture was protected from light for 5 to 15 min, and flow cytometry was conducted within 1 h.21 Detection of ROS Activity. To detect the increase in intracellular ROS,22 1.8 × 105 cells/dish were cultured overnight and then exposed to juglone for 24 h. DCFH-DA (Beyotime, Shanghai, China) was diluted in serum-free RPMI 1640 medium (Hyclone, South Logan, UT) to a final concentration of 5 μmol/L, cultured at 37 °C for 1 h, and washed three times with PBS before the measurement of fluorescence intensity. Real-Time PCR Analysis. After 24 h of incubation with juglone, the medium was discarded, and the cells were washed twice with PBS. According to the manufacturer’s instructions, total cell RNA was separated with RNA ISO Plus reagent (TaKaRa, Dalian Company, LTD, Liaoning, China). Subsequently, DNA removal and RNA reverse transcription were performed using TaKaRa reverse transcription kit. The retroviral transcript DNA was preserved at −80 °C. The TB Green Premix Ex TaqII kit (TaKaRa, Dalian Company, LTD, Liaoning, China) was used for quantitative fluorescence PCR detection. RT-PCR was performed by ABI PRISM 7300 Sequence Detection (Applied Biosystems, Foster, CA). The sequences of primers are shown in Table 1. Relative mRNA expression levels were calculated using the 2−ΔΔCt method, and the β-actin gene was used as an internal control gene.19

Figure 1. HPLC chromatogram of purified juglone.

1). Subsequently, as shown in Figure 2A,B, MS data showed that the excimer ion of the sample was m/z 173 [M − H]+. The excimer ion peak was relatively high, and it was likely to lose the m/z 145.08 [M − H − CO]+ fragment ion with the highest abundance of CO neutral fragments and open ring under high energy collision. The reaction formed the less abundant m/z 131 [M − H − CO − CH2]+ fragment ions and the excimer ion peak m/z 173 [M − H]+. The parent ion lost one molecule of H2O to form a less abundant m/z 155 [M − H − H2O]+ ion. The CO fragments were continuously lost in the formation of the m/z 127 [M − H − H2O − CO]+ and m/ z 101 [M + H − H2O − 2CO]+2 fragment ions. This cleavage pathway was basically consistent with the secondary fragments of the reference material of the C. cathayensis Sarg. Therefore, the compound was identified as juglone, and the secondary mass spectrometry and ion fragment data were calculated as shown in Figure 2A,B, respectively, and were consistent with previous reports.16 Moreover, NMR analysis reconfirmed that the material was juglone on the basis of the following data (Figure 3A,B): 13C NMR (151 MHz) δ 190.56, 184.70, 160.65, 154.46, 146.28, 146.14, 139.82, 139.33, 137.23, 132.15, 127.59, 126.06, 124.45, 118.88, 115.53, 113.69, 109.24, 108.87, 108.44; 1H NMR (600 MHz, CDCl3-d6) δ 11.91 (s, 0.96H), 7.64 (m, 2.04H), 7.30 (dd, 1.02H), 6.97 (s, 1.98H). Inhibitory Effects of Juglone on Proliferation of Ishikawa Cells. After 24 h of treatment with different 7380

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 2. LC-MS/MS spectra of purified juglone. (A) MS spectrum of the prepared juglone. (B) MS2 spectrum of the prepared juglone.

(Figure 4C). After 24 h of treatment with different concentrations of juglone, Ishikawa cells showed varying degrees of cell shrinkage, rough edges, rounded cells, smaller size, loss of connectivity, detachment from surrounding cells, decline of adherence ability, partial cell detachment, and poor growth status, all of which were concentration-dependent. Effects of Juglone on Ishikawa Cell Cycle. The inhibitory effects of juglone on cancer cell cycle were detected by flow cytometry (Figure 5). The proportions of cells at different stages are shown in Figure 5. After 24 h of treatment with juglone, juglone could inhibit Ishikawa cells in S phase significantly (23.78% at 10 μM, 25.21% at 15 μM, and 29.33%

concentrations of juglone, the cell absorbance was measured by the MTT method, and the inhibition rate of juglone on the growth of Ishikawa cells was calculated. Compared with those of the control group, the cell proliferation activity decreased, and the cell growth inhibition rate increased significantly (p < 0.05) in the treatment groups with different concentrations of juglone, and the effects were concentration-dependent (Figure 4A). The IC50 of juglone on Ishikawa cells was calculated to be 20.81 μM (Figure 4B). Effects of Juglone on the Morphology of Ishikawa Cells. In the normal control group, Ishikawa cells were mostly spindle-shaped, fully stretched, and firmly adhered to the wall 7381

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 3. NMR spectra of the prepared juglone. (A) 13C NMR spectrum. (B) 1H NMR spectrum. (C) Structure of juglone.

at 20 μM). In view of the effect of juglone on the cell cycle, the key regulatory factors in the cell cycle related genes were determined with the aim of studying the molecular regulation of Ishikawa cells cultured with juglone. As shown in Figure 6A, mRNA expression levels of CDK2, cyclin A, CHK1, and cdc25A were down-regulated in a concentration-dependent manner, whereas the expression levels of FoxO1, Akt, ATM, p27, p21, and p53 were significantly up-regulated. On the basis of the aforementioned facts, the effect of juglone on gene expression was evaluated. The levels of CDK2, cyclin A, cdc25A, and CHK1 proteins, which are essential in S phase, were reduced in the treated cells (Figure 6B,C). CDK2 initiates a checkpoint of S phase, and continuance of the cell

cycle is controlled by a p53 dependent pathway.14 Our results showed that treatment with juglone enhanced the protein expression of p21 (Figure 6B,C). Effects of Juglone on Apoptotic Morphology Determined by Hoechest33342−PI staining. Hoechst 33342 can penetrate the cell membranes of normal and apoptotic cells. In combination with DNA, it can display blue fluorescence under ultraviolet light, and the fluorescence of apoptotic cells after staining is significantly enhanced when compared with that of normal cells. PI cannot penetrate cell membranes and cannot stain normal or apoptotic cells with intact cell membranes. In necrotic cells, the integrity of the cell membrane is lost, and PI can penetrate the cell membrane to 7382

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 4. Proliferation inhibition of juglone treated cells (A) Inhibition rate. (B) Inhibition curve. (C) Morphological changes in juglone treated Ishikawa cells, as compared with the morphology of the untreated group, observed under an inverted optic microscope (original magnification, ×200). All the data are expressed as means ± SD of replicates.

Figure 5. Cell cycle arrest at S stage in juglone treated Ishikawa cells. (A) Cell cycle distribution of juglone treated Ishikawa cells. (B) Rates of the cell cycle in different phases. Statistical analysis was performed using one-way ANOVA at p < 0.05. Significant differences are designated by the letters a, b, c, and d.

stain necrotic cells and produce red fluorescence. As can be seen from Figure 7A, with increasing concentrations of juglone, there were increases in blue fluorescence as well as in red fluorescent, which indicated increasing numbers of apoptotic and necrotic cells. It can be further stated that juglone treatment could promote apoptosis. Effects of Juglone on Ishikawa Cell Apoptosis. According to previous studies, juglone can induce apoptosis in human breast cancer, prostate cancer, gastric cancer, and many other cancers. In this experiment, Ishikawa cells were

exposed to different concentrations of juglone (0, 10, 15, and 20 μM) for 24 h and then treated with annexin V-FITC and PI for flow cytometry analysis. The proportions of early apoptotic cells were 2.6, 10.7, 18.4, and 49.0%, respectively (Figure 7B). Effects of Juglone on the Expression of Mitochondrial Pathway Related Genes. By determining the influences of internal factors, our results showed that juglone can up-regulate the mRNA expression levels of Bad, Bax, PUMA, cyto c, caspase 9, and caspase 3 and down-regulate the expression of Bcl-xl and Bcl-2 (Figure 8). At the same time, 7383

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 6. Cell cycle related gene expression in juglone treated Ishikawa cells (10, 15, and 20 μM) after 24 h. (A) mRNA levels. (B) Western blotting analyses. (C) Relative protein levels of cell cycle related genes. All the data are expressed as means ± SD of replicates. Significant differences at p < 0.05 are designated by the letters a, b, c, and d.

Figure 7. Apoptosis in juglone treated Ishikawa cells. (A) Hoechst 33342−PI staining for the detection of juglone effects on the morphology of Ishikawa cells after 24 h. (B) Apoptosis in juglone treated Ishikawa cells, assessed by flow cytometry analysis. All the data are expressed as means ± SD of replicates.

Effects of Juglone on the Expression of Other Apoptosis Related Genes. Juglone also down-regulated the mRNA expression levels of AKT, PI3k, and p70s6k and upregulated the expression of AMPK, Smac, and JNK1/2, which confirmed that other pathways were involved in apoptosis (Figure 10). Juglone Induction of ROS-Mediated Apoptosis in Ishikawa Cells. To investigate the correlation between ROS and juglone-mediated apoptosis in Ishikawa cells, we measured ROS levels by flow cytometry (Figure 11). After the cells were stained with a fluorescent probe (DCFH-DA), the active oxygen content was determined on the basis of fluorescence. Our results showed that the production of ROS increased significantly after exposure to juglone (Figure 11). After exposure to different concentrations (0, 10, 15, and 20 μM) of juglone, the percentages of ROS-positive cells increased from 0.9 ± 0.04 to 1.90 ± 0.22, 2.6 ± 0.31, and 27.01 ± 0.75%, respectively. On the basis of the above results, the mechanism of apoptosis and cell cycle arrest induced by Juglone is summarized in Figure 12.

Western blot analysis also confirmed the protein expression of the relevant genes. In addition, specific inhibitors were used to determine whether the mitochondrial pathway was used for the induction of apoptosis. The expression of caspase 3 was significantly reduced after treatment with a caspase 3 inhibitor (Ac-DEVD-FMK), whereas the addition of the juglone could mitigate the above inhibition to a certain extent (Figure 8). The combination of inhibitors and juglone attenuated this inhibition to some extent, suggesting that caspase 3 in the mitochondrial pathway plays a key role in juglone-induced apoptosis of Ishikawa cells. Effects of Juglone on the Expression of Death Receptor Pathway Related Genes. Apoptosis plays a crucial role in cell survival, growth, development, and tumorigenesis. It is mediated by both endogenous and exogenous mechanisms. Under exogenous influence, mRNA expression and protein expression of certain genes (TNF-α, TNF-R1, TRADD, FAS, FADD, caspase 8, caspase 10, and DR3/5) were significantly up-regulated after 24 h of juglone treatment (Figure 9). In addition, specific inhibitors were used to determine death receptor induced apoptosis. When treated with the caspase 8 inhibitor (Z-IETD-FMK), the expression level of caspase 8 was significantly reduced, but the addition of juglone mitigated the inhibition to a certain extent (Figure 9). 7384

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 8. mRNA and protein expression profiles of mitochondrial pathway related genes in juglone treated Ishikawa cells after 24 h. (A) mRNA expression profile. (B) Protein expression profile (C) Expression levels of mitochondrial pathway related proteins. (D) Effects of juglone on apoptosis in Ishikawa cells treated with or without caspase 3 inhibitor. Cells (1.8 × 105 cells) were exposed to caspase 3 inhibitor (Ac-DEVD-FMK) for 2 h before or after treatment with 20 μM juglone. Statistical analysis was performed using one-way ANOVA. Significant differences at p < 0.05 are designated by the letters a, b, c, and d.

■

DISCUSSION Tumorigenesis is a multistep process in which cell cycle arrest is considered an important mechanism. The release of DNA during apoptosis and necrosis indicates decreases in nuclear DNA contents within the cell. Our results demonstrate that juglone induces cell cycle arrest in Ishikawa cells at S phase. At the same time, according to previous studies, in ovarian cancer cells, juglone-induced its blockade in G0/G1 phase.24 In another study, cell cycle analysis with PI staining showed that the juglone-induced blockade in HepG2 cells occurred at S phase.14 Through real-time PCR and Western blot analysis, our results revealed the molecular mechanism of juglone inhibition of Ishikawa cells. It was found that CDK2 protein could bind to cyclin E, cyclin A, and cyclin D and play essential roles in G1/S, S, and G2 phases, respectively. CDK2, a key kinase for initiating DNA replication, is also necessary for the operation of G2 phase. Cyclin E and CDK2 are required in the transition from G1 phase to S phase. When cells enter S phase, cyclin E degrades and CDK2 binds to cyclin A, pushing cells from S phase to G2 phase. S phase arrest of the cell cycle has been found in recent studies.25 The experimental data show that this is closely related to decreases in cell cycle regulatory complex (cyclin A−CDK2−cdc25A complex) production and to the up-regulation of p21 expression.26 Cyclin A and CDK2 belong to positive cell cycle regulatory proteins.27 The content of the cyclin A−CDK2−cdc25A complex in the DNA synthesis phase of the cell cycle is the key factor for ensuring the smooth entry of cells from S phase to G2/M.28 Because of the role of cdc25A phosphatase in the dephosphorization of

the cell cycle dependent kinase, it is essential for cell cycle progression.29 Cyclin-dependent kinases can be activated by cdc25A to remove inhibitory phosphates from tyrosine and threonine residues, whereas p21 is a negative regulator of the cell cycle that can block normal cell cycle progression when overexpressed. CHK1 initiates the S phase checkpoint.30 Our study showed that the levels of p21 increased, whereas the levels of CHK1, cyclin A, cdc25A, and CDK2 decreased during the cell cycle. Juglone treated Ishikawa cells showed cell cycle arrest at S phase. Apoptosis is an important biological process that regulates cell growth and response to external stimuli. The two main pathways that cause apoptosis are the death receptor pathway and the mitochondrial apoptosis pathway.31 It is the main apoptotic pathway induced by stress. The ultimate pathway for apoptosis is DNA degradation. Death receptors (DRs) are cell surface receptors and belong to the tumor necrosis factor (TNF) superfamily.32 The TNF receptor superfamily, which initiates apoptosis upon binding to a cognate ligand or agonizes the antibody to initiate apoptosis under experimental conditions.33 In this study, the expression of TNF-α, TNF-R1, Fas, FADD, TRADD, DR3, DR5, caspase 8, and caspase 10 mRNA in Ishikawa cells was induced by juglone. The preapoptotic signals of DRs are homologous, and the involvement of specific ligands or agonist antibodies in DR oligomerization leads to the recruitment of the cytoplasmic junction protein Fas associated death domain (FADD).34 The death effector region (DED) of FADD can perform oligomerization and activation 7385

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 9. mRNA and protein expression profiles of death receptor pathway related genes in juglone treated Ishikawa cells after 24 h. (A) mRNA expression profile. (B) Protein expression profile. (C) Expression levels of death receptor pathway related proteins. (D) Effects of juglone on apoptosis in Ishikawa cells treated with or without caspase 8 inhibitor. Cells (1.8 × 105 cells) were exposed to caspase 8 inhibitor (Z-IETD-FMK) for 2 h before or after treatment with 20 μM juglone. Statistical analysis was performed using one-way ANOVA. Significant differences at p < 0.05 are designated by the letters a, b, c, and d.

transduction different from the former, which can induce both apoptosis and survival signals.38 TNF-α binds to TNF-R1 to bind the receptor protein, TRADD (TNF receptorassociated death domain protein), to the aggregated receptor death zone.38 TRADD recruits several signaling molecules to activate receptors, such as FADD, which binds to and activates caspase 8 or caspase 10, leading to apoptosis in the same manner as that of Fas-initiated apoptosis.39 After 24 h of treatment with juglone, the expression of caspase 8 increased at the mRNA and protein levels in Ishikawa cells. With further study of the mechanism of apoptosis, the role of mitochondria in apoptosis has been highlighted.40 A previous study has shown the structural and functional changes in mitochondria during the early stage of apoptosis.41 Mitochondrial membrane permeability transition pore (MPTP) opening is an important part of apoptosis.42 Under the stimulation of apoptotic factors, the mitochondrial transmembrane potential is decreased or lost, and the mitochondrial matrix is released. Excessive active substances, such as cyto c and apoptosis-inducing factor AIF, enter the nucleus or cytoplasm, eventually leading to irreversible apoptosis of cells.43 As the concentration of cyto c increases, the expression of Fas mRNA and protein increases. The mechanism may be that cyto c promotes the binding of Fas receptor to its ligand, which induces apoptosis through the nuclear factor κB signal transduction pathway. It may also be that cyto c induces expression of the Fas receptor on the cell membrane surface or enhances the expression of Fas on the surface of the cell membrane so that it can firmly bind to the Fas ligand and effectively induce apoptosis of cancer cells. Studies have shown that down-regulation of Bcl-2 gene

Figure 10. mRNA expression profile of apoptosis related genes in juglone treated Ishikawa cells after 24 h. All the data are expressed as means ± SD of replicated experiments. Statistical analysis was performed using one-way ANOVA. Significant differences at p < 0.05 are designated by the letters a, b, c, and d.

of the caspase 8 precursor to form a death-inducing signaling complex (DISC).35 This complex includes Fas, FADD, and caspase 8 precursors.36 The precursor is processed and released from the DISC in an active form, which in turn cleaves other caspases into active subunits, activates the caspase cascade, and induces apoptosis.37 TNF-R1 induces intracellular signal 7386

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

Figure 11. Effects of juglone on ROS generation after 24 h of treatment. (A) Cell distributions of untreated and juglone treated Ishikawa cells after DCFH-DA staining. (B) Percentage of ROS-positive cells for various concentrations of juglone treatment.

ROS induces apoptosis by affecting mitochondrial metabolism, and mitochondria play a very important role in apoptosis.46 Apoptosis can also cause the migration of intracellular mitochondria as well as endoplasmic reticulum Ca2+ and plasma membrane Ca2+ATPase inactivation, leading to elevated intracellular Ca2+ levels.47 Ca2+ elevation can trigger apoptosis, and high concentrations of juglone can accelerate ROS. The production of ROS is related to the apoptosis of Ishikawa cells. Hoechst 33342−PI staining was used to observe apoptotic body formation with apoptotic features. One of the mechanisms of juglone cytotoxicity is the production of ROS. ROS production was noticed in gastric cancer cells, human peripheral blood lymphocytes, and HL-60 cells after treatment with juglone.48 In conclusion, the induced apoptosis effect of juglone in Ishikawa cells was accompanied by growth inhibition at an IC50 of 20.83 μM, morphological destruction, and S phase cell cycle arrest. In addition, two crucial pathways (endogenous and exogenous) that regulate cell death may accelerate the apoptosis induced by juglone. Other genes, such as PI3K, PDK1, Akt, p27, p70s6k, FoxO1, and Bad, were also involved in the progress of apoptosis. In addition, the increase of intracellular ROS as an intermediate signaling molecule can be recognized an important key for the treatment of Ishikawa cells by juglone.

Figure 12. Possible anticancer effects of juglone on the cell cycle and apoptosis with the pathways involved in Ishikawa cells.

expression can increase the sensitivity of tumor cells to Fasmediated apoptosis.44 Cyto c increases the sensitivity of Ishikawa cells to the acanthus-mediated apoptotic pathway by inhibiting gene expression of Bcl-2, thereby increasing the expression of the Fas gene. In the p53-dependent apoptosis process, PUMA acts as an important intermediate in the activation of Bax and in mitochondrial membrane permeability. However, juglone reduced the inhibition of caspase caused by inhibitor of apoptosis proteins (IAPS), thereby accelerating apoptosis. In another study, caspase inhibitors significantly blocked juglone-induced cell death but did not completely prevent cell death, suggesting that other pathways not associated with caspases are involved in juglone-induced apoptosis.45 Furthermore, other genes and pathways are also involved in the apoptosis of Ishikawa cells induced by juglone. The PI3K−Akt signaling pathway plays a key role in inhibiting apoptosis and promoting cell proliferation. PI3K-activated Akt, which activates or inhibits the important antiapoptotic regulatory factors of its downstream target proteins Bad, caspase 9, and p21 by phosphorylation.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected] (Z.-J.W.). *E-mail: [email protected] (H.K.). ORCID

Jian-Guo Zhang: 0000-0001-6020-6148 Zhao-Jun Wei: 0000-0003-1729-209X Funding

This work was supported by the Major Projects of Science and Technology in Yunnan Province (2018ZG004), the National Natural Science Foundation of China (31850410476), and the 7387

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry

(18) Yuan, L.; Wei, S.; Wang, J.; Liu, X. Isoorientin induces apoptosis and autophagy simultaneously by reactive oxygen species (ROS)-related p53, PI3K/Akt, JNK, and p38 signaling pathways in HepG2 cancer cells. J. Agric. Food Chem. 2014, 62, 5390−5400. (19) Wang, J.; Zhang, Y. S.; Thakur, K.; Hussain, S. S.; Zhang, J. G.; Xiao, G. R.; Wei, Z. J. Licochalcone A from licorice root, an inhibitor of human hepatoma cell growth via induction of cell apoptosis and cell cycle arrest. Food Chem. Toxicol. 2018, 120, 407−427. (20) Farghadani, R.; Rajarajeswaran, J.; Hashim, N. B. M.; Abdulla, M. A.; Muniandy, S. A novel β-diiminatomanganeseiii complex as the promising anticancer agent induces G0/G1 cell cycle arrest and triggers apoptosis via mitochondrial-dependent pathways in mcf-7 and mda-mb-231 human breast cancer cells. RSC Adv. 2017, 7, 24387− 24398. (21) Zhang, Y. S.; Ma, Y. L.; Thakur, K.; Hussain, S. S.; Wang, J.; Zhang, Q.; Zhang, J. G.; Wei, Z. J. Molecular mechanism and inhibitory targets of dioscin in HepG2 cells. Food Chem. Toxicol. 2018, 120, 143−154. (22) Wu, H. L.; Fu, X. Y.; Cao, W. Q.; Xiang, W. Z.; Hou, Y. J.; Ma, J. K.; Wang, Y.; Fan, C. D. Induction of Apoptosis in Human Glioma Cells by Fucoxanthin via Triggering of ROS-Mediated Oxidative Damage and Regulation of MAPKs and PI3K-AKT Pathways. J. Agric. Food Chem. 2019, 67, 2212−2219. (23) Wang, J.; Liao, A. M.; Thakur, K.; Zhang, J. G.; Huang, J. H.; Wei, Z. J. Licochalcone B extracted from Glycyrrhiza uralensis Fisch induces apoptotic effects in Human Hepatoma Cell HepG2. J. Agric. Food Chem. 2019, 67, 3341−3353. (24) Sinuani, I.; Beberashvili, I.; Averbukh, Z.; Cohn, M.; Gitelman, I.; Weissgarten, J. Mesangial cells initiate compensatory tubular cell hypertrophy. Am. J. Nephrol. 2010, 31, 326−331. (25) Yu, H. Y.; Zhang, X. Q.; Li, X.; Zeng, F. B.; Ruan, H. L. 2methoxyjuglone induces apoptosis in HepG2 human hepatocellular carcinoma cells and exhibits in vivo antitumor activity in a h22 mouse hepatocellular carcinoma model. J. Nat. Prod. 2013, 76, 889−895. (26) Oakes, V.; Wang, W.; Harrington, B.; Lee, W. J.; Beamish, H.; Chia, K. M.; Pinder, A.; Goto, H.; Inagaki, M.; Pavey, S.; Gabrielli, B. Cyclin a/cdk2 regulates cdh1 and claspin during late S/G2 phase of the cell cycle. Cell Cycle 2014, 13, 3302−3311. (27) de la Fuente, C.; Santiago, F.; Chong, S. Y.; Deng, L. W.; Mayhood, T.; Fu, P.; Stein, D.; Denny, T.; Coffman, F.; Azimi, N.; Mahieux, R.; Kashanchi, A. Overexpression of p21waf1 in Human TCell Lymphotropic Virus Type 1-Infected cells and its association with Cyclin A/cdk2. J. Virol. 2000, 74, 7270−7283. (28) Tu, Y. S.; Kang, X. L.; Zhou, J. G.; Lv, X. F.; Tang, Y. B.; Guan, Y. Y. Involvement of Chk1−Cdc25A-cyclin A/CDk2 pathway in simvastatin induced S-phase cell cycle arrest and apoptosis in multiple myeloma cells. Eur. J. Pharmacol. 2011, 670, 356−364. (29) Ding, X. L.; Husseman, J.; Tomashevski, A. J.; Nochlin, D.; Jin, L. W.; Vincent, I. The cell cycle Cdc25A tyrosine phosphatase is activated in degenerating postmitotic neurons in Alzheimer’s disease. Am. J. Pathol. 2000, 157, 1983−1990. (30) Liu, P.; Barkley, L. R.; Day, T.; Bi, X. H.; Slater, D. M.; Alexandrow, M. G.; Nasheuer, H. P.; Vaziri, C. The Chk1-mediated Sphase Checkpoint Targets Initiation Factor Cdc45 via a Cdc25A/ Cdk2-independent Mechanism. J. Biol. Chem. 2006, 281, 30631− 30644. (31) Fan, J. P.; Kim, H. S.; Han, G. D. Induction of apoptosis bylcarnitine through regulation of two main pathways in Hepalclc 7 cells. Amino Acids 2009, 36, 365−372. (32) Mahmood, Z.; Shukla, Y. Death receptors: targets for cancer therapy. Exp. Cell Res. 2010, 316, 887−899. (33) Cosman, D. A family of ligands for the TNF receptor superfamily. Stem Cells 1994, 12, 440−455. (34) Hao, C.; Beguinot, F.; Condorelli, G.; Trencia, A.; Van Meir, E. G.; Yong, V. W.; Parney, I. F.; Roa, W. H.; Petruk, K. C. Induction and Intracellular Regulation of Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Mediated Apotosis in Human Malignant Glioma Cells. Cancer Res. 2001, 61, 1162−1170.

Major Projects of Science and Technology in Anhui Province (1804b06020347, 17030701028, 18030701142, and 18030701158). Notes

The authors declare no competing financial interest.

■

REFERENCES

(1) Ai, Z. H.; Yin, L. H.; Zhou, X. R.; Zhu, Y.; Zhu, D. M.; Yu, Y. H.; Feng, Y. J. Inhibition of survivin reduces cell proliferation and induces apoptosis in human endometrial cancer. Cancer 2006, 107, 746−756. (2) Tong, J. S.; Zhang, Q. H.; Huang, X.; Fu, X. Q.; Qi, S. T.; Wang, Y. P.; Hou, Y.; Sheng, J.; Sun, Q. Y. Icaritin Causes Sustained ERK1/2 Activation and Induces Apoptosis in Human Endometrial Cancer Cells. PLoS One 2011, 6, No. e16781-. (3) Peng, X. H.; Nie, Y.; Wu, J. J.; Huang, Q.; Cheng, Y. Q. Juglone prevents metabolic endotoxemia-induced hepatitis and neuroinflammation via suppressing TLR4/NF-κB signaling pathway in high-fat diet rats. Biochem. Biophys. Res. Commun. 2015, 462, 245−250. (4) Kobayashi, M.; Terui, Y.; Tori, K.; Tsuji, K. Carbon-13 NMR spectra of juglone, naphthazarin and their derivatives. Tetrahedron Lett. 1976, 17, 619−620. (5) Rudnicka, M.; Polak, M.; Karcz, W. Cellular responses to naphthoquinones: juglone as a case study. Plant Growth Regul. 2014, 72, 239−248. (6) Zhang, X. B.; Zou, C. L.; Duan, Y. X.; Wu, F.; Li, G. Activity guided isolation and modification of juglone from Juglans regia as potent cytotoxic agent against lung cancer cell lines. BMC Complementary Altern. Med. 2015, 15, 396−403. (7) Xu, H. L.; Yu, X. F.; Qu, S. C.; Qu, X. R.; Jiang, Y. F.; Sui, D. Y. Juglone, from Juglans mandshruica Maxim, inhibits growth and induces apoptosis in human leukemia cell HL-60 through a reactive oxygen species-dependent mechanism. Food Chem. Toxicol. 2012, 50, 590−596. (8) Aithal, B. K.; Kumar, M. R.; Rao, B. N.; Udupa, N.; Rao, B. S. Juglone, a naphthoquinone from walnut, exerts cytotoxic and genotoxic effects against cultured melanoma tumor cells. Cell Biol. Int. 2009, 33, 1039−1049. (9) Ji, Y. B.; Qu, Z. Y.; Zou, X. Juglone-induced apoptosis in human gastric cancer SGC-7901 cells via the mitochondrial pathway. Exp. Toxicol. Pathol. 2011, 63, 69−78. (10) Avci, E.; Arikoglu, H.; Erkoc Kaya, D. Investigation of juglone effects on metastasis and angiogenesis in pancreatic cancer cells. Gene 2016, 588, 74−78. (11) Zhang, W.; Liu, A.; Li, Y.; Zhao, X.; Lv, S.; Zhu, W.; Jin, Y. Anticancer activity and mechanism of juglone on human cervical carcinoma HeLa cells. Can. J. Physiol. Pharmacol. 2012, 90, 1553− 1558. (12) Nowicka, B.; Zadło, A.; Plucinski, B.; Kruk, J.; Kuczynska, P. The oxidative stress in allelopathy: Participation of prenyllipid antioxidants in the response to juglone in, Chlamydomonas reinhardtii. Phytochemistry 2017, 144, 171−179. (13) Ji, Y. B.; Qu, Z. Y.; Zou, X. Juglone-induced apoptosis in human gastric cancer SGC-7901 cells via the mitochondrial pathway. Exp. Toxicol. Pathol. 2011, 63, 69−78. (14) Fang, F.; Qin, Y.; Qi, L.; Fang, Q.; Zhao, L.; Chen, S.; Li, Q.; Zhang, D.; Wang, L. G. Juglone exerts antitumor effect in ovarian cancer cells. Iran. J. Basic Med. Sci. 2015, 18, 544−548. (15) Colaric, M.; Veberic, R.; Solar, A.; Hudina, M.; Stampar, F. Phenolic Acids, Syringaldehyde, and Juglone in Fruits of Different Cultivars of Juglans regia L. J. Agric. Food Chem. 2005, 53, 6390− 6396. (16) Sun, G. D.; Huo, J. H.; Wang, G. L.; Wang, W. M. Identification and characterization of chemical constituents in Cortex JuglandisMandshuricae based on UPLC-Q-TOF/MS. Chin. Tradit. Herbal Drugs 2017, 48, 657−667 (in Chinese) . (17) Hövelmann, Y.; Hahn, M.; Hü bner, F.; Humpf, H.-U. Detection of Novel Cytotoxic Imidazole Alkaloids in Tomato Products by LC-MS/MS. J. Agric. Food Chem. 2019, 67, 3670−3678. 7388

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389

Article

Journal of Agricultural and Food Chemistry (35) Yan, Q.; Mcdonald, J. M.; Song, Y. Abstract 19: Structural insight for the role of Fas binding to FADD and oligomerization degree of Fas/FADD complex in death inducing signaling complex formation. Cancer Res. 2011, 71, 19−19. (36) Salvesen, G. S.; Riedl, S. J. Structure of the Fas/FADD complex: A conditional death domain complex mediating signaling by receptor clustering. Cell Cycle 2009, 8, 2723−2727. (37) Truong-Tran, A. Q.; Carter, J.; Ruffin, R. E.; Zalewski, P. D. The role of zinc in caspase activation and apoptotic cell death. BioMetals 2001, 14, 315−330. (38) Lademann, U.; Kallunki, T.; Jäaẗ telä, M. A20 zinc finger protein inhibits TNF-induced apoptosis and stress response early in the signaling cascades and independently of binding to TRAF2 or 14−3-3 proteins. Cell Death Differ. 2001, 8, 265−272. (39) Morgan, M. J.; Thorburn, J.; Thomas, L.; Maxwell, T.; Brothman, A. R.; Thorburn, A. An apoptosis signaling pathway induced by the death domain of FADD selectively kills normal but not cancerous prostate epithelial cells. Cell Death Differ. 2001, 8, 696− 705. (40) Pollack, M.; Leeuwenburgh, C. Apoptosis and Aging Role of the Mitochondria. J. Gerontol., Ser. A 2001, 56, B475−B482. (41) Lee, H. C.; Wei, Y. H. Mitochondrial role in life and death of the cell. J. Biomed. Sci. 2000, 7, 2−15. (42) Drahota, Z.; Milerová, M.; Endlicher, R.; Rychtrmoc, D.; Č ervinková, Z.; Ošt’ádal, B. Developmental changes of the sensitivity of cardiac and liver mitochondrial permeability transition pore to calcium load and oxidative stress. Physiol. Res. 2012, 61, S165−S182. (43) Krysko, D. V.; Roels, F.; Leybaert, L.; D’Herde, K. Mitochondrial transmembrane potential changes support the concept of mitochondrial heterogeneity during apoptosis. J. Histochem. Cytochem. 2001, 49, 1277−1284. (44) Jain, M. V.; Paczulla, A. M.; Klonisch, T.; Dimgba, F. N.; Rao, S. B.; Roberg, K.; Schweizer, F.; Lengerke, C.; Davoodpour, P.; Palicharla, V. R.; Maddika, S.; Łos, M. Interconnections between apoptotic, autophagic and necrotic pathways: implications for cancer therapy development. J. Cell. Mol. Med. 2013, 17, 12−29. (45) Wang, P.; Gao, C.; Wang, W.; Yao, L. P.; Zhang, J.; Zhang, S. D.; Li, J.; Fang, S. H.; Fu, Y. J. Juglone induces apoptosis and autophagy, via, modulation of mitogen-activated protein kinase pathways in human hepatocellular carcinoma cells. Food Chem. Toxicol. 2018, 116, 40−50. (46) Stojnev, S.; Ristićpetrović, A.; Jankovićvelicković, L. Reactive oxygen species, apoptosis and cancer. Vojnosanit. Pregl. 2013, 70, 675−678. (47) Xu, H.; Yu, X.; Qu, S.; Sui, D. Y. Juglone, isolated from Juglans mandshurica Maxim, induces apoptosis via down-regulation of AR expression in human prostate cancer LNCaP cells. Bioorg. Med. Chem. Lett. 2013, 23, 3631−3634. (48) Jiang, L.; Allagnat, F.; Nguidjoe, E.; Kamagate, A.; Pachera, N.; Vanderwinden, J. M.; Brini, M.; Carafoli, E.; Eizirik, D. L.; Cardozo, A. K.; Herchuelz, A. Plasma membrane Ca2+-ATPase overexpression depletes both mitochondrial and endoplasmic reticulum Ca2+ stores and triggers apoptosis in insulin-secreting BRIN-BD11 cells. J. Biol. Chem. 2010, 285, 30634−30643.

7389

DOI: 10.1021/acs.jafc.9b02759 J. Agric. Food Chem. 2019, 67, 7378−7389