Metabolic recruitment and directed evolution of nucleoside

Subscriber access provided by UNIV OF DURHAM

Article

Metabolic recruitment and directed evolution of nucleoside triphosphate uptake in Escherichia coli Valerie PEZO, Camille Hassan, Dominique Louis, Bruno Sargueil, Piet Herdewijn, and philippe marliere ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00048 • Publication Date (Web): 10 May 2018 Downloaded from http://pubs.acs.org on May 12, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Metabolic recruitment and directed evolution of nucleoside triphosphate uptake in Escherichia coli

Valérie Pezo*1,2, Camille Hassan3, Dominique Louis4, Bruno Sargueil5, Piet Herdewijn1,2, and Philippe Marlière*2,6

1 Génomique Métabolique, Genoscope, Institut François Jacob, CEA, CNRS, Univ Evry, Université Paris-Saclay, 91057 Evry, France 2 ISSB, Génopole, 5 rue Henri Desbruères, 91000 Evry, France 3 Isthmus, 81 rue Réaumur, 75002 Paris, France 4 Alderys, 86 Rue de Paris, 91400 Orsay, France 5 CNRS UMR 8015, Laboratoire de cristallographie et RMN Biologiques, Université Paris Descartes, 4 avenue de l’Observatoire, 75006 Paris, France 6 TESSSI, 81 rue Réaumur, 75002 Paris, France *Corresponding authors

1 ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 29

ABSTRACT We report the design and elaboration of a selection protocol for importing a canonical substrate of DNA polymerase, thymidine triphosphate (dTTP) in Escherichia coli. Bacterial strains whose growth depend on dTTP uptake, through the action of an algal plastid transporter expressed from a synthetic gene inserted in the chromosome, were constructed and shown to withstand the simultaneous loss of thymidylate synthase and thymidine kinase. Such thyA tdk dual deletant strains provide an experimental model of tight nutritional containment for preventing dissemination of microbial GMOs. Our strains transported the four canonical dNTPs, in the following order of preference: dCTP>dATP≥dGTP>dTTP. Prolonged cultivation under limitation of exogenous dTTP led to the enhancement of dNTP transport by adaptive evolution. We investigated the uptake of dCTP analogs with altered sugar or nucleobase moieties, which were found to cause a loss of cell viability and an increase of mutant frequency, respectively. E. coli strains equipped with nucleoside triphosphate transporters should be instrumental for evolving organisms whose DNA genome is morphed chemically by fully substituting its canonical nucleotide components.

KEYWORDS dNTP transporter, XNA, xeno-nucleic acid, trophic containment, Escherichia coli


Page 3 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The set of deoxynucleoside triphosphates (dNTPs) stands as the "sanctum sanctorum" of cell metabolism: the four molecules dATP, dCTP, dGTP and dTTP are the sole substrates authorized to undergo polymerization into DNA, the hereditary polymer whose structure must be accurately copied and repaired at nearly all cost1. Cells bear an arsenal of countermeasures for preventing qualitative as well as quantitative disturbances of dNTP pools, respectively embodied by the occurrence of faulty dNTPs such as hydroxylated or alkylated derivatives and by concentration imbalances between the four canonical dNTPs. Homeostasis of dNTP pools is currently understood as resulting from the interplay of de novo biosynthesis, salvage pathways, replication, sanitization and repair enzymes2–5. Misincorporation of dNTPs by DNA polymerase enzymes, even at a low rate, cause deleterious genetic mutations or other types of mayhem, such as premature chain termination or strand breaks, conducive to cell death 6,7. The accumulation of dNTPs bearing a nucleobase other than the canonical A,C,G,T at position 1’ of the deoxyribose sugar is actively prevented by sanitizing enzymes such as 8-oxo-dGTP diphosphatase (MutT)8 and by repair enzymes such as uracil-DNA-glycosylase (Ung)9. Imbalances between the pools of the four canonical dNTPs were shown to be lethally mutagenic and their investigation led to the discovery of metabolic flux vents, such as dGTP triphosphohydrolase (Dgt)10.

Overall, the intricate and robust design of dNTP metabolism has made it possible for cellular genomes ranging in size from a few hundred thousand base pairs in bacteria and archaea to several billion base pairs in eukaryotes to emerge and vary at a nearly constant mutation rate11. However, it has apparently prevented the adoption of chemical variants of the canonical dNTPs by cells and presumably halted genetic innovation by restricting evolution to the combinatorial space of A,C,G,T sequences12,13. Floyd Romesberg and his coworkers described a radical approach for expanding genetics through creative chemistry, based on the use in the bacterium E. 3 ACS Paragon Plus Environment


Page 4 of 29

coli of nucleoside triphosphate transporters originating from diatom chloroplasts14. The expression of a single foreign gene made it possible to perpetuate a plasmid bearing an additional base pair, in E. coli over several dozen generations. Building on this work, we report here how we pursued the domestication of the algal nucleoside triphosphate transporter by selecting for dTTP uptake in bacteria, and how we used this transporter to import dNTP analogs featuring changes to the base or to the sugar moieties, causing mutagenesis and replication arrest, together with the chemical diversification of DNA structures.

RESULTS AND DISCUSSION

Selection scheme for dTTP uptake in E. coli No E. coli strain lacking both thymidylate synthase (thyA) and thymidine kinase (tdk), the two enzymes responsible for thymidylate (dTMP) generation through de novo and salvage pathways, has ever been constructed (Figure 1A). A closely related condition can be phenotypically created by treating a tdk deletant lacking thymidine kinase with the antibiotic trimethoprim, which inhibits dihydrofolate reductase, encoded by folA15,16. The reduction step converting dihydrofolate into tetrahydrofolate and hence dTMP biosynthesis are thus blocked (Figure 1B). Other cell components requiring tetrahydrofolate for their biosynthesis, i.e. methionine, pantoate and purine nucleotides, must be provided in the growth medium, in addition to the nucleobase thymine or the nucleoside thymidine12. The absence of initiator formyl-methionyl-tRNA, which primes the ribosomal synthesis of proteins in bacteria, slows but does not completely halt the growth of E. coli devoid of tetrahydrofolate because the non-formylated form of initiator methionyl-tRNA can serve as initiator15.


Page 5 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We found that addition of thymine to the medium formulated by Mueller-Hinton, which contains methionine, pantoate and purines, did not permit growth of E. coli strains lacking tdk if trimethoprim was added at a concentration of 0.17 mM. Replacing the base thymine in MuellerHinton trimethoprim medium with the nucleoside thymidine or the nucleotides dTMP, dTDP or dTTP did not lead to bacterial growth, even after a prolonged duration (data not shown). This simple system therefore made possible a stringent selection scheme for the transport of phosphorylated derivatives of thymidine (Supplemental Table S2).

Construction and selection of dTTP-auxotrophic strains Building on the advance brought by heterologous expression of deoxynucleoside triphosphate transporter from diatom chloroplasts previously described14, we inserted nucleoside triphosphate transporter genes into the chromosome of E. coli. To this end, we replaced the ompT gene encoding an outer membrane protease with a synthetic gene encoding an diatom chloroplast deoxynucleoside triphosphate transporter (ntt2 gene), flanked by an antibiotic resistance marker. More precisely, the genetic construct was designed so as to leave in place the promoter of the ompT gene, which was concatenated to the spectinomycin resistance aad gene, preceded by its own promoter and followed by the strong promoter from phage T5, and finally the ntt2 gene itself (Supplemental Figure S1). Two constructions were made: the first including an ntt2 gene for the nucleoside triphosphate transporter from Phaeodactylum tricornutum, which was used by Romesberg's laboratory to propagate an additional base pair, the second with an ntt2 gene encoding the 70% similar transporter from Thalassiosira pseudonana14. To prevent hydrolysis of dTTP and other thymine nucleotides exogenously supplied in nutrient media, the phoA gene encoding periplasmic alkaline phosphatase was deleted, together with the tdk gene (Supplemental Table S1). 5 ACS Paragon Plus Environment


Page 6 of 29

Growth assays were performed by using a radial gradient of dTTP in Mueller-Hinton agar plates containing 50 mM phosphate and 0.17 mM trimethoprim (MHP trimethoprim medium). The ntt2 construct expressing the Thalassiosira pseudonana transporter (TpNTT2) reproducibly showed the formation of colonies near the dTTP well, whereas the homologous ntt2 construct expressing the Phaeodactylum tricornutum transporter (PtNTT2) yielded no colony despite repeated attempts. We therefore focused our efforts on TpNTT2.

Sequencing of the chromosomal ntt2 gene from growing colonies revealed the presence of mutations in all the isolates which we tested. Two different alleles were found in two independent experiments, namely M46V resulting from a single A to G mutation and R446G/F474L resulting from two mutations, C to G and T to C (Supplemental Figure S1B). The isolates XE858 and XE870 were chosen as representative strains of the alleles M46V and R446G/F474L, respectively. Both strains displayed a phenotype of vigorous growth in radial gradient plates with dTTP (Figure 2) but not with dTDP nor dTMP, the monophosphate or diphosphate esters of thymidine (Supplemental Table S2). This confirmed the strict specificity of the algal plastid transporters reported for triphosphates esters, as originally reported17. The concentration of 1 mM dTTP was found sufficient for stably propagating XE858 on solid medium or in liquid culture.

We transferred the M46V allele of ntt2 to a fresh genetic background by amplifying the whole ompT locus from XE858 (aad ntt2:M46V), transforming its progenitor strain XE763 strain by the amplicons and selecting for spectinomycin resistance. All the recombinant clones thus obtained were able to grow on MHP trimethoprim plates if and only if exogenous dTTP was supplied, just as XE858. This finding ruled out the involvement of genetic determinant separate from the ompT locus in the acquisition of dTTP utilization. Under conditions not imposing the uptake of dTTP 6 ACS Paragon Plus Environment

Page 7 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for survival, generation times of about 30 mn were found in LB medium at 37°C, for the strains XE 858 and XE 870 expressing the ntt2 gene and for the progenitor XE763 strain lacking the tdk, phoA and ompT genes, all comparable to that of wt E. coli MG1655 (Supplemental Figure S2). The TpNTT2 protein expressed from a synthetic gene inserted into the chromosome thus did not seem to cause a deleterious burden to E. coli cells. Likewise, the Romesberg’s group reported that expression of an N-terminus truncated form of PtNTT2 from the E. coli chromosome did not entail cellular toxicity18.

Nutritional containment of thyA tdk dual deletants Elaboration of an absolute auxotrophy for dTTP was conducted by further deleting the thyA gene for thymidylate synthase from the chromosome of strain XE858, resulting in the genotype ∆tdk ∆phoA ∆ompT::ntt2:M46V ∆thyA (Figure 1C). Two isolates, XE1346 and XE1368, were found to grow in MHP medium if, and only if, at least 1 mM dTTP was supplied in the medium. Thymine, thymidine, dTMP and dTDP did not sustain growth of these strains (Supplemental Table S2). The absolute dependency of tdk thyA dual deletant strains on exogeneous dTTP fulfills the specification of trophic containment19. Indeed, phosphoanhydrides such as dTTP are unstable molecules that form within the cytoplasm of cells but rapidly decay in natural habitats. Shortage in dTTP is notoriously lethal, a well-studied phenomenon known as thymineless death20,21. Accordingly, we found that incubation of XE1346 and XE1368 in growth medium devoid of dTTP led to the exponential decrease of viable cell titers as a function of time (Figure 3).



Page 8 of 29

Uptake of radio-labeled canonical dNTPs The transport of the four canonical dNTPs was investigated by feeding strains XE858 and XE870 with α-32P-labeled isotopomers as shown in Figure 4. Radioactivity accumulated for the four labeled dNTPs relative to the control strain XE763 bearing no ntt2 gene in its genome. The deoxyriboside triphosphate of thymine was transported less efficiently than dATP, dCTP and dGTP in the two strains XE858 and XE870. These results are consistent with affinity measurements performed with algal extracts, except for dATP for which a higher Km of 665µM was reported14,17. dCTP scored as the most efficiently transported dNTP in these experiments as well as in our study.

Uptake of nucleoside triphosphates with altered sugar moieties 2’-3’dideoxynucleoside triphosphates (ddNTPs) are known to be potent chain terminators in replication reactions22. We found that the XE858 and XE870 strains were sensitive to dideoxynucleoside triphosphates of the four bases A,C,G,T. Figure 5A shows typical inhibition halos using XE858 strain. The two strains XE858 and XE870 had similar sensitivities to the four different ddNTPs (Figure 5B). The analog for T appeared as the least toxic, whereas the C analog appeared as the most toxic, judging from the size of the inhibition halo. This experiment indicated that the ntt2 alleles M46V and R446G/F474L conferred the ability to transport triphosphates of nucleosides with a modified sugar moiety. The MICs obtained with the XE858 strain amounted to 5 µM for ddATP, 20 µM for ddCTP, 50 µM for ddGTP and 300 µM for dTTP. The inhibition patterns, observed using gradient plates, were generally consistent with the MICs obtained in liquid medium containing dNTPs of A, C, G and T. We provide no simple explanation for the discrepancy about ddATP toxicity between gradient plates and MICs.


Page 9 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Another sugar alteration was investigated using the TpNTT2 in E. coli. Gemcitabine contains two fluorine atoms attached to carbon 2’ of deoxycytidine (Figure 6). The incorporation of its triphosphate derivative into DNA was reported to terminate replication23. Inhibition halos of similar size were obtained for the two different ntt2 alleles of strains XE858 and XE870 (Figure 6B) as a response to gemcitabine triphosphate gradients, whereas the control strain lacking the ntt2 gene was completely resistant (Figure 6A).

Uptake of a mutagenic nucleoside triphosphate We investigated the transport of the 5-aza analog of dCTP (dzCTP). The nucleobase analog 5azacytosine is known to be lethally toxic and mutagenic when supplied to E. coli as its ribonucleoside form24,25 or as it deoxyriboside form when expressing human deoxycitydine kinase in E. coli12. 5-Aza-deoxycytidine triphosphate (dzCTP) biosynthesis from the ribonucleoside (rzC) involves the conversion of rzCDP to dzCDP by nucleotide reductase, followed by phosphorylation by nucleoside diphosphate kinase to yield dzCTP. The incorporation of dzCTP into DNA specifically causes G to C transversion mutations26. We first showed that dzCTP was highly toxic to the XE858 and XE870 strains bearing the ntt2 gene, but not to the XE763 strain lacking it. The mutagenic effect of dzCTP was assessed by measuring the frequency of mutants resistant to valine and rifampicin12 (Figure 7). The highest mutant frequencies were obtained by subjecting XE858 to 100 µM dzCTP, and amounting to 3.4 10-5 for valine and 2.5 10-5 for rifampicin. Such elevated frequencies qualify for high mutagenic potency, with the advantage that it is conditional on the expression of a transporter which human cells lack, which should reduce manipulation hazard.



Page 10 of 29

Directed evolution of dTTP auxotrophic strains We attempted to enhance dTTP uptake by serial batch culture in medium containing a decreasing dTTP concentration over successive passages. Two separate lineages were propagated in parallel from the strain XE858 and found to evolve at a similar pace. After 20 passages, each corresponding to 5.6 generations, totaling 113 generations, clones capable of growing in medium containing 125 µM dTTP were isolated from each culture. The evolvant isolates XE1468 and XE1885 had significantly larger growth halos in dTTP gradient plates than the progenitor XE858 (Figure 8). The concentration of 0,1 mM dTTP was found to be sufficient for stably propagating the two evolvant strains on solid MHP trimethoprim medium, whereas XE858 required at least 1 mM dTTP. Growth assays in liquid medium confirmed these phenotypes (Supplemental Figure S3). Generation times of respectively 58 and 77 mn were found for the evolvant strains XE1468 and XE1885 in MHP trimethoprim whereas the progenitor strain XE858 took 59 mn to double under the same conditions. In LB medium, longer generation times were observed for the two evolvant strains XE1468 and XE1885 relative to XE858 amounting to respectively 42, 59 and 30 mn (Supplemental Figure S2). Growth at low concentration of exogeneous dTTP was seemingly gained at the detriment of maximal growth rate. The genetic basis of such a trade-off remains to be investigated. The strains constructed or evolved along this study were all found genetically stable, as judged from the reproducibility, from one colony to another, of growth halos in dTTP gradient plates. Whole-genome sequencing of the two strains did not indicate that any additional mutation in the ntt2 gene had taken place during the adaptive process. Two genetic loci were found to be mutated in the progenitor XE858, one encoding a membrane protein (ybjE gene) and the other a formate reductase (nrfD gene). The two evolvant strains XE1468 and XE1885 each also bore an


Page 11 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


additional mutation in their genomes, at locus rrfF and ybcK, respectively. Further work is needed to assess the adaptive merit of these mutations and their underlying mechanisms.

CONCLUSION

We made use of the nutritional selection for thymine deoxynucleotides biosynthesis, a wellunderstood metabolic paradigm, to recruit the protein family transporting nucleoside triphosphates from diatom chloroplasts and emulate its evolution in E. coli cells. A transporter from the species Phaeodactylum tricornutum had previously been shown to mediate the transport of artificial dNTPs bearing complementary hydrophobic bases for incorporation into plasmid DNA in E. coli14.We found that a synthetic gene encoding a homologous nucleoside triphosphate transporter from the related species Thalassiosira pseudonana, inserted by disrupting the ompT locus of the E. coli chromosome, restored growth of bacterial cells deleted of the tdk gene for thymidine kinase and depleted of dTTP through the action of the antibiotic trimethoprim. Dual deletion of the tdk gene and the thyA gene encoding thymidylate synthase, combined with the insertion of the ntt2 gene from Thalassiosira pseudonana into the E. coli genome resulted in a phenotype of addiction to the nucleoside triphosphate dTTP supplied exogenously. Seemingly, no such auxotrophic bacterial strain has ever been constructed in the laboratory nor discovered in a natural habitat. The lethal character of E. coli strains lacking jointly the tdk and thyA genes provides a convenient model for implementing the concept of trophic containment19,27. This concept is put forward as a practical means to prevent dissemination of unnatural genetic constructs in synthetic biology28.



Page 12 of 29

Bacterial strains auxotrophic for dTTP pave the way for the enzymatic synthesis of nucleoside triphosphate compounds at the exterior of living bacteria and the improvement of enzymes catalyzing triphosphate formation through natural selection. We explored the import and impact of non-canonical nucleoside triphosphates structurally related to deoxycytidine. Gemcitabine, which bears two fluorine atoms at carbon 2’ of the sugar ring, strongly inhibited E. coli growth when added to the medium as its 5’ triphosphate form. The 5aza-cytosine analog of dCTP was found to impair growth and also to increase mutant frequency at chromosome loci by three orders of magnitude. Mutagenic dNTPs bearing mispairing bases augur well for the massive genetic diversification of bacterial genomes and episomes in directed evolution. While this manuscript was in preparation, use of the Phaeodactylum tricornutum transporter for importing and incorporating different sugar and base analogs was reported by Floyd Romesberg and his collaborators29. The two studies closely converged regarding the biological effects of dNTPs base and sugar analogs in E. coli.

Altogether, deoxynucleoside triphosphate transport in E. coli provides unprecedented capabilities for addressing questions pertaining to metabolic engineering and chemical evolution of DNA, as well as technological means of accelerating genetic evolution in synthetic systems. It has already enabled the propagation of an additional base-pair endowed with hydrophobic complementarity in E. coli14. It is now expected to facilitate the complete substitution of certain canonical bases in DNA, regardless of the availability of a metabolic pathway for generating non-canonical dNTPs within cells13,29,30.


Page 13 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MATERIAL AND METHODS

Strains, reagents and growth conditions All the strains used and constructed in this study were derivatives of the wild-type Escherichia coli K12 strain MG1655 (Supplemental Table S1). Bacteria were routinely grown in Mueller Hinton (MH) medium (Merck). When required, antibiotics were added at the following concentrations: carbenicillin, 100 mg/L (Invitrogen); spectinomycin (Sigma), 100 mg/L; apramycin (Sigma), 50 mg/L; trimethoprim (Sigma), 50 mg/L (172 µM). For the selection of strains dependent on dTTP, growth was assessed on MH trimethoprim plates containing 50 mM potassium phosphate (MHP trimethoprim), with a central well filled with 50µl of dTTP 100mM (GE Healthcare), at 30°C. Gemcitabine triphosphate and 5-Aza-deoxycytidine triphosphate were obtained from Jena bioscience, dideoxynucleoside triphosphates (ddNTPs) from Trilink and radioactive [α-32P]-dNTPs from Perkin Elmer.

Insertion of ntt2 genes into the chromosome The ntt2 genes of Thalassiosira pseudonana and Phaeodactylum tricornutum14 were synthesized by Eurofins Genomics. For insertion of the ntt2 gene into the bacterial chromosome, a DNA fragment encoding a spectinomycin resistance (specR) cassette (aad gene) upstream from the ntt2gene under the control of a strong promoter from bacteriophage T5 was generated by recombining PCR31 (Supplemental Figure S1). Three independent PCRs were performed, to amplify: i) The aad gene with the 3561 (5’ AGAGCGGCCGCCACCGCGGG-3’) and 3457 (5’AAATTTTCCTGAAAGCAAATAAATTTTTTATGAgaattcGCATATGCTGCGT-3’) oligonucleotides 13 ACS Paragon Plus Environment


Page 14 of 29

ii) The PT5 promoter with the 3456 (5’-tagagaataggaacttCGCATGCACGCA GCATATGCgaattcTCATAAAAAATTTATTTGC-3’) and 3562 oligonucleotides ((5’ttaattaacctcctgtgtg-3’) on the 3291 template (5’- TCATAAAAAATTTATTTGCTT TCAGGAAAATTTTTCTGTATAATAGATTCATAAATTTGAGAGAGGAGTTttcacacAGGA GG-3’) and iii) The ntt2 gene with the X563 (5’-CACACAGGAGGTTAATTAAATGAAAACATCGT GTACAATCC-3’) and X564 (5’-ttatttctggtgttctttgg-3’) oligonucleotides. The resulting PCR products were then amplified with the X123 and X565 oligonucleotides (X123: 5’-ATA TAAAAAATACATATTCAATCATTAAAACGATTGAATGGAGAACTTTTAGAGCGGCCG CCACCGCGGG-3’ and X565 5’AGTTATTCCCCGGGGCGATTTTCACCTCGGGGAAATTT TAGTTGGCGTTCTTATTTCTGGTGTTCTTTGG-3’) to surround the PCR product (aad /PT5 ntt2) with 50 bp upstream and downstream from the ompT gene. The ompT gene was then replaced with this final construct, by homologous recombination.

The cassette was inserted into the G2477 or XE763 strains with the lambda red recombinase system32. Cells were transformed with the PCR products, cultivated overnight in MH medium and then diluted in the selective medium (MHP trimethoprim, dTTP 1mM) and cultivated for 20 hours before plating on MHP trimethoprim with a central well of 100 mM dTTP.

Viability of tdk thyA deletant strains in rich medium XE1346 and XE1368 strains were diluted at 107cells/ml in 2ml and cultivated in LB medium supplemented with thymine (100µM) and thymidine (100µM). At different time, cultures were diluted and viable cells were counted on LB plates containing1mM dTTP. 14 ACS Paragon Plus Environment

Page 15 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Labelled dNTP transport Strains were grown overnight in MH apra for XE 763 and MH spec for XE 858 and XE870. They were diluted (1:50) and incubated for 2 h at 37°C in 5 ml of fresh MHP medium, until they reached an OD of 0.8. We then added 10 µl of medium containing 1 µl of each labelled dNTP (3000 Ci/mmol, 10 mCi/ml) to 1 ml of each cell culture. The cells were cultivated for another 90 minutes at 37°C, and were then washed twice in KPi buffer and resuspended in 20 µl KPi. We then loaded 5 µL onto Whatman filter paper for counting with a PhosphorImager.

Growth inhibition assays on plates For testing the toxicity of ddNTP, gemcitabine triphosphate or decitabine triphosphate in vivo, XE763, XE858, and XE870 were cultivated overnight in MH apramycin or MH spectinomycin, then diluted to an OD of 0.04 in 5 ml of fresh medium and spread on LB plates. The excess liquid was removed, a central well is dug and 30 µl of 10mM ddNTP, gemcitabine triphosphate or decitabine triphosphate were injected in the central well.

Decitabine triphosphate mutagenesis An overnight culture of XE858 in MH spectinomycin was diluted 1:100 in the same fresh medium containing different concentrations of decitabin and incubated for 16 hours at 37°C before plating. Viable cell counts (cfu) were done on LB plates. Rifampicin-resistant clones were selected on LB agar supplemented with 50 mg/L rifampicin. For assessing valine resistance bacterial cells were washed twice in mineral medium (MS) before plating and counted on MS glucose plates containing 80 mg/L DL valine. MS mineral medium is a buffer solution pH 7.3 containing 50 mM dipotassium phosphate, 20 mM ammonium chloride, 4 mM citric acid, 1 mM magnesium sulfate, 3 µM ferric chloride, 1 µM manganese chloride, and 1 µM zinc chloride and 15 ACS Paragon Plus Environment


Page 16 of 29

D-glucose is added at 11mM33. The mutation frequency was calculated as the number of mutant cells divided by the total number of viable cells. It was calculated as the mean of three mutation frequencies, from three independent experiments, as follows: (p_1 + p_2 + p_3)/3. The variance was calculated as 1.96xS, where S =1/3 sqrt(p_1 x (1 - p_1) / N_1 + p_2 x (1 - p_2) / N_2 + p_3 x (1 - p_3)/N_3. N represents the number of viable clones in each replicate and P is the corresponding mutation frequency.

Minimal inhibitory concentration The MICs of each ddNTP were done as previously described16. An overnight bacterial culture in minimal medium supplemented with 2g/L glucose and 100 µg/L spectinomycin was diluted (1:100) in the same fresh medium and incubated until an OD of 0.1 was attained. The culture was then diluted 25-fold and aliquots were incubated with different concentrations of each ddNTP. The MIC was done after 18 hours of culture at 37°C, as the lowest ddNTP concentration for which no turbidity was detectable.

Serial batch cultivation Two different colonies of the XE858 strain were inoculated in MHP trimethoprim medium containing 1 mM dTTP at 30°C until reaching an absorbance of 1 at 600 nm. The two cultures were iteratively diluted (1:50) by re-inoculation in the same sterile medium prior to incubating. The two cultures underwent three successive passages at 1 mM dTTP, 3 passages at 500 µM dTTP, 10 passages at 250 µM dTTP and 3 passages at 125 µM dTTP. The two independent cultures were plated on MHP trimethoprim containing 125 µM dTTP and 16 clones underwent sequencing at the ntt2 locus.


Page 17 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


SUPPLEMENTAL INFORMATION Supplemental Table S1: Bacterial strains and genotypes. Supplemental Table S2: Growth response of bacterial strains. Supplemental Figure S1: Chromosomal insertion of a gene for a dTTP transporter. Supplemental Figure S2: Growth under non selective conditions of E. coli strains producing the algal nucleoside triphosphate transporter from Thalassiosira pseudonana.

Supplemental Figure S3: Growth under selective conditions of E. coli strains producing the algal nucleoside triphosphate transporter from Thalassiosira pseudonana.

AUTHOR INFORMATION Corresponding authors Email: [email protected] Email: [email protected]

Author contributions VP and PM designed the research. VP, CH, BS performed experiments, VP, DL, PH, BS, PM analyzed the results, VP and PM wrote the manuscript. All authors reviewed the manuscript.

Notes The authors declare no conflict of interest and no competing financial interest.



Page 18 of 29

ACKNOWLEDGMENTS: We thank the sequencing department of Genoscope. The research has received funding from the European Research Council under the European Union's Seventh Framework Program (FP7/2007-2013)/ERC Grant agreement no ERC-2012-ADG_20120216/320683 and from ERASynBio no BB/N01023X/1, ANR-15-SYNB-0003-04 for “ in vivo XNA” project.

REFERENCES (1) Ninio, J. (1997) The evolutionary design of error-rates, and the fast fixation enigma. Orig. Life Evol. Biosphere J. Int. Soc. Study Orig. Life 27, 609–621. (2) Reichard, P. (1988) Interactions between deoxyribonucleotide and DNA synthesis. Annu. Rev. Biochem. 57, 349–374. (3) Nordlund, P., and Reichard, P. (2006) Ribonucleotide reductases. Annu. Rev. Biochem. 75, 681–706. (4) Tse, L., Kang, T. M., Yuan, J., Mihora, D., Becket, E., Maslowska, K. H., Schaaper, R. M., and Miller, J. H. (2016) Extreme dNTP pool changes and hypermutability in dcd ndk strains. Mutat. Res. 784–785, 16–24. (5) Zhu, M., Dai, X., Guo, W., Ge, Z., Yang, M., Wang, H., and Wang, Y.-P. (2017) Manipulating the Bacterial Cell Cycle and Cell Size by Titrating the Expression of Ribonucleotide Reductase. mBio 8,(6). pii: e01741-17. (6) Kunz, B. A., Kohalmi, S. E., Kunkel, T. A., Mathews, C. K., McIntosh, E. M., and Reidy, J. A. (1994) International Commission for Protection Against Environmental Mutagens and Carcinogens. Deoxyribonucleoside triphosphate levels: a critical factor in the maintenance of genetic stability. Mutat. Res. 318, 1–64. (7) Wheeler, L. J., Rajagopal, I., and Mathews, C. K. (2005) Stimulation of mutagenesis by proportional deoxyribonucleoside triphosphate accumulation in Escherichia coli. DNA Repair 4, 1450–1456. (8) Maki, H., and Sekiguchi, M. (1992) MutT protein specifically hydrolyses a potent mutagenic substrate for DNA synthesis. Nature 355, 273–275. (9) Lindahl, T. (1974) An N-glycosidase from Escherichia coli that releases free uracil from DNA 18 ACS Paragon Plus Environment

Page 19 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


containing deaminated cytosine residues. Proc. Natl. Acad. Sci. U. S. A. 71, 3649–3653. (10) Itsko, M., and Schaaper, R. M. (2014) dGTP starvation in Escherichia coli provides new insights into the thymineless-death phenomenon. PLoS Genet. 10, e1004310. (11) Drake, J. W. (1991) A constant rate of spontaneous mutation in DNA-based microbes. Proc. Natl. Acad. Sci. U. S. A. 88, 7160–7164. (12) Bouzon, M., and Marlière, P. (1997) Human deoxycytidine kinase as a conditional mutator in Escherichia coli. C. R. Acad. Sci. III 320, 427–434. (13) Marlière, P., Patrouix, J., Döring, V., Herdewijn, P., Tricot, S., Cruveiller, S., Bouzon, M., and Mutzel, R. (2011) Chemical evolution of a bacterium’s genome. Angew. Chem. Int. Ed Engl. 50, 7109–7114. (14) Malyshev, D. A., Dhami, K., Lavergne, T., Chen, T., Dai, N., Foster, J. M., Corrêa, I. R., and Romesberg, F. E. (2014) A semi-synthetic organism with an expanded genetic alphabet. Nature 509, 385–388. (15) Mazel, D., Pochet, S., and Marlière, P. (1994) Genetic characterization of polypeptide deformylase, a distinctive enzyme of eubacterial translation. EMBO J. 13, 914–923. (16) Harvey, R. J. (1973) Growth and initiation of protein synthesis in Escherichia coli in the presence of trimethoprim. J. Bacteriol. 114, 309–322. (17) Ast, M., Gruber, A., Schmitz-Esser, S., Neuhaus, H. E., Kroth, P. G., Horn, M., and Haferkamp, I. (2009) Diatom plastids depend on nucleotide import from the cytosol. Proc. Natl. Acad. Sci. U. S. A. 106, 3621–3626. (18) Zhang, Y., Lamb, B. M., Feldman, A. W., Zhou, A. X., Lavergne, T., Li, L., and Romesberg, F. E. (2017) A semisynthetic organism engineered for the stable expansion of the genetic alphabet. Proc. Natl. Acad. Sci. U. S. A. 114, 1317–1322. (19) Marliere, P. (2009) The farther, the safer: a manifesto for securely navigating synthetic species away from the old living world. Syst. Synth. Biol. 3, 77–84. (20) Cohen, S. S., and Barner, H. D. (1954) STUDIES ON UNBALANCED GROWTH IN ESCHERICHIA COLI. Proc. Natl. Acad. Sci. U. S. A. 40, 885–893. (21) Ahmad, S. I., Kirk, S. H., and Eisenstark, A. (1998) Thymine metabolism and thymineless death in prokaryotes and eukaryotes. Annu. Rev. Microbiol. 52, 591–625. (22) Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U. S. A. 74, 5463–5467. 19 ACS Paragon Plus Environment


Page 20 of 29

(23) Sandrini, M. P. B., Clausen, A. R., On, S. L. W., Aarestrup, F. M., Munch-Petersen, B., and Piskur, J. (2007) Nucleoside analogues are activated by bacterial deoxyribonucleoside kinases in a species-specific manner. J. Antimicrob. Chemother. 60, 510–520. (24) Paces, V., Doskocil, J., and Sorm, F. (1968) Incorporation of 5-azacytidine into nucleic acids of Escherichia coli. Biochim. Biophys. Acta 161, 352–360. (25) Watanabe, M., Nohmi, T., and Ohta, T. (1994) Effects of the umuDC, mucAB, and samAB operons on the mutational specificity of chemical mutagenesis in Escherichia coli: II. Base substitution mutagenesis. Mutat. Res. 314, 39–49. (26) Clouser, C. L., Patterson, S. E., and Mansky, L. M. (2010) Exploiting drug repositioning for discovery of a novel HIV combination therapy. J. Virol. 84, 9301–9309. (27) Herdewijn, P., and Marlière, P. (2009) Toward safe genetically modified organisms through the chemical diversification of nucleic acids. Chem. Biodivers. 6, 791–808. (28) Schmidt, M. (2010) Xenobiology: a new form of life as the ultimate biosafety tool. BioEssays. 32, 322–331. (29) Feldman, A. W., Fischer, E. C., Ledbetter, M. P., Liao, J.-Y., Chaput, J. C., and Romesberg, F. E. (2018) A Tool for the Import of Natural and Unnatural Nucleoside Triphosphates into Bacteria. J. Am. Chem. Soc. 140, 1447–1454. (30) Mehta, A. P., Li, H., Reed, S. A., Supekova, L., Javahishvili, T., and Schultz, P. G. (2016) Replacement of Thymidine by a Modified Base in the E. coli genome. J. Am. Chem. Soc. 138, 7272–7275. (31) Metzgar, D., Bacher, J. M., Pezo, V., Reader, J., Döring, V., Schimmel, P., Marlière, P., and de Crécy-Lagard, V. (2004) Acinetobacter sp. ADP1: an ideal model organism for genetic analysis and genome engineering. Nucleic Acids Res. 32, 5780–5790. (32) Datsenko, K. A., and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640–6645. (33) Richaud, C., Mengin-Lecreulx, D., Pochet, S., Johnson, E. J., Cohen, G. N., and Marlière, P. (1993) Directed evolution of biosynthetic pathways. Recruitment of cysteine thioethers for constructing the cell wall of Escherichia coli. J. Biol. Chem. 268, 26827–26835.


Page 21 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For Table of contents Use Only

Metabolic recruitment and directed evolution of nucleoside triphosphate uptake in Escherichia coli Valérie Pezo, Camille Hassan, Dominique Louis, Bruno Sargueil, Piet Herdewijn and Philippe Marlière

ACS Paragon Plus Environment


Figure 1: Selection scheme for thymidine triphosphate import. A) Biosynthesis of dTTP from dUMP involves the three enzymes thymidylate synthase, thymidylate kinase and nucleoside diphosphate kinase, respectively encoded by the thyA, tmk and ndk gene. The co-substrate of thymidylate synthase, methylenetetrahydrofolate (MTHF), is produced by the metabolic cycle comprising dihydrofolate reductase and serine hydroxymethyltransferase, respectively encoded by the folA and serA genes. The nucleobase thymine (T) and the deoxynucleoside thymidine (dT) are salvaged through the action of the recycling enzymes thymidine phosphorylase and thymidine kinase, respectively encoded by the deoA and tdk genes. B) The antibiotic trimethoprim inhibits dihydrofolate reductase, leaving only the salvage pathway to feed the dTTP pool using thymidine, thymidine kinase then becoming essential for growth and survival. A strain devoid of thymidine kinase can be complemented by expression of a nucleoside triphosphate transporter in the dual presence of trimethoprim and dTTP. C) In a strain devoid of both thymidylate synthase and thymidine kinase, the uptake of exogenously supplied dTTP by a nucleoside triphosphate transporter restores bacterial cell proliferation.


Page 22 of 29

Page 23 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2: Exogenous dTTP-supported growth of strains expressing ntt2 alleles. A) XE763 is the background strain lacking nucleoside triphosphate transporter. Strains XE858 (B) and XE870 (C) express two different alleles of ntt2, namely M46V and R446G/F474L, derived through selection from a synthetic gene encoding the Thalassiosira pseudonana nucleoside triphosphate transporter. Transport is demonstrated by a halo of growth surrounding the central well containing 50 µl of a 100 mM dTTP solution.



Figure 3: Lethality of dTTP deprivation to thyA tdk dual deletant strains. Kinetics of cell titer decrease in rich medium (LB) supplemented with thymine (100 µM) and thymidine (100 µM) is shown for clonal isolates XE1346 (A) and XE1368 (B) (red dots). Half-life durations of 48 minutes and 59 minutes are inferred from the decay of the two cultures. The cell increase of the same strains in LB medium supplemented with 1 mM dTTP is indicated by blue squares.


Page 24 of 29

Page 25 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4: Radio-labeled dNTP transport by bacterial strains equipped with the TpNtt2 transporter. Uptake of each 32P-labeled dNTP is shown for the background strain XE763 and for strains XE858 and XE870 expressing the ntt2 gene. Raw (4A) and processed data (4B) are shown for each dNTP and each strain.



Figure 5: Toxic effect of ddNTP import. Radial gradient plates were prepared using Mueller-Hinton medium supplemented with 50 mM phosphate by diffusion of 50 µl of a 10 mM ddNTP solution from a central well. Toxicity is visualized by a halo of inhibition surrounding the well. A) Response of strain XE 858 expressing the ntt2 gene to ddTTP, ddGTP, ddATP and ddCTP is compared to background XE763 devoid of ntt2. B) Diameters of inhibition discs resulting from ddNTP transport.


Page 26 of 29

Page 27 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6: Toxic effect by 2'-deoxy-2',2'-difluorocytidine triphosphate transport. Radial gradient plates were prepared using Mueller-Hinton medium supplemented with 50 mM phosphate by diffusion of 50 µl of 10 mM 2'-deoxy-2',2'-difluorocytidine triphosphate from a central well. Toxicity is visualized by a halo of inhibition surrounding the well. A) Response of strains XE858 and XE870 expressing the ntt2 gene to 2'-deoxy-2',2'difluorocytidine triphosphate is compared to XE763 devoid of ntt2. B) Diameters of inhibition discs resulting from 2'-deoxy-2',2'-difluorocytidine triphosphate transport.



Figure 7: Mutagenic effect of 5-aza-dCTP import. Mutagenesis potency was evaluated by measuring the frequency of mutants resistant to rifampicin (in rich LB medium) and to valine (in mineral MS glucose medium). Bacterial cells were grown in parallel in the presence of a variable concentration of 5-aza-dCTP and diluted before plating on selective and non-selective plates. The error-bars correspond to the standard deviation calculated for three independent experiments.


Page 28 of 29

Page 29 of 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 8: Enhancement of dTTP import in evolvant strains. Efficiency of dTTP transport is visualized by a halo of growth surrounding a central well containing 50 µl of 100 mM dTTP solution. The growth response of strains XE1468 and XE885 is compared to that of their progenitor XE858, from which they were independently evolved, and to that of the background strain XE763.


Metabolic recruitment and directed evolution of nucleoside

Recommend Documents