Metallo-Toehold-Activated Catalytic Hairpin Assembly Formation of

Subscriber access provided by UNIV OF CALIFORNIA SAN DIEGO LIBRARIES

Article

Metallo-Toehold-Activated Catalytic Hairpin Assembly Formation of ThreeWay DNAzyme Junctions for Amplified Fluorescent Detection of Hg2+ Xin Li, Jiaqing Xie, Bingying Jiang, Ruo Yuan, and Yun Xiang ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.6b13717 • Publication Date (Web): 24 Jan 2017 Downloaded from http://pubs.acs.org on January 25, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Applied Materials & Interfaces is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Metallo-Toehold-Activated Catalytic Hairpin Assembly Formation of Three-Way DNAzyme Junctions for Amplified Fluorescent Detection of Hg2+ Xin Li,† Jiaqing Xie,‡ Bingying Jiang,*,‡ Ruo Yuan,† Yun Xiang*,†

†

Key Laboratory of Luminescent and Real-Time Analytical Chemistry, Ministry of Education, School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, PR China

‡

School of Chemistry and Chemical Engineering, Chongqing University of Technology, Chongqing 400054, PR China *Corresponding authors. Tel/Fax: +86-23-68667675 (B. Jiang); Tel: +86-23-68252277 (Y. Xiang). E-mails: [email protected] (B. Jiang); [email protected] (Y. Xiang).

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 18

ABSTRACT Because of their irreversible toxicological impacts on environment and human body, the development of reliable and sensitive Hg2+ detection methods with high selectivity is of great significance. Based on the substantial signal amplification by metallo-toehold-triggered, catalytic hairpin assembly (CHA) formation of three-way DNAzyme junctions, we have constructed a highly selective and sensitive fluorescent sensing system for the determination of Hg2+ in different environmental water samples. The presence of the target Hg2+ ions can lead to the generation of T-Hg2+-T base mismatched metallo-toeholds, which trigger the catalytic assembly of three split-DNAzyme containing hairpins to form many Mg2+-dependent DNAzyme junction structures upon binding to the fluorescently quenched substrate sequences. The Mg2+ ions then cyclically cleave the fluorescently quenched substrate sequences of the Mg2+-dependent DNAzymes to generate drastically enhanced fluorescent signals for sensitively detecting Hg2+ at the low 4.5 pM level. The developed sensing method offers high selectivity towards the target Hg2+ over other possible competing metal ions due to the specific T-Hg2+-T bridge structure chemistry in the metallo-toehold domain, and reliable detection of spiked Hg2+ in environmentally relevant water samples with this method is also verified. Considering the nucleic acid nature of the trigger and assembly sequences, the developed approach thus holds great potentials for designing new enzyme-free samplification strategies to achieve highly sensitive determination of different DNA and RNA targets.

KEYWORDS: Strand displacement; Catalytic hairpin assembly; DNAzyme; Fluorescence; Mercury (II).

2


Page 3 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION Besides its natural biological function as genetic information carriers, DNA can be used as an engineering material to achieve “bottom-up” construction of two- and three-dimensional nanostructures. The size and complexity of the DNA nanostructures can be tuned by simple components at nanometer-scale precision because of the significant advances in DNA nanotechnology in the past few decades.1 By encoding substantial structural and functional units into the base sequence in DNAs, predictable DNA nanostructures with different geometries can be built through the unique Watson-Crick base pairing property during DNA hybridizations.2 These DNA nanostructures have found extensive applications in nanomachine,3 molecular sensing 4 and drug delivery.5 Inspired by current trends in the field of molecular self-assembly, several systems, such as linear DNA nanostructures,6,7 DNA dendrimers8 and DNA ferris wheels,9 have been constructed and used to amplify specific DNA molecular recognition events. Among them, hybridization chain reaction (HCR), systematically proposed by the Pierce group,10 has shown powerful capability for enhancing the analytical signal outputs in detecting different biomolecules11-13. In a typical HCR reaction, the DNA initiators trigger the cascaded hybridization events of two metastable DNA hairpins to self-assemble into long-nicked dsDNA polymers without using any enzymes. Despite the wide applications of HCR in bioanalyses, the un-catalyzed reaction mechanism of HCR encounters the issues of being sufficiently slow to ensure low background and limited sensitivity.14 Therefore, further efforts have been directed toward the development of catalytic self-assembly amplification systems. In 2008, Yin et al.15 first established the concept of the catalytic self-assembly generation of DNA branched junctions from three metastable DNA hairpins by manipulating the assembly process to recycle the DNA initiators. Relying on this reaction strategy, the Zhou group16 designed a DNA junction logic gate system, in which the logic operations can only be realized by the introduction of three hairpin-inputs in a proper order. Such logic system can also be reset many times without changing the logic reaction activity upon exposure to a recyclable initiator nucleic acid fragment. A nanodevice by taking the unique property of target-catalyzed formation of DNA branched junctions with spatially resolved signals of organic pyrene

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 18

molecules for sensitive nucleic acid detection was also developed recently.17 Indeed, the three-way-DNA junction architectures hold great application potential in several fields, due to their excellent signal amplification capacity, versatile conjugation capability with different fluorescent reporters, and intrinsic properties of scalable and modular operations. Metal ion-dependent DNAzymes have received increasing interest as ideal signal reporter units because of their unique advantages in terms of easy labeling, simple synthesis, good stability, and design flexibility.18 These unique advantages make DNAzymes excellent catalytic labels for amplified fluorescent,19,20 colorimetric,21,22 electrochemical,23 or chemiluminescent24 detection of different target biomolecules. These DNAzymes also show great potentials for the development of logic gates25 and pH-sensitive devices.26 Although DNAzymes have wide applications as mentioned; their catalytic activity can be potentially reduced by the weak binding activity between the enzyme strand and its substrate sequence..27 To circumvent this constraint, several research groups27,28 have proposed strategies to divide the catalytic core of 8-17 Mg2+-dependent DNAzyme into two fragments that can be combined together to generate active enzymes upon template-assisted formation of intact catalytic cores. By using the split 8-17 Mg2+-dependent DNAzymes, Willner’s group6 has built a powerful approach for sensitive DNA detection by using target-triggered cross-hybridization of two stable DNA hairpin structures and the self-assembly generation of DNAzyme wire structures Herein, we report on a powerful three-way DNAzyme junction platform for enzyme-free amplified determination of Hg2+ by coupling the amplification capability of target-catalyzed dynamic assembly of split Mg2+-dependent DNAzymes. Hg2+ is a widespread pollutant that can result in adverse effects on human body and environmental water samples even at trace amount.29 Metallo-toehold featuring with specific form of T-Hg2+-T base mismatch in the toehold region has been exploited to generate mercury sensor with excellent selectivity.30,31 In such metallo-toehold mediated-strand displacement reactions (TSDRs), the invading DNA (or DNA initiator) contains T-T mismatches to the toehold region of a dsDNA duplex or a hairpin DNA. Only with the presence of Hg2+ can the invading DNA bind to the toehold region of the dsDNA duplex through T-Hg2+-T interaction to trigger the SDR to displace the

4


Page 5 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


short strand of the duplex or to unfold the hairpin DNA. Analogously, the T-Hg2+-T mismatch toehold-mediated SDR can also trigger common HCR or catalytic self-assembly process as mentioned previously. In our approach, metallo-toehold is employed to induce the self-assembly process of three DNA hairpins to produce the nanostructures of three-way DNAzyme junctions with the addition of Hg2+. The formed nanostructures bind the fluorophore/quencher-modified, ribonucleobase-containing substrate hairpin DNAs, and Mg2+ ions can cyclically cleave the substrate DNAs to yield substantially amplified recovery of fluorescent emission, resulting in highly sensitive and selective determination of Hg2+ down to 4.5 pM in a non-enzyme and homogenous fashion. EXPERIMENTAL SECTION Chemicals and Materials: 3-(Nmorpholino) propanesulfonic acid (MOPS) was ordered from J&K Scientific Ltd. (Beijing, China). Hg(NO3)2, Ca(CH3COO)2 Mg(CH3COO)2 , Co(CH3COO)2 , Zn(CH3COO)2 , Cd(NO3)2, AgNO3, Pb(CH3COO)2 , Mn (CH3COO)2, Cu(CH3COO)2 and other reagents were all received from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). The oligonucleotide sequences (Table 1) were purified and synthesized by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China). Other chemical reagents (analytical grade) involved in the reaction processes were used as provided, and ultrapure water obtained from water purification system was used throughout the experimental procedures. Table 1 The designed sequences of the oligonucleotides involved in the present sensing experiments Name

Sequence (from 5’ to 3’)

H1

GATATCAGCGATGGTTGTTGGGTGAGTGAGTGGGTGC ACCCACAAGACCACCCACTCACTCACCCATGTTACTCT

H2

GATATCAGCGATAGTGAGTGGGTGGTCTTGTGGGTGC ACCCAACAACCCACCCACAAGACCACCCATGTTACTCT

H3

GATATCAGCGATGTCTTGTGGGTGGGTTGTTGGGTGCA CCCACTCACTCACCCAACAACCCACCCATGTTACTCT

Substrate probe (SP)

DABCYL-AGAGTATrAGGATATC-FAM

Initiation probe (IP)

CACCCACTCACTCACCCATCTTCC

5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 18

Native polyacrylamide gel electrophoresis (PAGE): The solutions of the reaction samples were freshly prepared and mixed with loading buffer, then transferred to electrophoretic analysis on the 8% nondenaturing polyacrylamide gels. The electrophoresis experiment was performed in 1× TBE buffer at 100 V for 90 min. After being stained by ethidium bromide, the gels containing the DNA samples were photographed with a digital camera by using ultraviolet light. Hg2+ detection procedure: Prior to experiments, each hairpin probe, H1, H2 and H3 washeated at 90 °C for 10 min and was cooled down to room temperature for 2 h to obtain the stable stem-loop structures. The sensing solutions were then prepared by mixing IP (250 nM), SP (500 nM), H1 (500 nM), H2 (500 nM) and H3 (500 nM) in Tris-acetate buffer (20 mM, 10 mM MOPS, 20 mM Mg(Ac)2, 0.5 M NaNO3, 15 mM KAc, pH=7.4). Series Hg2+ at different concentrations were added to the sensing media and reacted at 25 °C for 200 min. Finally, fluorescence measurements were performed to collect the data with a quartz cuvette containing 200 µL of sample solution. Fluorescence measurements: Fluorescence signalsof the solutions were obtained on a RF-5301PC fluorescence spectrophotometer (Shimadzu, Tokyo, Japan) by diluting the sample solution to a final volume of 200 μL with Tris-acetate buffer. The excitation wavelength was set at 490 nm and fluorescence data were collected in the range of 498 to 600 nm utilizing the excitation and emission slits of 3 and 5 nm at room temperature. RESULTS AND DISCUSSION

6


Page 7 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


S Scheme 1. Schematicc diagram of metalloo-toehold-acctivated caatalytic selff-assembly fformation of three-way D DNAzyme juunctions for amplified fl fluorescent ddetection off Hg2+. The toehhold-mediated strand ddisplacemennt reaction (TSDR) takkes place w when an invvading strannd displaces thhe shorter single s strandded DNA of o the double helix by first hybriddizing withh an overhanng domain (caalled a toehold).32 Suchh toehold ccan be enginneered to be b activated by some environment e tal stimuli (succh as pH,33 ATP34 or Sr2+)35. By fuurther extennding this T TSDR mechaanism, Lianng et al.30 firrst introduced the conceppt of metalllo-toehold w with the T--Hg2+-T briddge structuure chemisstry.36-38 They NA hybridizzation can bbe found that the dynamiic TSDR caan be triggeered by Hgg2+ and the rates of DN way DNAzyyme junctioons adjusted byy changing tthe Hg2+ ioon concentraation. In thee present woork, three-w are construucted on thee basis of thhe metallo-toehold inittiated and T TSDR-mediiated strateggy, which are a employed aas a new cattalytic self-aassembly am mplification strategy forr sensitive aand selective detection of Hg2+. As ddepicted byy scheme 11, the consstructed thrree-way DN NAzyme juunction deteection systeem involves thrree properlyy designed hairpins (deenoted as H H1, H2 and H3, respecttively), a suubstrate probbe (SP) modiffied with a quencher/ffluorophore

(DABCY YL/FAM) paair at its 5’ and 3’ teermini and an

initiation prrobe (IP). Each E hairpinn contains an a 18-base pair stem, a 12-base lloop and ann extra 6-baase sticky term minus at thee 5’-end. In I order to suppress tthe processs of assembbly formatiion of active 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 18

DNAzyme structures inn the absencce of Hg2+, the enzymaatic sequence is cut intoo two parts and a separateely t 5’- and 3’-termini oof the three hairpins (H H1, H2 and H H3). Part off the DNAzyyme sequennce inserted at the at the 3’-terrimus is also locked inn the stem of the hairpinns. Besides,, the red toeehold regionn (6-nt) in H1 H has three T T-T mismattched base pairs to IP P (the red rregion at thhe 3’-termiinus). Thus, without thhe presence off Hg2+, all hairpins arre stable in the closedd conformattions and thhe self-assembly proceess cannot takee place due to the fact tthat IP is unnable to binnd the toehoold region oof H1 becauuse of the T-T mismatchedd base pairss. On the coontrary, wheen Hg2+ ionns are introdduced into tthe system, IP hybridizzes with the reed toehold region at tthe 5’-term minus of H11 through thhe metallo--toehold indduced by the t formation oof T-Hg2+-T T bridge struucture chemiistry to initiiate the firstt TSDR, resuulting in thee unfolding of H1 and thee exposure oof the blue toehold iniitiation sequuence of H11. Subsequeently, the neewly exposed blue toeholld trigger seequence of H1 hybridiizes with thhe blue segm ment of H2 and triggers the seconnd TSDR to unfold u H2 aand to unlocck the purplle toehold iinitiation seequence. Annalogously, the unlockked purple initiation sequeence (in H2)) further hyybridizes wiith the purpple region of o H3 to inittiate the thiird TSDR, whiich displacees Hg2+ ionss and IP froom the brannched compplex. The libberated Hg22+ and IP can again bind to H1 andd initiate annother self-aassembly cycle througgh series TSDRs to geenerate manny Azyme sequeences inserted DNAzyme--branched juunctions in a catalytic ffashion. Eveentually, thee two DNA on the neigghboring prrobes are brrought into close proxximity, whicch hybridizze with the fluorescenttly quenched substrate proobes (SP) too form the M Mg2+-depenndent DNAzzyme brancched junctioons. The Mgg2+ mes and thuus lead to thhe ions presennt in buffer thus catalyyze cyclic clleavage of tthe SP of thhe DNAzym generation oof significanntly amplifiied fluoresceent emissionns for sensittive detectioon of Hg2+ ions.

8


Page 9 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. (A) PAGE characterization of the assembly process of the three-way DNAzyme structures. Lane 1: H1; Lane 2: Mixture of H1, H2, H3 and IP; Lane 3: Hg2+, H1 and IP; Lane 4: Hg2+, H1, H2 and IP; Lane 5: Hg2+, H1, H2, H3 and IP. The concentrations of Hg2+, IP, H1, H2 and H3 are 1.0 µM, 1.0 µM, 2.0 µM, 2.0 µM and 2.0 µM, respectively. The mixtures were allowed to react at 25 °C for 240 min. (B) Fluorescent spectra of different mixtures: (a) IP, H1, H2, H3 and SP; (b) Hg2+, IP, H1 and SP; (c) Hg2+, IP, H1, H2 and SP; (d) Hg2+, IP, H1, H2, H3 and SP. The concentrations of Hg2+, H1, H2, H3, IP and SP were 10.0 nM, 500 nM, 500 nM, 500 nM, 250 nM and 500 nM, respectively. The formation of the three-way DNAzyme junctions based on Hg2+-initiated TSDRs was first verified by gel electrophoresis. As can be seen in Figure 1A, the band of Lane 1 indicates the hairpin H1. Mixing IP and the three hairpins (H1, H2 and H3) shows slightly decreased electrophoretic mobility (Lane 2) compared to H1, assumably due to some nonspecific interactions between the hairpins and IP. However, when Hg2+ ions are mixed with the solution containing H1 and IP, a band that appears in Lane 3 is slightly lower than the migration position of H1 due to the successful binding of IP to H1 in the presence of Hg2+. The introduction of Hg2+ to the reaction solution with IP, H1 and H2 results in the generation of IP/H1/H2 (Lane 4) with much lower mobility compared to the position of the band in Lane 3, which is in agreement with the fact that the IP/H1 complexes move faster than IP/H1/H2. As a comparison with Lane 4, a much brighter band with lower mobility appears in Lane 5 for the mixture of Hg2+, IP, H1, H2 and H3, and this is accompanied by the reduction in band intensity of Lane 2, suggesting the successful self-assembly formation of the three-way DNAzyme junction structures. To check the feasibility of the signal amplification for sensitive determination of Hg2+, fluorescence signals under different mixture conditions were recorded with the presence of SP. As illustrated in Figure 1B, the mixted solution of IP, H1, H2, and H3 exhibits minimal fluorescent intensity (curve a) because of the weak interactions among the three hairpins without the presence of the target Hg2+. Although the presence of Hg2+ ions can lead to the hybridization of IP with H1 to expose the locked and split segments of the DNAzyme, these two split sequences are separated at the 5’- and 3’-terminus of H1 respectively to avoid the formation of the active DNAzyme core that binds SP, leading to neglect change in fluorescent intensity (curve b vs. a). When Hg2+ is introduced to the reaction mixture of IP,

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 18

H2 and H1, apparent iincrease in ffluorescent intensity (ccurve c vs. aa) can be obbserved. Thhis increase is t liberatedd blue regioon of H1 w with the adddition of thhe target Hgg2+ mostly because of thee fact that the me further hybrridizes withh the blue toehold domaain of H2 to unfold H2 and to bringg the two spplit DNAzym sequences into close proximity tto hybridizze with SP and to forrm Mg2+-deependent D DNAzymes as Despite the apparent inncrease, the incubation of Hg2+ ionns with the m mixture of IIP, discussed ppreviously. D H1, H2, H H3 and SP causes morre significannt enhancem ment in fluuorescent reesponse (cuurve d vs. c), c indicating tthe successfful assemblyy generationn of the thrree-way DN NAzyme junnction nanosstructures annd cyclic cleavvage of the quenchedd SP. Thesse results hhave revealeed the drasstic signal amplificatioon efficiency oof the propoosed three-w way DNAzym me junctionns for the detection of H Hg2+.

Figure 2. Effects E of thhe experimeental conditiions: (A) thhe reaction ttemperaturee (with 240 min reactioon time) and ((B) reactionn time (at thhe temperature of 25 °C) on the signal-to-nnoise ratio ((F/F0) for the t detection off Hg2+. Considerring the impportance of the t reactionn temperaturre on the freee energy off DNA hybrridization annd stability off the hairpiin structurees, it was first investtigated to sselect the ooptimal tem mperature ffor fluorescent detection oof Hg2+ by ccomparing tthe signal-too-noise ratioo (F/F0, whhere F and F0 representted the fluoresccence signall of the senssing solutionn with the ppresence andd absence 100 nM of thee target Hg2++). From Figurre 2A, we observe thhat the valuue of F/F0 gradually iincreases with w incremeental reactioon temperaturee from 15 tto 25 °C, dduo to the iincreased thhermal stabiility of the hairpin connformation at lower tempperatures w with decreased cross-oppening of hhairpin probbes and positive signaals. Howeveer, further incrrease in thee reaction teemperature leads to grradual decreeases in fluuorescence iintensity rattio (F/F0). Suchh decreasess are owingg to the largge increase in the noisee (F0) causeed by the leeakage of the

10


Page 11 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


self-assembbly process (30 °C) or the significant decrease in the signal responsse (35 °C) bbecause of the t reduced staability of thhe DNAzym me structurees at high rreaction tem mperatures. Next, we ooptimized the t reaction tim me in the raange of 0 aand 280 minn by increassing 40 minn each timee at 25 °C. As shown in Figure 2B, the maximuum signal-tto-noise ratiio is obtaineed at 200 m min. The reaason for thiis observatioon with the addition of thhe target Hgg2+ may be duee to that thee fluorescennt signal off the sensingg solution w increases w with the augment of reaaction time and almost levels off aafter 200 m min while the backgrounnd signal show ws slow incrrease due to the leakagee reaction between the hairpins (sppontaneous self-assembbly without thee Hg2+ triggeer) with proolonged incuubation timee.[39-41] Thuus, the reactiion temperaature of 25 °°C and reactioon time of 200 min are a selectedd as the best assay cconditions and a used in subsequeent experiments.

(A) Fluoresccence responnses of the ssensing soluutions with the additionn of Hg2+. From a to h: Figure 3. (A 0, 0.01 nM M, 0.05 nM, 0.1 nM, 0.55nM, 1 nM, M, 10 nM, 1000 nM. (B) The corresp sponding linnear responnse between thee logarithmoof Hg2+ concentration aand the fluoorescent valuue. Error baars, SD, n=33. After thee optimizatioon of the reeaction param meters of thhe experimeents, the deppendence off fluorescennce emission inntensity of thhe sensing ssolutions to different cooncentrationns of Hg2+ iss displayed in Figure 3A A. As depictedd, the fluoreescence signnal increasees with the presence p off elevated am mount of H Hg2+ from 0 to 100 nM. Byy plotting tthe fluoresccence value as a function of the loogarithm off Hg2+ conccentration, the calibration curve withh the equatiion of y = 107.5x + 4401.6 (R2=00.9939) from m 10 pM tto 100 nM is obtained foor Hg2+ deteection (Figurre 3B), and the detectioon limit is ddetermined to be 4.5 pM M with to thhe mean fluoreescent intennsity of blannk (without the presencce of Hg2+, n=11) plus three timess the standaard deviation. Our O detectioon limit is cllose to or evven better thhan some off the previoously reporteed fluoresceent 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 18

methods baased on enzyymes31,42 oor HCR-mecchanism am mplificationss for Hg2+ ddetection.43,444 In additioon, although m most of the reported seensing methhods have tthe detectioon limits that reach thee standard of United Stattes Environm mental Proteection Agenncy (10 nM of Hg2+ in ddrinkable w water), higheer sensitivitiies are needed if the senssors are to bbe applied in complexx cellular orr environmental samplles,45 and oour mise for sennsitive monnitoring of Hg2+ in diifferent watter proposed aapproach hoolds consideerable prom samples.

Figure 4. SSelectivity of the ampliffied sensingg method forr Hg2+ (1 nM) against other contrrol metal ioons (each at 50 nM). s o the amplified sensiing method for Hg2+ ddetection, series contraast of To invesstigate the selectivity experiments were perfformed by using u other environmenntally relevaant metal ioons, includinng Pb2+, Agg+, 2 , Cd2+, Ca22+ and Cu2++, as the conntrol target iions. As illuustrated by tthe results ((in Mg2+, Zn2+, Co2+, Mn2+

Figure 4), the introduuction of thhe competiing metal iions (50 nM M) causes insignificannt fluoresceent intensity chhanges of thhe sensing system, whhile the intrroduction of 1 nM target Hg2+ exxhibits stronng fluorescent signal. Thiss control ressult evidenttly shows thhe excellent selectivity of the developed sensinng system toward Hg2+ aggainst other control ionss, and such high specifi ficity is due to the fact that t only Hgg2+ t could inserrt into a bis-thymine baase pairs too produce a T-Hg2+-T binding struucture and to trigger the catalytic seelf-assemblyy hybridizattion reactionn process too produce thhe DNAzym me junctionns for a signnal readout.

12


Page 13 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


We further utilized the developed approach for the analysis of several samples (tap water and river water) with the standard addition method. The results for the tested water samples are listed in Table 2. According to the results, satisfactory values in the range of 93% to 109.4% are obtained for the recovery experiments, indicating that the constructed detection system can be applied to detect Hg2+ in environmental samples without apparent effects from other possible competing metal ions. Table 2 Recovery experiments of Hg2+ in water different samples (n=6). Sample

Hg2+ added (nM)

Hg2+ detected (nM)

Recovery (%)

Tap water 1

0

No found

N/A

Tap water 2

1

0.93 ± 0.04

93

Tap water 3

5

5.3 ± 1.2

106

Tap water 4

50

54.7 ± 4.1

109.4

River water 1

0

No found

N/A

River water 2

1

1.05 ± 0.06

105

River water 3

5

4.8 ± 0.8

96

River water 4

50

47.5 ± 3.9

95

CONCLUSIONS To conclude, the present study has demonstrated that the generation of T- Hg2+-T mismatch base paring with the assistance of Hg2+ ions can be used as metallo-toehold sequence to initiate the self-assembly of three metastable hairpins into three-way DNAzyme junctions through series of TSDRs. The fluorescently quenched substrate sequences of the DNAzymes can be cyclically cleaved by Mg2+ to generate significantly recovered fluorescence emission, resulting in substantial signal amplification for ultrasensitive detection of Hg2+ down to 4.5 pM. Compared with other strategies, our developed signal amplification method can be achieved in an isothermal and catalytic fashion by recycling the target Hg2+ without the involvement of expensive and unstable protein enzymes. Besides, our method exhibits high selectivity for Hg2+ against other control ions and can be readily applied to monitor Hg2+ spiked in environmental water samples with good recovery and accuracy. Moreover, owning to the design

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 18

flexibility of DNA, our system can be extended for the determination of nucleic acid targets or aptamer-related target molecules for general applications. ACKNOWLEDGMENT This work was supported by National Natural Science Foundation of China (Nos. 21505010 and 21675128), Chongqing Research Program of Basic Research and Frontier Technology (No. cstc2015jcyjA1357) and Scientific Research Innovation Team of Chongqing University of Technology (2015TD22). REFERENCES (1) Seeman, N. C. Nanomaterials Based on DNA. Annu. Rev. Biochem. 2010, 79, 65-87. (2) Seeman, N. C.; Kallenbach, N. R. Design of Immobile Nucleic Acid Junctions. Biophys. J. 1983, 44, 201-209. (3) Liu, M. H.; Hou, R. Z.; Cheng J.; Iong Ying Loh, I. Y.; Sreelatha, S.; Tey J. N.; Wei, J.; Wang, Z. S. Autonomous Synergic Control of Nanomotors. ACS Nano 2014, 8, 1792-1797. (4) Wu, C. C.; Han, D.; Chen, T.; Peng, L.; Zhu, G. Z.; You, M. X.; Qiu, L. P.; Sefah, K.; Zhang, X. B.; Tan, W. H. Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy. J. Am. Chem. Soc. 2013,135, 18644-18650. (5) Jiang, Q.; Song, C.; Nangreave, J.; Liu, X. W.; Lin, L.; Yan, H.; Ding, B. Q. DNA Origami as a Carrier for Circumvention of Drug Resistance. J. Am. Chem. Soc. 2012, 134, 13396-13403. (6) Wang, F.; Elbaz J.; Orbach, R. Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires. J. Am. Chem. Soc. 2011, 133 17149-17151. (7) Zhu, G.; Zhang, S.; Song, E. Building Fluorescent DNA Nanodevices on Target Living Cell Surfaces. Angew. Chem., Int. Ed., 2013, 52, 5490-5496. (8) Lee, J. B.; Roh, Y. H.; Um, S. H. Multifunctional Nanoarchitectures from DNA-Based ABC Monomers. Nature Nanotech. 2009, 4, 430-436. (9) Zhou, W.; Li, D.; Chai, Y.; Yuan, R.; Xiang, Y. RNA Responsive and Catalytic Self-Assembly of DNA Nanostructures for Highly Sensitive Fluorescence Detection of MicroRNA from Cancer Cells. Chem. Commun. 2015, 51, 16494-16497. (10) Dirks, R. M.; Pierce, N. A. Triggered Amplification by Hybridization Chain Reaction. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 15275−15278. (11) Chen Y.; Xu J.; Su J.; Xiang Y.; Yuan R.; Chai Y. Q. In Situ Hybridization Chain Reaction Amplification for Universal and Highly Sensitive Electrochemiluminescent Detection of DNA. Anal. Chem., 2012, 84, 7750-7755.

14


Page 15 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(12) Zhu, G.; Zhang, S.; Song, E.; Zheng, J.; Hu, R.; Fang, X.; Tan, W. Building Fluorescent DNA Nanodevices on Target Living Cell Surfaces. Angew. Chem., Int. Ed. 2013, 52, 5490-5496. (13) Zhang, B.; Liu, B.; Tang, D.; Niessner, R.; Chen, G.; Knopp, D. DNA-Based Hybridization Chain Reaction for Amplified Bioelectronic Signal and Ultrasensitive Detection of Proteins. Anal. Chem. 2012, 84, 5392-5399. (14) Li, B. L.; Ellington. A. D.; Chen, X. Rational, Modular Adaptation of Enzyme-Free DNA Circuits to Multiple Detection Methods. Nucleic Acids Res. 2011, 39, e110-e110. (15) Yin, P.; Choi, H. M.; Calvert, C. R.; Pierce, N. A. Programming Biomolecular Self-Assembly Pathways. Nature 2008, 451, 318-322. (16) Chen, J. H.; Zhou, S. G.; and Wen, J. L. Concatenated Logic Circuits Based on a Three‐Way DNA Junction: A Keypad‐Lock Security System with Visible Readout and an Automatic Reset Function. Angew. Chem., Int. Ed. 2015, 54, 446-450. (17) Qing, Z.; He, X.; Huang, J.; Wang, K.; Zou, Z.; Qing, T.; He, D. Target-Catalyzed Dynamic Assembly-Based Pyrene Excimer Switching for Enzyme-Free Nucleic Acid Amplified Detection. Anal. Chem. 2014, 86, 4934-4939. (18) Wang, F., Elbaz, J., Teller, C., Willner, I. Amplified Detection of DNA Through an Autocatalytic and Catabolic DNAzyme‐Mediated Process. Angew. Chem., Int. Ed. 2011, 50, 295-299. (19) Freage, L.; Wang, F.; Orbach, R.; Willner, I. Multiplexed Analysis of Genes and of Metal Ions Using Enzyme/DNAzyme Amplification Machineries. Anal. Chem. 2014, 86, 11326-11333. (20) Wang, F.; Freage, L.; Orbach, R.; Willner, I. Autonomous Replication of Nucleic Acids by Polymerization/Nicking Enzyme/DNAzyme Cascades for The Amplified Detection of DNA and the Aptamer–Cocaine Complex. Anal. Chem. 2013, 85, 8196-8203. (21) Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. Catalytic Beacons for the Detection of DNA and Telomerase Activity. J. Am. Chem. Soc. 2004, 126, 7430-7431. (22) Li, W.; Liu, Z.; Lin, H.; Nie, Z.; Chen, J.; Xu, X.; Yao, S. Label-Free Colorimetric Assay for Methyltransferase Activity Based on a Novel Methylation-Responsive DNAzyme Strategy. Anal. Chem. 2010, 82, 1935-1941. (23) Xiao Y.; Rowe A. A.; Plaxco K. W. Electrochemical Detection of Parts-per-billion Lead via an Electrode-Bound DNAzyme Assembly. J. Am. Chem. Soc. 2007, 129, 262-263. (24) Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Amplified Chemiluminescence Surface Detection of DNA and Telomerase Activity Using Catalytic Nucleic Acid Labels. Anal. Chem. 2004, 76, 2152-2156. (25) Orbach, R.; Remacle, F.; Levine, R. D.; Willner, I. Logic Reversibility and Thermodynamic Irreversibility Demonstrated by DNAzyme-Based Toffoli and Fredkin Logic Gates. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 21228-21233. (26) Elbaz, J.; Wang, F.; Remacle, F.; Willner, I. pH-Programmable DNA Logic Arrays Powered by Modular DNAzyme Libraries. Nano Lett. 2012, 12, 6049-6054.

15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 18

(27) Mokany, E.; Bone, S. M.; Young, P. E.; Doan, T. B.; Todd, A. V. MNAzymes, a Versatile New Class of Nucleic Acid Enzymes That Can Function as Biosensors and Molecular Switches. J. Am. Chem. Soc. 2009, 132, 1051-1059. (28) Elbaz, J.; Lioubashevski, O.; Wang, F.; Remacle, F.; Levine, R. D.; Willner, I. DNA Computing Circuits Using Libraries of DNAzyme Subunits. Nature Nanotech. 2010, 5, 417-422. (29) Nolan E. M.; Lippard S. J. Tools and Tactics for The Optical Detection of Mercuric Ion. Chem. Rev. 2008, 108, 3443-3480. (30) Ding, W.; Deng, W.; Zhu, H.; Liang, H. Metallo-Toeholds: Controlling DNA Strand Displacement Driven by Hg Ions. Chem. Commun. 2013, 49, 9953-9955. (31) Chen J.; Zhou S.; Wen, J. Disposable Strip Biosensor for Visual Detection of Hg2+ Based on Hg2+-Triggered Toehold Binding and Exonuclease III-Assisted Signal Amplification. Anal. Chem. 2014, 86, 3108-3114. (32) Yurke, B.; Turberfield, A. J.; Mills, A. P.; Simmel, F. C.; Neumann, J. L. A DNA-Fuelled Molecular Machine Made of DNA. Nature 2000, 406, 605-608. (33) Liu, Z.; Mao, C. Reporting Transient Molecular Events by DNA Strand Displacement. Chem. Commun. 2014, 50, 8239-8241. (34) Xu, X.; Yang, X. Reversion of DNA Strand Displacement Using Functional Nucleic Acids as Toeholds. Chem. Commun. 2014, 50, 805-807. (35) Tang, W.; Wang, H.; Wang, D.; Zhao, Y.; Li, N.; Liu, F. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions. J. Am. Chem. Soc. 2013, 135, 13628-13631. (36) Liu, X.; Tang, Y.; Wang, L.; Zhang, J.; Song, S.; Fan, C.; Wang, S. Optical detection of mercury (II) in aqueous solutions by using conjugated polymers and label‐free oligonucleotides. Adv. Mater. 2007, 19, 1471-1474. (37) Zhu, Z.; Su, Y.; Li, J.; Li, D.; Zhang, J.; Song, S.; Fan, C. Highly sensitive electrochemical sensor for mercury (II) ions by using a mercury-specific oligonucleotide probe and gold nanoparticle-based amplification. Anal. Chem. 2009, 81, 7660-7666. (38) He, S.; Li, D.; Zhu, C.; Song, S.; Wang, L.; Long, Y.; Fan, C. Design of a gold nanoprobe for rapid and portable mercury detection with the naked eye. Chem. Commun. 2008, 40, 4885-4887. (39) Tang, Y.; Lin, Y.; Yang, X.; Wang, Z.; Le, X. C.; Li, F. Universal strategy to engineer catalytic DNA hairpin assemblies for protein analysis. Anal. Chem. 2015, 87, 8063-8066. (40) Jiang, Y. S.; Bhadra, S.; Li, B.; Ellington, A. D. Mismatches Improve the Performance of Strand-Displacement Nucleic Acid Circuits. Angew. Chem., Int. Ed. 2014,126, 1876-1879. (41) Jiang, Y.; Li, B.; Milligan, J. N.; Bhadra, S.; Ellington, A. D. Real-time detection of isothermal amplification reactions with thermostable catalytic hairpin assembly. J. Am. Chem. Soc. 2013, 135, 7430-7433. (42) Xuan, F.; Luo, X; Hsing, I. M. Conformation-Dependent Exonuclease III Activity Mediated by Metal Ions Reshuffling on Thymine-Rich DNA Duplexes for an Ultrasensitive Electrochemical Method for Hg2+ Detection. Anal. Chem. 2013, 85, 4586-4593. 16


Page 17 of 18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(43) Hao, Y.; Guo, Q.; Wu, H.; Guo, L.; Zhong, L.; Wang, J.; Chen, G. Amplified Colorimetric Detection of Mercuric Ions Through Autonomous Assembly of G-Quadruplex DNAzyme Nanowires. Biosens. Bioelectron. 2014, 52, 261-264. (44) Huang, J.; Gao, X.; Jia, J.; Kim, J. K.; Li, Z. Graphene Oxide-Based Amplified Fluorescent Biosensor for Hg2+ Detection Through Hybridization Chain Reactions. Anal. Chem. 2014, 86, 3209-3215. (45) Zhang, X. B.; Wang, Z.; Xing, H.; Xiang, Y.; Lu, Y. Catalytic and Molecular Beacons for Amplified Detection of Metal Ions and Organic Molecules with High Sensitivity. Anal. Chem. 2010, 82, 5005-5011.

17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 18

For TOC C only:

18


Metallo-Toehold-Activated Catalytic Hairpin Assembly Formation of

Recommend Documents