Mesoporous Carbon Nanospheres Featured Fluorescent

ARTICLE

Mesoporous Carbon Nanospheres Featured Fluorescent Aptasensor for Multiple Diagnosis of Cancer in Vitro and in Vivo Chengyi Li, Ying Meng, Shanshan Wang, Min Qian, Jianxin Wang, Weiyue Lu, and Rongqin Huang* Department of Pharmaceutics, School of Pharmacy, Key Laboraty of Smart Drug Delivery, Ministry of Education, Fudan University, Shanghai 201203, China

ABSTRACT Multiple diagnosis of cancer by a facile fluorescent

sensor is extremely attractive. Herein, a Cy3-labeled ssDNA probe (P0-Cy3) was π
π stacked on the surface of oxidized mesoporous carbon nanospheres (OMCN) to construct the fluorescent “turn-on” aptasensor. Attributing to the intrinsic properties of OMCN, the OMCN-based aptasensor not only can be used to detect mucin1 protein in liquid with a wide range of 0.1
10.6 μmol/L, a low detection limit of 6.52 nmol/L, and good selectivity, but also can quantify the cancer cells in solution with the linear range of 104
2  106 cells/mL and a detection limit of 8500 cells/mL. Fascinatingly, this OMCN-based aptasensor was exploited to image cancer via solid tissues such as cells, tissue sections, and ex vivo and in vivo tumors, in which the obvious distinguishability between cancer and normal tissues was clearly demonstrated. This is a robust and simple detection technique, which can well achieve the multiple diagnosis of cancer in vitro and in vivo. KEYWORDS: mesoropous carbon nanospheres . mucin1 . multiple diagnosis . aptasensor . fluorescent imaging

T

he increased global cancer incidence and mortality in recent years has spurred cancer diagnosis (detection or imaging) technology to become extremely important due to its great effects in early cancer identification, drug discovery and development, as well as monitoring patients' responses to therapy.1,2 To consolidate the diagnosis, a combination of various biochemical tests or imaging techniques, including enzyme-linked immunosorbent assay (ELISA), hematoxylin-eosin (H&E) staining, computed tomography (CT), or magnetic resonance imaging (MRI), is often needed to be done on different tissues, which therefore increases the complexity. What is worse, many of these techniques lack specificity, and consequently cause many false positives.3,4 Recently, biosensors based on quenching-recovering (turn-on) mechanisms are recognized as sensitive and reliable analytical tools for cancer detection.5,6 However, most fluorescent biosensors were convenient to detect the cancer biomarkers (nucleic acids, peptides, or proteins) in fluid tissue (blood),7,8 while LI ET AL.

the evident imaging of solid tissues, especially the in vivo tumors for more robust in situ cancer diagnosis, is seldom exploited. Therefore, continuing interest is aroused to search for new fluorescence quenching materials to construct special biosensors for the ultimate cancer diagnosis by multiple detections. Carbon nanomaterials, including onedimensional carbon nanotubes (CNT)9,10 and two-dimensional graphene oxide (GO),11,12 have often been used to construct fluorescent “turn-on” biosensors due to their unique functions such as excellent fluorescence quenching by noncovalent π
π stacking interactions with fluorescently labeled single-stranded DNA (ssDNA),13 and quantitative recovery after exposure to the targets. Nevertheless, unitary detection of in vitro fluid tissue is still prevalent based on these “turn-on” biosensors.14,15 Possible reason for this situation is the anisomerous dimensions of CNT and GO, which resulted in either serious toxicity, aggregation or functional groups only heterogeneously existing in margins.16
18 Most importantly, the one- and two-dimensional VOL. XXX

’

NO. XX

’

* Address correspondence to [email protected]. Received for review August 17, 2015 and accepted November 17, 2015. Published online 10.1021/acsnano.5b05137 C XXXX American Chemical Society

000–000

’

XXXX

A www.acsnano.org

RESULTS AND DISCUSSION MCN were synthesized according to previous reports. After oxidation, OMCN remained as uniformed nanospheres with diameter around 100 nm (Figure 1A). Transmission electron microscopy (TEM) images showed that the nanospheres were much more dispersed due to the oxidation-resulted hydrophilicity (Figure 1B and bottom inset). High resolution TEM (HRTEM) image demonstrated that OMCN possessed ordered mesopores with size of about 3 nm (top inset in Figure 1B). The typical (110) and (211) reflections at q values of 0.73 and 1.26 nm
1 in SAXS pattern indicated that the highly ordered mesopores of OMCN were structured by body-centered cubic Im3m mesostructure (Figure 1C).28 The XRD pattern of OMCN exhibited two distinct diffraction peaks at 2θ values of 22.3° and 43.3°, which could be indexed as the (002) and (100) reflections of graphitic carbon, respectively (Figure 1C), revealing that OMCN had graphitization domains.29 This could also be supported by the Raman spectra, which gave obvious LI ET AL.

ARTICLE

structures might be not beneficial for their fully homogeneous interactions with solid tumors owing to the high rotational energy in the relative rigid tissues.19 Comparatively, as a kind of three-dimensional carbon nanomaterials, mesoporous carbon nanospheres (MCN) may overcome these drawbacks of CNT and GO. For example, (1) the three-dimensional spherical structure with well-defined mesoporosity, large surface area, and high pore volume is beneficial to interact with biomolecules by the homogeneous production of functional groups on their surfaces via oxidation,20,21 and (2) the three-dimensional nanospheres with low rotational energy are easy to homogeneously interact with the solid tumors for the stability and sensitivity of sensing signals in vivo.22 Moreover, MCN are biocompatible, and have been exploited as an excellent drug vehicle and photothermal convertor for cancer photothermochemotherapy.23,24 Therefore, MCN are expected to be an encouraging class of potential fluorescence quencher for novel “turn-on” biosensing, which might achieve the multiple diagnosis of cancer via various tissues in vitro and in vivo. Herein, a dye (Cy3)-labeled ssDNA probe (P0 aptamer), which can specifically bind to cell-surface mucin1 (MUC1) marker overexpressed in many malignant tumors including breast cancer and prostate cancer,25
27 was π
π stacked on the surface of oxidized MCN (OMCN) for the “turn-on” fluorescent aptamer-based sensor (aptasensor). This OMCN featured fluorescent aptasensor not only can quantify the MUC1 molecules and MCF-7 tumor cells in fluid with high sensitivity, but also can clearly image the cancer cells, ex vivo tissues, and solid tumors with high specificity. Thus, the fabricated aptasensor can achieve the consolidated multiple diagnosis of cancer in vitro and in vivo.

Figure 1. (A) SEM and (B) TEM images of OMCN. Top inset in (B) is the magnified image of OMCN, while bottom inset is the TEM image of pristine MCN. (C) SAXS pattern and corresponding high angle XRD pattern (inset) of OMCN. (D) XPS and corresponding deconvoluted C 1s spectra (inset) of OMCN.

signals similar to the symmetry A1g mode and E2g mode of graphitic carbon atoms at 1350 cm
1 (D-band), 1590 cm
1 (G-band), and 2770 cm
1 (2D-band) (Figure S1B).30 XPS results showed that OMCN was composed of 74.6 atom % C and 24.8 atom % O (Figure 1D). The C 1s spectrum could be deconvoluted into graphitic or aliphatic carbon at 284.5 eV (CdC/C
C), and oxygenated carbon at 286.2 eV (C
O) and 288.6 eV (CdO), respectively.31 This confirmed the existence of graphitization domains, and it also suggested the surface oxidation. The well oxygenated status with hydrophilic groups could also be revealed by the IR spectrum of OMCN, which gave additional carboxyl (
COOH) vibrations such as νCdO at 1690 cm
1 and νC
O at 1077 cm
1, as compared with that of MCN (Figure S1A). The zeta potential of OMCN was about
47.8 mV, which was much lower than that of MCN (
17.3 mV) due to the surface oxidation. All these results suggested that OMCN are well-defined homogeneous nanospheres with high dispersity, ordered mesopores, hydrophilic surface, and graphitization domains, which would be an ideal platform for fluorescent “turn-on” biosensing via appropriate π
π stacking interactions. Schematic illustration of the preparation and performances of the OMCN-based “turn-on” aptasensor are shown in Figure 2A. A dye (Cy3)-labeled ssDNA probe (P0-Cy3) was π
π stacked on the surface of OMCN, and the Cy3 fluorescence was quickly and totally quenched within 7 min (Figure S2A). Correspondingly, the fluorescence quenching efficiency can approximately reach 100% due to the graphitization domains of OMCN, which was similar to that of graphene oxide (99.9%) and graphite nanoparticle (97.7%),32,33 in spite of the higher OMCN concentration involved in our work. After exposure to the overexpressed MUC1 of malignant tumors, P0-Cy3 was gradually released from VOL. XXX

’

NO. XX

’

000–000

’

B

XXXX www.acsnano.org

ARTICLE Figure 2. (A) Schematic illustration of the sensing principle based on the OMCN/P0-Cy3 aptasensor. (B) MUC1 responsive fluorescent recovery in the buffer solution recorded by fluorescence spectrophotometer. (C
E) Sensing performances of the OMCN/P0-Cy3 aptasensor in cell level (confocal fluorescence microscopy image), tissue level (inverted fluorescence microscopy image), and whole animal level (in vivo fluorescent image), respectively.

OMCN due to the much stronger interaction between P0-Cy3 and MUC1 than that between P0-Cy3 and MUC1. Consequently, an obvious fluorescence recovery was observed within 10 min (Figure S2A). Both the fluorescence quench and recovery exhibited OMCN concentrationdependent performance, in which the highest recovery/ quenching ratio could reach 9.9 at OMCN concentration of 300 μg/mL (Figure S2B). At the optimal conditions, the prepared OMCN-based aptasensor can be used to quantify MUC1 or cancer cells in Tris-HCl buffer solution, 4% serum-containing buffer solution, and MCF-7 cells-containing buffer solution, respectively (Figure S3). The detection limit and linear range are shown in Table 1. Notably, the detectability of the OMCN-based aptasensor was seriously subjected to the sensitivity of the instruments. Using a more sensitive Infinite M1000 Pro microplate reader for fluorescent measurement, much lower detection limit and enlarged linear range were achieved in different solutions (Figure S4 and Table 1). The detection limit, especially in the serum contained medium, was superior to that of many other carbon-based biosensors, such as graphene (44.7 nM),34 GO (28 nM)35 and Rul-GO (40 nM).36 In addition, the OMCN-based aptasensor had a good repeatability for 5 times detections (Figure S5 and Table S1) and acceptable stability after 12 h of storage (Figure S6 and Table S1), as well as 92
108% recoveries for detecting the approximately practical fluid tissues (Table S1), in different mediums. These results were comparable with those for nanomaterials or systems in many other reports, such as GO, GO-based microfluidic chips, and sliver-carbon nanotubes.37
39 More importantly, due to the specific binding between LI ET AL.

TABLE 1. Linear Range and Detection Limit of the OMCN/ P0-Cy3 Aptasensor for Detection of MUC1 or MCF-7 Cells in Different Mediums Using Common Fluorescence Spectrophotometer and Infinite M1000 Pro Microplate Reader common fluorescence

microplate reader Infinite

spectrophotometer

M1000 Pro (Tecan)

medium

linear range

detection limit

linear range

detection limit

Tris-HCl serum cella

1.06
10.6 μM 1.06
10.6 μM 105
2  106

67.8 nM 49.5 nM 9.3  104

0.10
2.12 μM 0.10
2.12 μM 104
2  105

7.05 nM 6.52 nM 8500

a

The unit of cells is cells/mL.

P0-Cy3 and MUC1, the OMCN-based aptasensor was insensitive to the interfering proteins such as cytochrome c, human serum albumin (HSA), and lysozyme (Figure S7), similar to the reported CNT or GO-based biosensors.40,41 The preferable detection ability of OMCN-based biosensors might be attributed to the spherical surfaces without sharp edges and the threedimensional porous framework with larger surface/ volume ratio, which could produce appreciated interactions for the sensitive affinity/detachment toward the target proteins.42 Therefore, these good performances of the OMCN-based “turn-on” aptasensor together with its anti-interfering ability suggested its practicability for diagnosis of breast cancer in fluid tissue such as blood or cell solution since MUC1 is overexpressed on this cancer. Besides the detection in fluid tissue, the OMCNbased “turn-on” aptasensor could also be used for diagnosis of breast cancer by targeting imaging of VOL. XXX

’

NO. XX

’

000–000

’

C

XXXX www.acsnano.org

ARTICLE Figure 4. Inverted fluorescence microscopy images of tumor sections treated without or with OMCN/P0-Cy3. Bar = 200 μm.

Figure 3. Different magnified confocal fluorescence microscopy images and corresponding 2.5 dimensional sectional views of MCF-7 cells incubated with OMCN/P0-Cy3 for different time periods. Scale bar: 50 μm (200 images) and 10 μm (900 images). (M
P) Scatter diagrams of MCF-7 cancer cells (M, N) and MCF-10A normal cells (O, P) incubated without or with OMCN/P0-Cy3, respectively. (Q) Flow cytometry of MCF-7 and MCF-10A cells incubated without or with OMCN/P0-Cy3. Blue line, MCF-7 cells (OMCN/P0-Cy3); red line, MCF-7 cells (control); green line, MCF-10A cells (OMCN/P0-Cy3) orange line, MCF-10A cells (control).

solid tissues, including cells, tissue sections, and ex vivo and in vivo tumors. As shown in Figure 2, the quenched fluorescence was all clearly turned on in these solid tissues, which gave obvious contrasts to distinguish breast cancer and normal tissues. For the cell imaging, after incubation of OMCN/P0-Cy3 with cells, enhanced fluorescence was observed with increased incubation times in MCF-7 cancer cells by confocal laser scanning microscopy (CLSM) (Figure 3A
L), while there was not any fluorescence in all normal MCF-10A cells (Figure S9), in good agreement with the results in solution. Flow cytometric assay confirmed the excellent fluorescence imaging ability of OMCN/P0-Cy3 aptasensor for cancer cells, as revealed by larger percentage of MCF-7 cells (56.5%) with strong fluorescence signal than that of MCF-10A cells (0.8%) (Figure 3Q). Comparatively, no apparent fluorescence could be observed within both cells without any treatment (Figure 3M
Q). These results suggested that P0-Cy3 could be detached from LI ET AL.

OMCN by competitive binding with MCF-7, which was then responsible for the diagnosis of breast cancer at the cellular level. Especially, the OMCN-assisted fluorescence quenching can avoid fluorescent background from the untargeted P0-Cy3 in cell culture solution,32 without time-consuming and cell-loss washing process. And, it was found in 2.5D sectional imaging that majority of OMCN/P0-Cy3 could be transferred into MCF-7 cells, suggesting its ability as a vehicle for intracellular drug delivery.43,44 In addition, the cytotoxicity results (Figure S8) indicated that OMCN had negligible toxicity against MCF-7 and MCF-10A cells even at the high concentration (1000 μg/mL), which further suggested the potential application of the OMCN/P0-Cy3 aptasensor in living systems. For imaging of tissue sections, obvious fluorescence was observed in the tumor sections when treated with the OMCN/P0-Cy3 aptasensor (Figure 4), whereas this unique “turn-on” fluorescence was almost not visible in the normal tissue sections such as kidney and liver whether they were treated with the aptasensor (Figure S10). This imaging performance also evidenced the sensitive diagnosis of breast cancer via tissue sections by using the OMCN-based aptasensor. To consolidate the diagnosis, in vivo and ex vivo tumor specific imaging performances based on the OMCN/P0-Cy3 aptasensor were also investigated. As shown in Figure 5, subcutaneous injections of P0-Cy3 into nontumor sites of tumor-bearing nude mice (I in Figure 5) and normal nude mice (III in Figure 5) both resulted in the obvious fluorescence, which then decreased with time (Figure 5) due to the diffusion. Whereas, intratumoral injection of OMCN/P0-Cy3 into tumor-bearing nude mice led to a first enhancement after 30 min and then wearing off, which indicated the fluorescence of OMCN/P0-Cy3 can be recovered upon exposure to in vivo tumor despite the diffusion. In contrast, normal nude mice injected with OMCN/ P0-Cy3 exhibited no fluorescence which meant that normal tissues do not possess the recovering ability of VOL. XXX

’

NO. XX

’

000–000

’

D

XXXX www.acsnano.org

CONCLUSION

P0-Cy3. The ex vivo imaging results also showed that significantly higher fluorescence was observed within the tumor treated with OMCN/P0-Cy3 than that treated with P0-Cy3, indicating the tumor-accumulated ability of OMCN/P0-Cy3 (Figure 5F). Furthermore, no apparent fluorescence was observed in main organs. Fluorescent intensity was then quantified and is presented in Figure 5G. After treatment with OMCN/P0-Cy3, the fluorescence in tumor-bearing nude mice was strong while that in normal nude mice or in nontumor sites of tumor-bearing nude mice was hardly quantified. These results indicated that the prepared aptasensor can discern tumors from normal tissues in vivo and ex vivo with a positive expression, which also suggested its favorable prospects in further clinical applications. Moreover, a fascinating phenomenon was observed in in vivo imaging results (Figure 5). Tumor-bearing nude mice after intratumorally injected with P0-Cy3 presented relatively much lower fluorescent efficiency as compared to tumor-bearing nude mice with intratumoral injection of OMCN/P0-Cy3 and normal nude mice with subcutaneous injection of P0-Cy3. It was

In this work, a simple, sensitive and highly efficient fluorescent aptasensor for multiple diagnosis of breast cancer in vitro and in vivo was successfully constructed based on the unique interaction between P0-Cy3 and OMCN. The three-dimensional spherical OMCN with good dispersity, well-defined mesoporosity, obvious graphitization domains, and hydrophilic carboxyl surfaces could well quench the fluorescence of P0-Cy3 by noncovalent π
π stacking, which was then quantificationally recovered upon exposure to the targets. The OMCN featured fluorescent “turn-on” aptasensor not only can be used to quantify the MUC1 tumor marker molecules and MCF-7 tumor cells in fluid with high sensitivity, but also can be used to clearly image the cancer cells, ex vivo tissues, and solid tumors with high specificity. This advanced OMCN-based aptasensor which could consolidate the diagnosis of cancer by multiple detection and imaging, together with the facile preparation and the intrinsic multifunctions (drug vehicle and photothermal convertor for cancer photothermotherapy), exhibited robust potential applications for cancer diagnosis and therapy.

EXPERIMENTAL SECTION

purchased from China Peptides Co. Ltd. (Shanghai, China). Fetal bovine serum (FBS), phosphate buffer solution (PBS), penicillin, and streptomycin were obtained from Hyclone. RPMI 1640 medium, Dulbecco's modified Eagle's medium (DMEM), trypsin, and L-glutamine were purchased from Gibco. Phenol, formaldehyde, D-Glu, phenol red, Tris, and other reagents, if not

Materials and Reagents. P0-Cy3 (50 to 30 : GCAGTTGATCCTTTGGATACCCTGG, 50 decorated with Cy3 fluorophore), cytochrome c, and lysozyme were purchased from Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China). MUC1 (N f C: PDTRPAPGSTAPPAHGVTSAPDTRPAPGSTAPPA HGVTSA) was

LI ET AL.

ARTICLE

Figure 5. In vivo fluorescent images of normal and tumorbearing nude mice treated with P0-Cy3 and OMCN/P0-Cy3. Images were taken at 0 min (A), 5 min (B), 15 min (C), 30 min (D), and 60 min (E). (F) Ex vivo fluorescent images of isolated tumors and major organs after injection for 60 min. (G) Fluorescent quantitative results of tumor-bearing and normal nude mice treated with P0-Cy3 and OMCN/P0-Cy3. Green dotted lines pointed out the position of tumor, and black dotted lines are the location for subcutaneous injections. Numbers I and II represent tumor-bearing nude mice treated with P0-Cy3 and OMCN/P0-Cy3 and their fetched tumors and organs, respectively. Numbers III and IV are normal nude mice treated with P0-Cy3 and OMCN/P0-Cy3 and their fetched tumors and organs, respectively.

speculated that P0-Cy3 is a kind of relatively small molecule which diffuses easily and fleetly to the whole body through abundant blood vessels within the tumor. Whereas, much less blood vessels in subcutaneous tissue made the subcutaneous injection of P0-Cy3 present much stronger and gave lasting fluorescence due to its much longer in situ stay.45,46 This speculation was demonstrated by the result that nude mice with intravenous injection of P0-Cy3 exhibited no observed fluorescence in the whole body (Figure S11). However, tumor-bearing mice intratumorally injected with OMCN/P0-Cy3 showed strong fluorescent recovery over time. This was also an inspiring and explicable result. OMCN are nanoscaled materials which own a tendency to accumulate in tumors because of the enhanced permeability and retention (EPR) effect.47 Meanwhile, P0-Cy3 was noncovalently stacked on OMCN adequately before injection, which caused the retention of P0-Cy3 within the tumor and strong fluorescence recovery due to its specific binding with MUC1 subsequently. These results also proved that OMCN play an important role in biosensors and also in active/passive targeting accumulation when used as drug carriers.

VOL. XXX

’

NO. XX

’

000–000

’

E

XXXX www.acsnano.org

LI ET AL.

the OMCN/P0-Cy3 was incubated within these approximately practical fluid tissues for 10 min. The corresponding recoveries were calculated according to the following formula: R% ¼

f (A)
f (B)  100% C

where A is the fluorescence intensity with MUC1 or MCF-7 cells, B is the fluorescence intensity without MUC1 or MCF-7 cells, C is the actual concentration of MUC1 or MCF-7 cells, R is the recovery, and f(x) is the fluorescence intensity-concentration calibration. To evidence the anti-interference ability of the prepared OMCN/P0-Cy3 aptasensor, 20 μmol/L cytochrome c, 20 μmol/L human serum albumin (HSA), or 20 μmol/L lysozyme, instead of MUC1 was used to recover the fluorescence. Cytotoxicity. MCF-7 and MCF-10A cells were incubated with different concentrations of OMCN (15
1000 μg/mL) at 37 °C and in 5% CO2 for 24 h. And the cell viability experiments were conducted using Cell Counting Kit-8 reagent. Confocal Microscopy and Flow Cytometry. Human mammary carcinoma MCF-7 cells and nontumorigenic MCF-10A breast epithelial cells were obtained from America Type Culture Collection. MCF-7 and MCF-10A cells were maintained in RPMI 1640 medium (15% FBS) and DMEM (10% FBS) at 37 °C and in 5% CO2, respectively. For confocal microscopy experiments, MCF-7 and MCF-10A cells were incubated with OMCN/P0-Cy3 solution (60 μg/mL of OMCN) for 5 min, 30 and 60 min, respectively. The fluorescence images were recorded using CLSM. The cells without incubation of OMCN/P0-Cy3 solution were used as control. For the flow cytometry experiments, cells were incubated with OMCN/P0-Cy3 solution for 60 min, trypsin-treated, and analyzed via the flow cytometer. Construction of MCF-7 Tumor-Bearing Nude Mice Models. Female Balb/c nude mice, about 5 weeks, were purchased from Department of Experimental Animals, Fudan University, and maintained under standard housing conditions. MCF-7 cells (2  106 cells/100 μL PBS) were slowly subcutaneously implanted into the right flank of mice. When the tumor volume reached about 200 mm3, nude mice models were prepared for the following experiments. All animal experiments were carried out in accordance with guidelines evaluated and approved by the ethics committee of Fudan University. Fluorescence Imaging of Frozen Sections and Living Imaging. Sections (10 μm) of tumor and normal organs (kidney and liver) were incubated with OMCN/P0-Cy3 solution for 1 h. Then fluorescence images of the sections were taken using an inverted fluorescence microscope. Normal (subcutaneous injection) and MCF-7 tumorbearing (intratumoral injection) nude mice were separately injected with 100 μL P0-Cy3 solution (Tris-HCl, 200 nmol/L) and 100 μL OMCN/P0-Cy3 (Tris-HCl, 300 μg/mL of OMCN) solution. Subcutaneous injection of P0-Cy3 solution in tumor-bearing nude mice was also carried for comparison. All the mice were imaged under the Maestro-2 instrument before and after injection for 5, 15, 30, and 60 min, respectively. After that, nude mice were sacrificed, and tumor and normal organs (heart, liver, spleen, lung and kidney) were fetched and observed. And corresponding florescence intensity was quantified by using IVIS software. Conflict of Interest: The authors declare no competing financial interest.

ARTICLE

specified, were purchased from Sinopharm Chemical Reagent Co. Ltd. (Shanghai, China). Apparatus. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) measurements were observed on an Ultra 55 electron microscope (Germany) and JEOL-2100F electron microscope (Japan), respectively. Small angle X-ray scattering (SAXS) was performed with a NanoStar U SAXS system (Germany) using Cu KR radiation (40 kV, 35 mA). X-ray diffraction patterns (XRD) were analyzed using a Bruker D8 Advance & Davinci Design diffractometer (Germany) by using Cu KR radiation at 40 kV and 60 mA. X-ray photoelectron spectroscopy (XPS) was conducted with Al KR radiation (hν = 1486.6 eV) using a RBD-upgraded PHI-5000C ESCA system. Raman spectra were performed with a SPEX-403 spectrometer (France). Infrared spectra (IR) were carried out with Thermo Nicolet AVATAR 360FT-IR. Fluorescent emission spectra were conducted on an Angilent-G9800A fluorescence spectrophotometer and Tecan Infinite M1000 Pro microplate reader (Switzerland). The confocal microscopy experiments were observed using a Carl Zeiss LSM710 instrument (Germany). Flow cytometry experiments were performed with a BD FACS Aria II apparatus. Frozen sections were obtained with a Labconcofreezon6 instrument and observed under a Leica- DMI4000D fluorescent microscope (Germany). Live cell imaging was processed and analyzed with a Maestro-2 system. Preparation of OMCN and the Aptasensor. MCN were prepared according to protocol in a previous work.48 Typically, phenol (0.6 g) and formalin aqueous solution (2.1 mL, 37 wt %) were mixed and stirred with NaOH solution (15 mL, 0.1 M) at 70 °C for 30 min, then added to Pluronic F127 solution (0.064 g/mL, 15 mL) and stirred at 66 °C for 2 h. Distilled water (50 mL) was added and continued to agitate for 17 h. Then, it was diluted with 260 mL of water and heated at 130 °C for 24 h. The yellow powders were collected, washed with water and freeze-dried. Finally, the dry powders were graphitized under a highly pure N2 atmosphere by gradient warming. For the synthesis of OMCN, MCN were treated in an acid mixture of H2SO4/HNO3 = 3/1 (v/v) by ultrasonication for 2 h and stirring at 50 °C for 2 h. OMCN were obtained by centrifugation, water washing, and drying. Then, OMCN/P0-Cy3 aptasensor was prepared by shaking suitable amounts of OMCN with P0-Cy3 solution in 37 °C for 10 min (160 rpm). Time and Concentration Dependent Fluorescent Recovery. To determine the time-dependent manner, the fluorescence of OMCN/ P0-Cy3 aptasensor with 300 μg/mL OMCN and 200 nmol/L of P0-Cy3 was recovered by 10.6 μmol/L MUC1 in Tris-HCl solution for different time, and the fluorescence was measured under a fluorescence spectrophotometer at every time point. To determine the concentration-dependent manner, the OMCN/P0-Cy3 aptasensors were first prepared using gradient concentrations of OMCN (30
780 μg/mL) and 200 nmol/L P0-Cy3. After these aptasensors were incubated with or without MUC1 (10.6 μmol/L) in Tris-HCl solution for 10 min, the fluorescence were measured using fluorescence spectrophotometer. Detection of MUC1 and MCF-7 Cells in Different Buffer Solutions. After incubation of OMCN/P0-Cy3 with different concentrations (0
10.6 μmol/L) of MUC1 solutions (Tris-HCl or 4% serum-containing Tris-HCl, respectively) or MCF-7 cells (0
2  106 cells/mL, Hank's buffer solution) for 10 min, respectively, the fluorescence was measured by fluorescence spectrophotometer. Also, the detection of low concentration MUC1 (0
2.12 μmol/L) and MCF-7 cells (0
2  105 cells/mL) was conducted using the Infinite M1000 Pro microplate reader according to the same procedure. To investigate the repeatability, the fluorescent aptasensor for detecting MUC1 (3.18 μmol/L) or MCF-7 cells (2  105 cells/mL) in different mediums by fluorescence spectrophotometer and Microplate reader were repeated for five times, respectively. The relative standard deviations (RSD) were calculated. To study the stability, the OMCN/P0-Cy3 aptasensor was stored in a dark place at 4 °C for 0, 4, 8, and 12 h before the measurements. To examine the recovery, different concentrations of MUC1 (1.06, 5.3, and 10.6 μmol/L) or MCF-7 cells (105, 5  105 and 106 cells/mL) were separately added into the interfering proteins (5 μmol/L HSA, lysozyme, and cytochrome c) or normal cells (MCF-10A, 2.5  105 cells/mL) solutions to simulate the complex samples or actual cell samples. Then,

Supporting Information Available: The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsnano.5b05137. IR and Raman spectra of MCN and OMCN; quenching and recovering efficiency of OMCN/P0-Cy3 as a function of time, OMCN or MUC1 concentrations; performances of the OMCN/P0-Cy3 aptasensor including repeatability, stability, and specificity; cell viability of MCF-7 and MCF-10A against OMCN; and confocal, inverted fluorescent, and in vivo fluorescent imaging results of control groups (PDF) Acknowledgment. This work was supported by the grants from National Natural Science Foundation of China (81573002), National Key Basic Research Program (2013CB932502) of China (973 Program), and Sino-German Research Project (GZ995).

VOL. XXX

’

NO. XX

’

000–000

’

F

XXXX www.acsnano.org

1. Siegel, R. L.; Miller, K. D.; Jemal, A. Cancer Statistics, 2015. Ca-Cancer J. Clin. 2015, 65, 5–29. 2. Bettegowda, C. Detection of Circulating Tumor DNA in Early-and Late-Stage Human Malignancies. Sci. Transl. Med. 2014, 6, 224ra24. 3. Siddiqui, M. M.; Rais-Bahrami, S.; Truong, H.; Stamatakis, L.; Vourganti, S.; Nix, J.; Hoang, A. N.; Walton-Diaz, A.; Shuch, B.; Weintraub, M.; et al. Magnetic Resonance Imaging/ Ultrasound-Fusion Biopsy Significantly Upgrades Prostate Cancer Versus Systematic 12-core Transrectal Ultrasound Biopsy. Eur. Urol. 2013, 64, 713–719. 4. Corley, D. A.; Jensen, C. D.; Marks, A. R.; Zhao, W. K.; Lee, J. K.; Doubeni, C. A.; Zauber, A. G.; de Boer, J.; Fireman, B. H.; Schottinger, J. E.; et al. Adenoma Detection Rate and Risk of Colorectal Cancer and Death. N. Engl. J. Med. 2014, 370, 1298–1306. 5. Geissler, D.; Stufler, S.; Lohmannsroben, H. G.; Hildebrandt, N. Six-Color Time-Resolved Forster Resonance Energy Transfer for Ultrasensitive Multiplexed Biosensing. J. Am. Chem. Soc. 2013, 135, 1102–1109. 6. Kairdolf, B. A.; Smith, A. M.; Stokes, T. H.; Wang, M. D.; Young, A. N.; Nie, S. M. Semiconductor Quantum Dots for Bioimaging and Biodiagnostic Applications. Annu. Rev. Anal. Chem. 2013, 6, 143–162. 7. Kirsch, J.; Siltanen, C.; Zhou, Q.; Revzin, A.; Simonian, A. Biosensor Technology: Recent Advances in Threat Agent Detection and Medicine. Chem. Soc. Rev. 2013, 42, 8733– 8768. 8. Li, M.; Cushing, S. K.; Zhang, J. M.; Suri, S.; Evans, R.; Petros, W. P.; Gibson, L. F.; Ma, D. L.; Liu, Y. X.; Wu, N. Q. ThreeDimensional Hierarchical Plasmonic Nano-Architecture Enhanced Surface-Enhanced Raman Scattering Immunosensor for Cancer Biomarker Detection in Blood Plasma. ACS Nano 2013, 7, 4967–4976. 9. Liu, Z.; Tabakman, S.; Welsher, K.; Dai, H. Carbon Nanotubes in Biology and Medicine: In vitro and in vivo Detection, Imaging and Drug Delivery. Nano Res. 2009, 2, 85–120. 10. De Volder, M. F. L.; Tawfick, S. H.; Baughman, R. H.; Hart, A. J. Carbon Nanotubes: Present and Future Commercial Applications. Science 2013, 339, 535–539. 11. Tang, Q.; Zhou, Z.; Chen, Z. F. Graphene-related Nanomaterials: Tuning Properties by Functionalization. Nanoscale 2013, 5, 4541–4583. 12. Yang, K.; Feng, L. Z.; Shi, X. Z.; Liu, Z. Nano-graphene in Biomedicine: Theranostic Applications. Chem. Soc. Rev. 2013, 42, 530–547. 13. Novoselov, K. S.; Fal'ko, V. I.; Colombo, L.; Gellert, P. R.; Schwab, M. G.; Kim, K. A Roadmap for Graphene. Nature 2012, 490, 192–200. 14. Chung, C.; Kim, Y. K.; Shin, D.; Ryoo, S. R.; Hong, B. H.; Min, D. H. Biomedical Applications of Graphene and Graphene Oxide. Acc. Chem. Res. 2013, 46, 2211–2224. 15. Zhou, Z.; Hartmann, M. Progress in Enzyme Immobilization in Ordered Mesoporous Materials and Related Applications. Chem. Soc. Rev. 2013, 42, 3894–3912. 16. Tamayo, J.; Kosaka, P. M.; Ruz, J. J.; San Paulo, A.; Calleja, M. Biosensors Based on Nanomechanical Systems. Chem. Soc. Rev. 2013, 42, 1287–1311. 17. Lu, W. B.; Zu, M.; Byun, J. H.; Kim, B. S.; Chou, T. W. State of the Art of Carbon Nanotube Fibers: Opportunities and Challenges. Adv. Mater. 2012, 24, 1805–1833. 18. Kuila, T.; Bose, S.; Mishra, A. K.; Khanra, P.; Kim, N. H.; Lee, J. H. Chemical Functionalization of Graphene and Its Applications. Prog. Mater. Sci. 2012, 57, 1061–1105. 19. Nardecchia, S.; Carriazo, D.; Ferrer, M. L.; Gutierrez, M. C.; del Monte, F. Three Dimensional Macroporous Architectures and Aerogels Built of Carbon Nanotubes and/or Graphene: Synthesis and Applications. Chem. Soc. Rev. 2013, 42, 794–830. 20. Qiao, Z. A.; Guo, B. K.; Binder, A. J.; Chen, J. H.; Veith, G. M.; Dai, S. Controlled Synthesis of Mesoporous Carbon Nanostructures via a 00 Silica-Assisted00 Strategy. Nano Lett. 2013, 13, 207–212.

LI ET AL.

21. Cheng, L.; Wang, C.; Feng, L. Z.; Yang, K.; Liu, Z. Functional Nanomaterials for Phototherapies of Cancer. Chem. Rev. 2014, 114, 10869–10939. 22. Liu, J.; Yang, T. Y.; Wang, D. W.; Lu, G. Q. M.; Zhao, D. Y.; Qiao, S. Z. A Facile Soft-Template Synthesis of Mesoporous Polymeric and Carbonaceous Nanospheres. Nat. Commun. 2013, 4, 2798. 23. Wang, Y.; Wang, K. Y.; Zhang, R.; Liu, X. G.; Yan, X. Y.; Wang, J. X.; Wagner, E.; Huang, R. Q. Synthesis of Core-Shell Graphitic Carbon@Silica Nanospheres with Dual-Ordered Mesopores for Cancer-Targeted Photothermochemotherapy. ACS Nano 2014, 8, 7870–7879. 24. Fang, Y.; Zheng, G. F.; Yang, J. P.; Tang, H. S.; Zhang, Y. F.; Kong, B.; Lv, Y. Y.; Xu, C. J.; Asiri, A. M.; Zi, J.; et al. Dual-Pore Mesoporous Carbon@ Silica Composite Core- Shell Nanospheres for Multidrug Delivery. Angew. Chem., Int. Ed. 2014, 53, 5366–5370. 25. Kimoto, M.; Yamashige, R.; Matsunaga, K.; Yokoyama, S.; Hirao, I. Generation of High-Affinity DNA Aptamers Using an Expanded Genetic Alphabet. Nat. Biotechnol. 2013, 31, 453–457. 26. Du, Y.; Li, B. L.; Wang, E. K. 00 Fitting00 Makes 00 Sensing00 Simple: Label-Free Detection Strategies Based on Nucleic Acid Aptamers. Acc. Chem. Res. 2013, 46, 203–213. 27. Gaidzik, N.; Westerlind, U.; Kunz, H. The Development of Synthetic Antitumour Vaccines from Mucin Glycopeptide Antigens. Chem. Soc. Rev. 2013, 42, 4421–4442. 28. Deng, Y. H.; Cai, Y.; Sun, Z. K.; Liu, J.; Liu, C.; Wei, J.; Li, W.; Liu, C.; Wang, Y.; Zhao, D. Y. Multifunctional Mesoporous Composite Microspheres with Well-Designed Nanostructure: A Highly Integrated Catalyst System. J. Am. Chem. Soc. 2010, 132, 8466–8473. 29. Qu, S.; Wang, X.; Lu, Q.; Liu, X.; Wang, L. A Biocompatible Fluorescent Ink Based on Water-Soluble Luminescent Carbon Nanodots. Angew. Chem., Int. Ed. 2012, 51, 12215– 12218. 30. Ferrari, A. C.; Basko, D. M. Raman Spectroscopy as a Versatile Tool for Studying the Properties of Graphene. Nat. Nanotechnol. 2013, 8, 235–246. 31. Zheng, Y.; Jiao, Y.; Ge, L.; Jaroniec, M.; Qiao, S. Z. Two-Step Boron and Nitrogen Doping in Graphene for Enhanced Synergistic Catalysis. Angew. Chem., Int. Ed. 2013, 52, 3110– 3116. 32. Ryoo, S. R.; Lee, J.; Yeo, J.; Na, H. K.; Kim, Y. K.; Jang, H.; Lee, J. H.; Han, S. W.; Lee, Y.; Kim, V. N.; et al. Quantitative and Multiplexed MicroRNA Sensing in Living Cells Based on Peptide Nucleic Acid and Nano Graphene Oxide (PANGO). ACS Nano 2013, 7 (7), 5882–5891. 33. Piao, Y. X.; Liu, F.; Seo, T. S. A Novel Molecular Beacon Bearing a Graphite Nanoparticle as a Nanoquencher for In situ mRNA Detection in Cancer Cells. ACS Appl. Mater. Interfaces 2012, 4, 6785–6789. 34. Wang, C.; Kim, J. H.; Zhu, Y. B.; Yang, J. Y.; Lee, S. W.; Yu, J.; Pei, R. J.; Liu, G. H.; Nuckolls, C.; Hone, J.; et al. An Aptameric Graphene Nanosensor for Label-Free Detection of Small Molecule Biomarkers. Biosens. Bioelectron. 2015, 71, 222– 229. 35. He, Y.; Lin, Y.; Tang, H. W.; Pang, D. W. A Graphene OxideBased Fluorescent Aptasensor for the Turn-On Detection of Epithelial Tumor Marker Mucin 1. Nanoscale 2012, 4, 2054–2059. 36. Wei, W.; Li, D. F.; Pan, X. H.; Liu, S. Q. Electrochemiluminescent Detection of Mucin 1 Protein And MCF-7 Cancer Cells Based On The Resonance Energy Transfer. Analyst 2012, 137, 2101–2106. 37. Song, E.; Cheng, D.; Song, Y.; Jiang, M. D.; Yu, J. F.; Wang, Y. Y. A Graphene Oxide-Based FRET Sensor for Rapid and Sensitive Detection of Matrix Metalloproteinase 2 in Human Serum Sample. Biosens. Bioelectron. 2013, 47, 445–450. 38. Cao, L. L.; Cheng, L. W.; Zhang, Z. Y.; Wang, Y.; Zhang, X. X.; Chen, H.; Liu, B. H.; Zhang, S.; Kong, J. L. Visual and HighThroughput Detection of Cancer Cells Using a Graphene Oxide-Based FRET Aptasensing Microfluidic Chip. Lab Chip 2012, 12, 4864–4869.

VOL. XXX

’

NO. XX

’

000–000

’

ARTICLE

REFERENCES AND NOTES

G

XXXX www.acsnano.org

ARTICLE

39. Lai, G. S.; Wu, J.; Ju, H. X.; Yan, F. Streptavidin-Functionalized Silver-Nanoparticle-Enriched Carbon Nanotube Tag for Ultrasensitive Multiplexed Detection of Tumor Markers. Adv. Funct. Mater. 2011, 21, 2938–2943. 40. Lei, J. P.; Ju, H. X. Signal Amplification Using Functional Nanomaterials for Biosensing. Chem. Soc. Rev. 2012, 41, 2122–2134. 41. Bianying, F.; Linjie, G.; Lihua, W.; Fan, L.; Jianxin, L.; Jimin, G.; Chunhai, F.; Qing, H. A Graphene Oxide-Based Fluorescent Biosensor for the Analysis of Peptide-Receptor Interactions and Imaging in Somatostatin Receptor Subtype 2 Overexpressed Tumor Cells. Anal. Chem. 2013, 85, 7732– 7737. 42. Liu, J.; Wickramaratne, N. P.; Qiao, S. Z.; Jaroniec, M. Molecular-Based Design and Emerging Applications of Nanoporous Carbon Spheres. Nat. Mater. 2015, 14, 763– 774. 43. Hermann, T.; Patel, D. J. Biochemistry - Adaptive Recognition by Nucleic Acid Aptamers. Science 2000, 287, 820–825. 44. Tan, W. H.; Donovan, M. J.; Jiang, J. H. Aptamers from CellBased Selection for Bioanalytical Applications. Chem. Rev. 2013, 113, 2842–2862. 45. Carmeliet, P.; Jain, R. K. Angiogenesis in Cancer and Other Diseases. Nature 2000, 407, 249–257. 46. Cheng, L.; Huang, Z.; Zhou, W. C.; Wu, Q. L.; Donnola, S.; Liu, J. K.; Fang, X. G.; Sloan, A. E.; Mao, Y. B.; Lathia, J. D.; et al. Glioblastoma Stem Cells Generate Vascular Pericytes to Support Vessel Function and Tumor Growth. Cell 2013, 153, 139–152. 47. Maeda, H.; Nakamura, H.; Fang, J. The EPR effect for Macromolecular Drug Delivery to Solid Tumors: Improvement of Tumor uptake, Lowering of Systemic Toxicity, and Distinct Tumor Imaging in vivo. Adv. Drug Delivery Rev. 2013, 65, 71–79. 48. Fang, Y.; Gu, D.; Zou, Y.; Wu, Z. X.; Li, F. Y.; Che, R. C.; Deng, Y. H.; Tu, B.; Zhao, D. Y. A Low-Concentration Hydrothermal Synthesis of Biocompatible Ordered Mesoporous Carbon Nanospheres with Tunable and Uniform Size. Angew. Chem., Int. Ed. 2010, 49, 7987–7991.

LI ET AL.

VOL. XXX

’

NO. XX

’

000–000

’

H

XXXX www.acsnano.org