Microenvironment-Driven Cascaded Responsive ... - ACS Publications

Subscriber access provided by Universiteit Utrecht

Article

Microenvironment-driven cascaded responsive hybrid carbon dots as a multifunctional theranostic nanoplatform for imaging-traceable gene precise delivery Haijie Zhao, Junkun Duan, Yongcheng Xiao, Guoheng Tang, Chengguang Wu, Yi Zhang, Zonghua Liu, and Wei Xue Chem. Mater., Just Accepted Manuscript • DOI: 10.1021/acs.chemmater.8b01011 • Publication Date (Web): 30 Apr 2018 Downloaded from http://pubs.acs.org on April 30, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Chemistry of Materials

Microenvironment-driven cascaded responsive hybrid carbon dots as a multifunctional theranostic nanoplatform for imaging-traceable gene precise delivery Haijie Zhao, Junkun Duan, Yongcheng Xiao, Guoheng Tang, Chengguang Wu, Yi Zhang*, Zonghua Liu*, Wei Xue* Key Laboratory of Biomaterials of Guangdong Higher Education Institutes, Department of Biomedical Engineering, Jinan University, Guangzhou 510632, China.

* Corresponding authors:

Yi Zhang ([email protected]) ORCID: 0000-0003-4769-6642

Zonghua Liu ([email protected])

Wei Xue ([email protected])

Tel and Fax: 86-20-85224338

ACS Paragon Plus Environment

Chemistry of Materials 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 48

Abstract: Imaging-guided stimuli-responsive delivery systems based on nanomaterials for cancer theranostics have been recognized as promising alternatives to traditional therapies in clinic. How to integrate multiple response-mediated nanoproperties (i.e., charge, size or stability) transitions into a cascaded manner to overcome multistage biological barriers which usually demand different and even opposing nanoproperty in each stage is still a challenge. Herein, a multistage and cascaded responsive theranostic nanoplatform for imaging-traceable TRAIL gene precise delivery was prepared by a cleavable PEGylated shell and a fluorescent carbon dots (CDs)-based core. The CDs as the core was pre-functionalized with polyethyleneimine end-capped disulfide-bonds-bearing hyperbranched poly(amido amine) (HPAP), endowing the CDs with enhanced fluorescent quantum yield (27%), intracellular degradability, and efficient gene delivery capability. The shell was fabricated by dimethylmaleic acid modification

of

mPEG-PEI600

copolymer,

and

exhibited

tumor

microenvironment-triggered charge-reversal, leading to the shell detachment from the core at tumor site. The nanoplatform with cascaded responsive property displays prolonged blood circulation time benefiting from PEGylated shielding once being injected into blood, subsequently effective accumulation at tumor tissues from blood induced by elevated EPR effect resulting from the microenvironment-driven synchronous charge-conversion and size-shrinkage, and finally controlled gene release in tumor cell cytosol facilitated by glutathione-triggered HPAP degradability. In vitro and in vivo assays demonstrated that such a blood-tissue-cell cascaded responsive nanoplatform not only possessed imaging-trackable tumor-specific delivery ability, but also exhibited enhanced and selective antitumor activity through TRAIL-mediated apoptosis as well as excellent biocompatibility. This study provides a multifunctional integration strategy, paving the way for designing novel theranostic nanomedicines on the basis of precision medicine.


Page 3 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1 Introduction Recently, nanomaterials-based delivery systems loading drug, gene or imaging agent for cancer theranostics have attracted considerable attention and become one of the hotspots in cancer therapy research

1, 2

. Due to the complexity of physiological

environment, the incorporation of multiple functionalizations into one nanocarrier has become a well recognized trend. Generally, an ideal multifunctional nanocarrier for cancer treatment through intravenous administration must go through a cascade of multiple steps 3: (1) circulation in the blood compartments, (2) tumor-specific accumulation and penetration, (3) internalization into targeted cells, (4) intracellular cargoes release. Expected nanoproperties (i.e., charge, size or stability) to overcome the above-mentioned barriers are usually different and even opposing in different stages. To address the delima, the extensively exploited approach is to develop microenvironment-triggered responsive carriers, the properties of which could intelligently transit according to requirement of microenvironment

4-6

. For instance,

Gu et al. and Wang et al. reported amino-functionalized polymeric drug carriers modified with 2,3-dimethylmaleic anhydride (DMMA), which would be hydrolyzed in acidic tumor extracellular microenvironment, leading to the charge reversal and exposure of positive charge to achieve tumor tissue targeting and increased accumulation 7, 8. Besides, Yang et al. reported ROS-sensitive polymeric nanocarriers for intracellular ROS triggered drug release 9. Farokhzad et al. reported a redox hypersensitive nanoplatform to release drug in cancer cells after the polymeric carrier degraded in high glutathione (GSH) microenvironment 10. Though current studies on stimuli-responsive delivery systems have been proved effective under a specific microenvironment, the separated and disconnected response to corresponding delivery barriers still hampers their further application. Therefore, it is critically desired to develop integrated nanocarriers with cascaded switchable properties self-adapt to sequential microenvironment transitions from blood to tumor tissue and from tissue to cells, to achieve both temporal and spatial precise delivery. Fluorescent carbon dots (CDs) have shown enormous potentials for biomedical ACS Paragon Plus Environment


applications such as bioimaging

11-13

, theranostics

Page 4 of 48

14, 15

, and sensing

16, 17

, owing to

their fascinating properties involving superior optical properties (tunable emission and high photostability), small size, good aqueous solubility as well as facile preparation 5, 18

. However, CDs-based theranostic nanomedicine for cancer treatment faces two

fundamental chanllenges. One is the questionable biocompatibility of CDs, though they were widely regarded to be low cytotoxicity compared with conventional quantum dots 19. Recent studies from our group and Zboril’s group indicated that CDs impaired the structure and function of the blood components above 0.1 mg/mL 20, and that both negative and positive charged CDs induced cell cycle arrest 21. The other is the single-function nature of CDs with poor drug/gene loading efficiency and tumor-targeting

ability.

To

overcome

the

two

shortcomings,

the

surface

functionalization on CDs is a key bridge to connect the CDs with fascinating cancer theranostic applications. In currently reported studies, however, the surface modification to fabricate multifunctionalized CDs often requires complicated chemical conjugations with various functionalized ligands. For example, Cheng et al. reported a polycation‑b-polyzwitterion copolymer grafted CDs for gene delivery and bioimaging, which needs three-step surface-initiated atom transfer radical polymerization to modify the CDs with cationic polymer and serum-resistant ligands after CDs preparation

22

. In this regard, developing biocompatible multifunctional

CDs-based theranostic with facile preparation is still a challenge. Herein, we proposed an all-in-one strategy that integrates and synchronizes diverse

nanoproperties

into

one

multifunctional

nanoplatform,

including

microenvironment-driven cascaded responsiveness for precise gene delivery and CDs-based imaging-tracking. Specifically, a blood-tissue-cells multistage responsive nanoplatform for precise TRAIL gene delivery and imaging-tracking was prepared by electrostatic self-assembly between polycation-functionalized CDs as the core and pH-triggered cleavable PEGylated shielding as the shell. As shown in Scheme 1, the surface functionalized CDs was prepared by microwave-assisted one-pot strategy, in which

polyethyleneimine

(600

Da)

end-capped

disulfide-bonds-bearing

hyperbranched poly(amido amine) (HPAP) was employed as co-precursor together ACS Paragon Plus Environment

Page 5 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with citric acid for synchronous synthesis, passivation, and functionalization of the CDs. The introduction of HPAP endows the CDs with higher fluorescent quantum yield, GSH-triggered degradability and efficient gene delivery capability. The negatively

charged

shielding

shell

was

synthesized

by

modifying

mPEG-polyethyleneimine (PEI, 600 Da) copolymer with dimethylmaleic acid (DMMA) and denoted as mPEG-PEI-DMMA (PPD), which could reverse to be positively charged at tumor mildly acidic microenvironment via hydrolysis of DMMA, leading to PPD shell detachment from the CDs core. This multifunctional theranostic nanoplatform exhibits outstanding merits. First, the cascaded responsiveness endows the carrier with flexible adaptive capacity responding to multistage biological barriers during the delivery process. As shown in Scheme 2, once being injected into blood, the PEGylated shielding shell minimizes the non-specific interaction with blood components and normal tissues to improve the biocompatibility and prolong circulation time. From blood to tumor, simultaneous charge-conversion and size-shrinkage induced by pH-triggered PEG deshielding facilitates tumor-specific accumulation by enhanced permeability and retention (EPR) effect. From tissue to cells, the GSH-triggered HPAP degradability promotes the gene release into tumor cell cytosol. Therefore, this blood-tissue-cells three-stage responsive strategy could overcome sequential physiologic barriers and discriminate tumor from normal tissue as an ideal “smart” nanocarrier. Second, the employment of the CDs not only provides a bioimaging agent for tracing carrier biodistribution and locating tumor position, but also elevates EPR effect owing to their small size after the

shielding

separation.

Third,

such

a

multifunctional

architecture

was

easy-to-fabricated by one-pot microwave approach for synchronizing CDs synthesis and surface functionalization and by further one-step electrostatic self-assembly. With these advantages, this CDs-based multifunctional theranostics with cascaded responsiveness could exhibit imaging-trackable tumor-specific gene delivery ability as well as low side effects in vitro and in vivo, paving the way for significant application potential in cancer imaging and therapy.



Page 6 of 48

2 Results and discussion 2.1 Preparation and characterization of HPAP-functionalized carbon dots Polyethyleneimine (600 Da) end-capped disulfide-bonds-bearing poly(amido amine) (HPAP) was developed as the polycation precursor to prepare functionalized carbon dots (CDs) for synergetic gene delivery and imaging tracking in view of two following aspects. On the one hand, hyperbranched poly(amido amine) with disulfide bonds incorporated has been proved that it displays excellent gene transfection efficiency (even better than PEI-25k) but low cytotoxicity due to its intracellular degradation property in our previous studies 23. On the other hand, it was reported that N-doping facilitated the fluorescent quantum yield of CDs 24. For instance, branched polyethylenimine (bPEI) passivated CDs exhibited very high fluorescence quantum yield 25, suggesting that bPEI600 end-capped poly(amido amine) passivated CDs

may

enhance photoluminescence for bioimaging. In summary, the introduction of HPAP as precursor into CDs preparation was expected to endow CDs with higher fluorescent quantum yield, intracellular degradability and efficient gene delivery capability for theranostic. The

HPAP was synthesized by

Michael addition

polymerization

of

N,N’-bis(acryloyl)cystamine (BAC) and 1-(2-aminoethyl)-piperazine (AEPZ), and then bPEI600 was added to terminal vinyl groups. 1H NMR was carried out to confirm the chemical structure of HPAP (Figure S1). HPAP-functionalized carbon dots (HPAP-CDs) were facilely prepared through one-pot microwave-assisted pyrolysis of citric acid in the presence of HPAP as both passivator and functionalized agent (as shown in Scheme 1a). To confirm HPAP-CDs were successfully prepared, FTIR, 1H NMR, DLS and TEM were all performed. FTIR spectroscopy was measured to indicate the characteristic groups of HPAP-CDs. HPAP shows the broad vibration bands in the range of 3000-3500 cm-1 are from O-H and N-H stretching vibration, and the vibration bands at 1605 cm-1 and 1365 cm-1 are attributed to bending vibration of N-H and stretching vibration of C-N, and the peak at 510 nm was attributed to S–S. The peak at 2060 cm-1 indicates the CDs characteristic structure of –C=C=N which


Page 7 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


was the result from pyrolysis process (Figure 1a). The 1H NMR spectra of HPAP-CDs (Figure S1) showed that characteristic peak of HPAP was still existed, suggesting HPAP structure was retained on the carbon dots after pyrolysis. The dynamic light scattering (DLS) result shows that the hydrodynamic diameter of HPAP-CDs in aqueous solution was about 34.3 nm (Table S2) while the CDs core was about 8 nm in dry state observed by high resolution TEM (HRTEM) indicating the existence of HPAP around CDs core and the stretched state of HPAP chains in solution induced the size enlargement determined by DLS. The HRTEM image of HPAP-CDs revealed the 0.21 nm of lattice spacing in CDs core also could be observed (Figure 1b) which is consistent with related works reported before

26

. In addition, zeta potential of

HPAP-CDs was also measured and found it decreased to 20.5±1.85 mV compared with HPAP (30.3±1.91 mV) (Table S2) owing to amino group loss in the pyrolysis process. On the basis of above results, HPAP-CDs were successfully synthesized with small size, positively charged and HPAP functionalized coating on the CDs surface. Photoluminescence property of HPAP-CDs was measured by UV-vis Spectrometer and fluorescence spectrophotometer. The UV-vis spectra of HPAP-CDs shows the peak at 360 nm attribute to n-π* transition of C=O as shown in Figure 1c. The fluorescence photographs of HPAP and HPAP-CDs under excitation of 365 nm were shown in the inset image of Figure 1c in paired, further indicating that the fluorescent CDs were successfully prepared via microwave-assisted pyrolysis and showed bright blue fluorescence. The fluorescence spectra of HPAP-CDs displayed an excitation wavelength-dependent manner as shown in Figure 1d. The emission wavelength of HPAP-CDs showed red-shifting from 450 nm to 613 nm with gradual reduction of emission intensity when excitation wavelength increased from 320 nm to 600 nm. Compared with strong fluorescence intensity under 360 nm excitation, the peaks from 440nm and 600 nm appeared much weaker and only can observed in the partial enlarged drawing of Figure 1d. Accordingly, the red-shifting of emission spectra at different excitation wavelength also could be found only in the enlarge drawing. The fluorescence quantum yield (QY) of HPAP-CDs was calculated to be 27% under the excitation wavelength of 360 nm which is relatively high QY ACS Paragon Plus Environment


compared with previous reports

Page 8 of 48

22

. Generally, CDs with high QY was usually

synthesized through hydrothermal treatment with small molecule precursor under high temperature for a long time which may result in surface functionalized fragments loss and require further surface functionalized modification

27

. In contrast, we

proposed a strategy that using HPAP as a macromolecular precursor together with citric acid to prepare functionalized CDs by a facile one-pot microwave-assisted treatment for synchronized carbonization and surface functionalization, and the results have proved that HPAP-participated passivation could considerably improve the QY of CDs while retaining functionalized fragments. As a type of newly emerging light emitters, CDs have been widely used in bio-imaging, nanomedicine and bio-sensing

28, 29

. To evaluate the bioimaging ability

of HPAP-CDs, cancer cell lines of human breast tumor (MCF-7), cervix adenocarcinoma (Hela) and hepatocellular carcinoma (Hep G2), and the normal tissue cell line umbilical vein endothelial cells (HUVEC) were introduced and the fluorescence cell-imaging was observed by confocal laser scanning microscopy shown in Figure 1e. It was found bright fluorescence in four cell lines owing to the strong fluorescence emitting from HPAP-CDs that could stain cells with blue or green under the excitation of 350 or 480 nm respectively. However the green signal is weaker than blue but still can be observed, while the red signal is not captured under the 543 nm excitation wavelength, which is consistent with the result of fluorescence spectra. This result indicated HPAP-CDs were able to penetrate into different cells and display brightly fluorescence for potential cellular staining and imaging. 2.2 gene condensation and release mediated by biodegradable HPAP-CDs On the basis of GSH-responsive biodegradability of HPAP which had been reported in our previous works

23, 30

, we further investigated the GSH-triggered

degradability of HPAP-CDs. GPC and DLS were examined to evaluate the change of molecular weight and size before and after GSH treatment. Figure 2a shows that the elution time peak of HPAP-CDs was delayed from 6.22 to two peaks 7.05 and 7.88 which exhibited a wide distribution after incubating with GSH. As shown in Table S1


Page 9 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the calculated Mn of HPAP, HPAP-CDs were 156800 (Mw/Mn = 1.41) and 35200 (1.75) respectively, and Mn of HPAP-CDs after GSH treatment was 5500 (Mw/Mn =1.07) and 600 (Mw/Mn = 2.84). These results indicate that disulfide bonds in the HPAP-CDs were cleaved in presence of GSH and HPAP around the CDs degraded into low molecular weight fragments. Similarly, as shown in Figure 2b size of HPAP-CDs was reduced from 34.03 nm to 9.08 nm measured by DLS, suggesting that HPAP coating around the CDs degraded and left the CDs cores in presence of GSH. These results suggested that disulfide bonds within HPAP were retained in HPAP-CDs after microwave-assisted pyrolysis and endowing HPAP-CDs with a biodegradable surface coating responding to intracellular GSH microenvironment. Furthermore, gel electrophoresis assay was performed to assess pDNA binding and release ability of HPAP-CDs which is a crucial factor for efficient gene transfections. As shown in Figure 2c, TRAIL pDNA was totally retarded above 10:1 (weight ratio of HPAP-CDs/pDNA), implying pDNA could be completely condensed and HPAP-CDs showed good gene condensation ability in vitro. After cellular uptake, the condensed TRAIL pDNA is required to release from vector timely to ensure transfection. Therefore, gene release capacity of HPAP-CDs/pDNA complex was also estimated by gel electrophoresis assay in the presence of 10 mM GSH. As expected, pDNA were all leaked regardless of the mass ratios. In addition, the intracellular gene released ability of PPD@HPAP-CDs/pDNA at pH 6.8 in human breast tumor (MCF-7) cells were also traced by observing the HPAP-CDs (blue) and Cy5-labled pDNA (red) at various time intervals using Confocal laser scanning microscopy (CLSM) (Figure 2d). After 2 h treatment, some obvious purple ﬂuorescent dots (overlap of the blue and red ﬂuorescence) appeared with few red dots in merge images, demonstrating the co-localization of pDNA with HPAP-CDs. With the incubation time extend to 4h or even 8h, more and more separated red dots could be observed, suggesting pDNA had been released from HPAP-CDs/pDNA complexes and dispersed in the cytoplasm as expected. The above results indicated that the degradable HPAP-CDs could efficiently condense pDNA and showed redox-controlled gene release responding to intracellular GSH microenvironment that is meaningful for improving transfection efficiency and ACS Paragon Plus Environment


Page 10 of 48

preventing premature release. 2.3 Preparation and characterization of PPD@HPAP-CDs/pDNA To construct a CDs-based gene carrier with biocompatibility and tumor targeting ability, positive charged HPAP-CDs was firstly mixed with TRAIL pDNA to form complexes (HPAP-CDs/pDNA) and then assembled with acidity-responsive PEGylated shielding layer (mPEG-PEI-DMMA (PPD)) through electrostatic interaction, to form core/shell structured PPD@HPAP-CDs/pDNA. The shell layer of mPEG-PEI-DMMA (PPD) was synthesized by modifying polyethyleneimine (600 Da) end-capped mPEG with dimethylmaleic acid and was characterized by 1H NMR shown in Figure S2. The hydrodynamic size of PPD@HPAP-CDs/pDNA was 171 nm measured by DLS with the negative charge of -8.77 ± 0.3 mV (Table S2). Thereby the employment of PPD coating onto HPAP-CDs/pDNA would result in size increasement and charge transformation to negative which aided to minimize the non-specific interaction effectively in blood circulation. The morphology of PPD@HPAP-CDs/pDNA was also observed by HRTEM (Figure 3) and found that it presented a “chocolate chip cookie” like sharp. Each particle contained several CDs encapsulated inside the PEGylated shielding “pocket” which was similar to the structure reported previously called “cluster bomb” with pH-responsive size change 31

. In this regard, the small-sized CDs/gene complex in our study might also be

released as “bomblets” once the shielding layer cleaved under microenvironment trigger and may enhance diffusion into tumor sites. 2.4 Charge and size transition triggered by acidic tumor microenvironment The charge-convertible character of the dimethylmaleic acid (DMMA) modified polycation was endowed by the re-exposure of amino groups after hydrolysis of DMMA

which

was

extremely

sensitive

to

acidic

tumor

extracellular

microenvironment (pHe~6.8) 32. The negatively charged polymer mPEG-PEI-DMMA could be hydrolyzed to become positively charged mPEG-PEI, and then the PEGylated

shielding

layer

could

detach

from

the

positively

charged

HPAP-CDs/pDNA due to the electrostatic repulsion. To validate the pH triggered ACS Paragon Plus Environment

Page 11 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


charge-conversion and size-shrinkage of PPD@HPAP-CDs/pDNA, zeta-potentials and particle sizes were measured at both physiological pH (pH 7.4) and mildly acidic tumor extracellular microenvironment pH (pH 6.8) where mPEG-PEI-succinic anhydride (PPS) assembled HPAP-CDs/pDNA (PPS) was introduced as a control and its structure was characterized with 1H NMR shown in Figure S2b. Because of much slower rate in the hydrolysis of succinic amide than dimethylmaleic amide, PPS was stable under the acidity microenvironment of the tumor. The zeta potential of PPD@HPAP-CDs/pDNA was negative charged (-8.7 mV) at pH 7.4. However, it reversed to positively charge (14.4 mV) under pH 6.8 (Figure 4a). As expected, PPS@HPAP-CDs/pDNA could not achieve the charge reversion with -7.1 mV at pH 6.8 and -13.1 mV at pH 7.4. The change of size showed the similar pattern at different pH value. The size of PPD@HPAP-CDs/pDNA shrank by 64.3% from 171 nm at pH 7.4 to 61 nm at pH 6.8 (Figure 4b) similar to HPAP-CDs/pDNA. Furthermore, flow cytometry was also exploited to further confirm the effect of charge and size transition on cell uptake. PPD@HPAP-CDs/pDNA could significantly improve the rate of cell uptake at pH 6.8 compared with at pH 7.4 (Figure 4c). In contrast, the internalization of PPS@HPAP-CDs/pDNA was not significantly affected by pH value (Figure 4d). These results demonstrate that the exposure of PPD@HPAP-CDs/pDNA to pH 6.8 triggered the pH-activated rupture of PPD shielding layer, generating smaller size HPAP-CDs/pDNA complexes with positively charged amino groups, which further led to enhanced cellular uptake rate due to strong electrostatic interaction between positively charged HPAP-CDs/pDNA and negatively charged cytomembrane and size shrinkage

33, 34

. What’s more, acidity-responsive PPD@HPAP-CDs/pDNA could

reduce the side effect to normal tissue because of less internalization rate of negatively charged PPD@HPAP-CDs/pDNA at pH 7.4. On the basis of the above series of characterization including photoluminescence property, gene condensation/release ability and pH-responsive particle size/charge transition behavior, PPD@HPAP-CDs/pDNA displayed pH-responsive charge reversal and size-shrinkage from blood to mildly acidic tumor extracellular microenvironment, thereby facilitating the accumulation and permeation in tumor ACS Paragon Plus Environment


Page 12 of 48

tissue. Meanwhile, it also exhibited the GSH-responsive carrier degradation and thereby promotes gene release from tumor tissue into the cytosol. Thus, this nanoplatform provides a blood-tissue-cell cascaded responsive manner driven by microenvironment transition during the delivery to overcome a series of biological barriers and pitfalls. At present, various carrier design strategies based on intracellular GSH-responsive drug release lysosome escape and permeation

35

, pH-response for promoting endocytosis and

36

, nanoparticles size transition for facilitating tumor accumulation

37

and carbon dots for bioimaging agent

38

had all been reported

respectively. However, how to integrate all needed strategies into one nanomedicine in

a

rational

combination

that

self-adapting

to

cascade

transitions

of

microenvironment during cancer drug delivery process and guaranteeing precise shipping drugs into targeted cells is still a challenge for rational design of next generation cancer nanomedicines. In this regard, we proposed a solution that not just rest on multi-functionalization, but more lay in integrating all response-mediated nanoproperty transitions (charge, size and degradation) in cascaded way self-adaptive to requirements of multi-stage microenvironment as well as synchronizing therapy and imaging tracking, which provided a comprehensive strategy for precision medicine. 2.5 Biocompatibilty evaluation of PPD@HPAP-CDs/pDNA To evaluate the biocompatibilty of PPD@HPAP-CDs/pDNA and clarify the validity of PPD shielding layer, comprehensive safety evaluations were presented including serum stability, cytotoxicity and blood compatibility. Firstly, Stability of PPD@HPAP-CDs/pDNA and HPAP-CDs/pDNA in PBS containing 10% fetal bovine serum (FBS) was measured by DLS. The PPD shielded complexes maintained the initial size over the experimental time, demonstrating the effective non-specific protein adsorption resistance due to the introduction of PEGylated shielding layer. While the positively charged HPAP-CDs/pDNA shows size increase rapidly due to interaction with FBS (Figure 5a). This result is consistent with the previous report that PEGylated shielding has the ability to resist non-specific protein adsorption


39

.

Page 13 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Secondly, the cytotoxicity of PPD@HPAP-CDs/pDNA was also tested in human umbilical vein endothelial cells (HUVECs) by CCK-8 at pH 7.4. The cell viability of HUVECs incubated with PPD@HPAP-CDs/pDNA persisted over 80% even concentration reached 200 µg/mL and was significantly higher than positively charged HPAP-CDs/pDNA which showed concentration dependent cytotoxicity, indicating the PPD shielding contributed to the cytocompatibility improvement and decreased the side effects to normal tissue (Figure 5b). In addition, hemocompatibility of the PPD@HPAP-CDs/pDNA was assessed by hemolysis, blood coagulation and complement activation assays. Biocompatible evaluations in previous drug/gene delivery studies were often restricted to cytotoxicity 40-42

. However, gene carriers are usually delivered through intravenous injection and

inevitably contact with various blood components such as red blood cells and platelets. The interactions not only affect the delivery efficiency of gene carriers, but also exert an impact on functions of blood tissue, such as coagulation function. Hence, it is indispensable to evaluate the effect of nanocarriers on blood tissue to ensure their safe administration into the systemic circulation. Hemolysis indicates the biomaterial-induced disturbance of red blood cell (RBC) membrane integrity and was widely used in the biosafety assessment of various biomedical materials

43

. In this study, HPAP-CDs/pDNA exhibited the increasing

hemolysis rate in a concentration dependent manner and hemolysis ratio was even close

to

40%

when

concentration

reached

500

µg/mL.

By

contrast,

PPD@HPAP-CDs/pDNA with PEGylated shielding showed no significant impact on the RBCs (within 5% of lysis) even at high concentration (Figure 5c). This indicates that PPD@HPAP-CDs/pDNA didn't impair RBC membrane integrity even though concentration up to 500 µg/mL, which was benefit from PEGylated shielding layer. Blood coagulation is a synergy process of multiple blood components, mainly including clotting factors, fibrinogen, and platelets

44

. Four main parameters in the

whole blood clotting process were measured by Thromboelastography (TEG) 20, 45: (1) reaction time (R), indicating the activity of clotting factors; (2) coagulation time (K) and α angle indicating the activity of fibrinogen polymerization; (3) maximum ACS Paragon Plus Environment


Page 14 of 48

amplitude (MA), indicating the activity of platelet aggregation as depicted in Figure 6d (left). TEG traces, showing the blood clot formation process in the presence of different concentrations of PPD@HPAP-CDs/pDNA and HPAP-CDs/pDNA were displayed in Figure 5d (right) and the four TEG parameters were listed in Table 1. As shown in Figure 5d, the TEG traces in the presence of PPD@HPAP-CDs/pDNA reveal similar shapes to that of the PBS control and the four parameters are all within the normal range even at concentration of 1 mg/mL. In contrast, R and MA value in the presence of HPAP-CDs/pDNA exhibit abnormality at 1 mg/mL, indicating that the positive charged HPAP-CDs may activate clotting factor and impair platelet aggregation function. The protein family of complement system in humans contains 35-40 proteins in blood plasma and on cell surfaces. As the part of innate immune system, complement system promote the elimination of foreign invaders and involve in inflammation reaction and the blood clotting process. Therefore, the assessment of complement activation is very crucial in evaluating the safety of biomaterials. As the result (Figure S3) showed that complement activation level did not significant change after treated with PPD@HPAP-CDs/pDNA compared with negative control.

The above results

implied that PEGylated shielding layer could aid to improve blood-nanomaterial interactions. 2.6 In vitro transfection and tumor cells inhibition study It has been verified that PPD@HPAP-CDs/pDNA affords acidic-triggered cell uptake enhancement and intracellular GSH-responsive gene release. Then, we further estimate the gene transfection efficiency in MCF-7 cells using bioluminescent enzyme GLuc (pGL3) plasmids as reporter genes. The gene transfection results of the HPAP-CDs/pDNA complexes at various carrier/pDNA weight ratios were given as Figure S4. It was found that HPAP-CDs/pDNA complexes achieved the highest transfection efficiency at weight ratio of 20/1 and this ratio was used in following measurements.

Besides

we

examined

the

transfection

efficiency

of

PPD@HPAP-CDs/pDNA in MCF-7 cells at pH 6.8 and 7.4, with PEI/pDNA as


Page 15 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


positive control and PBS as negative control by luciferase system (shown in Figure 6a). PPD@HPAP-CDs/pDNA at pH 6.8 exhibited the highest transfection efficiency even than PEI25k. The prominent performance of PPD@HPAP-CDs/pDNA for gene transfection is probably derived from the hyperbranch-shaped structure of HPAP

46

,

charge/size transition based cell uptake enhancement and intracellular biodegrability induced gene release promotion 47, 48. In this study, the TNF-related apoptosis-inducing ligand (TRAIL) gene was selected as the therapeutic gene to assess tumor cells inhibition efficiency due to its specific antitumor activity which reduces risk to normal cells. TRAIL is a typical membrance-associtated cytokine acting on the death receptor on the tumor cell membrane for induction of caspase-dependent irreversible apoptosis

49, 50

. MCF-7

cells and HUVECs cells were treated with PPD@HPAP-CDs/TRAIL, PEI/TRAIL and PBS at pH 6.8 and 7.4 to evaluate the specific tumor cells inhibition efficiency using CCK-8. As Figure 6b showed that PEI/TRAIL group and PPD@HPAP-CDs/TRAIL at pH 6.8 can significantly suppress the viability of MCF-7 cells compared with PPD@HPAP-CDs/TRAIL at pH 7.4, while there is no significant effect on HUVECs in all groups. These results confirmed the effective anticancer activity of TRAIL and improved cancer cells-specific inhibition of PPD@HPAP-CDs/TRAIL, indicating the selective inhibition ability of PPD@HPAP-CDs/TRAIL which reduced side effect to normal tissue. Moreover, the anticancer activity of TRAIL had been further validated by apoptosis analysis (Figure 6c & Figure S5). The result showed that PEI/TRAIL revealed 14.89% and 14.38% cell apoptosis rate at pH 6.8 and 7.4, and PPD@HPAP-CDs/TRAIL at pH 6.8 led to about 19.42% cell apoptosis rate while only around 4.93% cell apoptosis was detected at pH 7.4. Both cell proliferation and apoptosis results demonstrated that PPD@HPAP-CDs/TRAIL showed the higher tumor cells suppression compared with the positive control PEI/TRAIL benefiting from the improved gene transfection. 2.7 Activation of TRAIL-mediated apoptosis signaling pathways As reported, binding of TRAIL to receptor (TRAILRI or TRAILR2) results in



Page 16 of 48

receptor oligomerization and initiation of apoptosis through the recruitment of the FAS-associated protein with death domain (FADD) to death domain motifs in the carboxyl terminus of the receptors

51, 52

. Then membrane-proximal caspase-8 is

recruited and generated multi-protein complex, designated the death-inducing signaling complex. The apoptotic signaling downstream of activated caspases-8 is caspase-3 which is then targeted for proteolytic cleavage, and activated caspase-3 in turn cleaves numerous cellular proteins, resulting in hallmarks of apoptosis

53, 54

.

However, Bcl2 homology domain 3-interacting domain death agonist (Bid) is also a target for active caspase-8 through mitochondrial pathway. Then, activated Bid can bind to pro-apoptotic Bax, resulting in mitochondrial membrane permeabilization and release of mitochondrial proteins cytochrome c which is a main component to form a functional apoptosome that results in cleavage and activation of caspase 9. Caspase-9 can also cleave caspase-3 resulting in apoptosis (Figure 7a). To prove the TRAIL-triggered apoptosis signaling pathways were activated by PPD@HPAP-CDs/TRAIL in both gene and protein levels, we examined the apoptotic signaling pathway of transfected MCF-7 cells by qPCR and western blotting. As shown in Figure 7b, mRNA expression levels of TRAIL were significant increased after treated with PPD@HPAP-CDs/TRAIL, compared with the PBS negative control. Further, the mRNA levels of downstream signal molecules such as caspase-8, caspase-3, Bid, Bax and caspase-9 were also up-regulated. The results of Western blotting analysis also showed that the protein levels of TRAIL, caspase-8, caspase-9 and caspase-3 were elevated obviously (Figure 7c, d) similar to the trend of mRNA upon the treatment with PPD@HPAP-CDs/TRAIL. These above results indicated that the apoptosis signaling pathways of TRAIL were activated both in gene and protein levels. Therefore, the inhibition effciency of PPD@HPAP-CDs/TRAIL complexes on MCF-7 cells could be associated with the activation of apoptosis signaling pathway by successful delivery of TRAIL pDNA. 2.8 In vivo image-tracking and tumor accumulation. In order to evaluate the imaging tracking efficacy and tumor targeting ability of


Page 17 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PPD@HPAP-CDs/pDNA, in vivo imaging of MCF-7 tumor-bearing mice with both intratumoral and intravenous injection was conducted by using an in vivo imaging system. As demonstrated in Figure 8a, mice treated with PPD@HPAP-CDs/pDNA via intratumoral injection displayed distinct fluorescence emission from the tumor site, while mice with intravenous injection showed a widespread fluorescent distribution in the whole body with heavy fluorescence background attributed to the skin autofluorescence in the blue-green light wavelength coverage. However higher fluorescence intensity still can be detected in the tumor site than other region, suggesting the intravenous injection of PPD@HPAP-CDs/pDNA enabled the fluorescence-based tumor imaging to some extent. On the basis of the in vivo imaging with both intratumoral and intravenous injection, the result demonstrated the potential of the hybrid CDs as an in vivo fluorescence tracing agent for studying carrier biodistribution. To further verify the tumor targeting and accumulation ability of our cascaded responsive hybrid CDs, tumors were isolated and the accumulated fluorescent CDs were quantified by in vivo imaging after intravenous injection of various formulations (PBS, PPD@HPAP-CDs/pDNA and HPAP-CDs/pDNA) after 8h. As presented in Figure 8b, the strongest fluorescence was detected in the PPD@HPAP-CDs/pDNA group, while injection of HPAP-CDs/pDNA shows weaker fluorescence signal demonstrating that PPD@HPAP-CDs/pDNA exhibited remarkable retention effect within tumor due to an elevated EPR-mediated accumulation and prolonged circulation.

Herein

the

elevated

EPR

effect

was

mediated

with

microenvironment-driven charge-conversion and size-shrinkage of this “smart” carrier. Specifically, this CDs/polycation hybrid coated with cleavable PEGylated shielding could remarkably minimize non-specific interaction with blood components to extend circulation

and

underwent

deshielding

once

entering

into

acidic

tumor

microenvironment to re-expose positively charged core and release smaller-sized HPAP-CDs/pDNA complex resulting in elevated EPR-mediated tumor accumulation. The above result was also supported by ex vivo fluorescence images of hybrid CDs distribution in different organs (shown in Figure 8c). The tumor tissue treated with ACS Paragon Plus Environment


Page 18 of 48

PPD@HPAP-CDs/pDNA had the highest fluorescence intensity of CDs signal compared to the other organs, and the liver also showed stronger fluorescence intensity of CDs signal compared to the other organs, implying that they could be eliminated by liver. This manner is beneficial for practical clinical translation. Whereas fluorescence distribution of HPAP-CDs/pDNA group revealed that more HPAP-CDs/pDNA complexes entered into normal organs (such as lung) which may induce toxic and side effect. Altogether, these results indicated that the hybrid CDs with intelligent responsive functionalization are able to not only act as a theranostic agent for tracing carrier distribution, but also greatly accumulate in tumor tissues through

passive

targeting

resulting

from

tumor

microenvironment-driven

charge-conversion and size-shrinkage, implying its potential for imaging-traceable tumor-specific gene precise delivery. 2.9 In vivo antitumor ability of PPD@HPAP-CDs/TRAIL Further experiments were performed to assess the tumor therapeutic efficiency in vivo. The MCF-7 cells were chosen as the xenograft model in BALB/c nude mice. The

MCF-7

tumor-bearing

mice

were

treated

with

PBS,

PEI/TRAIL,

HPAP-CDs/TRAIL and PPD@HPAP-CDs/TRAIL by intravenous injection every other day. The tumor growth of PPD@HPAP-CDs/TRAIL group was greatly inhibited after 16 days treatments compared with the group of PBS by 70.84%. The tumor growth of HPAP-CDs/TRAIL and PEI/TRAIL groups showed weaker inhibitory effect by 27.45% and 45.78% respectively, maybe due to the interaction between positive charged nanocarriers and blood component leading to therapeutic efficiency reduction (Figure 9a). Moreover, there is no obvious effect on body weight of all groups over the experimental period (Figure 9b), indicating that minor side effects of PPD@HPAP-CDs/TRAIL to animals. The digital photos of excised tumor isolated from mice at the end of the treatment also confirmed the tumor growth inhibition activity described above (Figure 9c). The in vivo therapeutic effect of the PPD@HPAP-CDs/TRAIL was further evaluated by H&E staining and TUNEL analysis in situ histological and


Page 19 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


immunohistochemical studies of the tumor sections (Figure 9d). In H&E analysis, the extremely compact cell arrangement was observed in PBS, while the tumors of TRAIL treated groups showed nuclei absence to different extent. Remarkable interstitial

spaces

and

nuclei

absence

were

found

in

the

tumors

of

PPD@HPAP-CDs/TRAIL. The result of TUNEL staining assays show the maximum ratio

of

apoptotic

cells

with

brown

staining

were

detected

in

PPD@HPAP-CDs/TRAIL group, which was significantly higher than that in other groups. These tendencies were consistent with the results of in vitro apoptosis assays. The effective tumor suppression efficiency demonstrated by H&E staining and TUNEL analysis both indicated the antitumor activity of PPD@HPAP-CDs/TRAIL for potential in vivo gene therapy. Besides, to assess the bio-safety of the TRAIL-based nanocarriers, the major organs including heart, liver, kidney, lung and spleen were collected and examined by H&E staining (Figure 10). There were no visible organ damage or tissue denaturation could be found in these organs indicating the good biocompatibility of nanocarriers. Altogether, the results demonstrate that the PPD@HPAP-CDs/TRAIL could improve the image-traceable TRAIL-based anticancer activity without appreciable side effects. 3 Conclusions In summary, functionalized carbon dots-based theranostic nanoplatform capable of facile preparation, microenvironment-driven cascaded responsiveness and imaging tracking capability has been successfully developed for tumor-specific TRAIL gene precise delivery with enhanced cancer therapeutic efficiency. The cascaded responsive property endows this nanocarrier with prolonged circulation time in blood benefiting from cleavable PEGylated shielding, effective accumulation in the tumor tissue induced

by

elevated

EPR

effect

resulting

from

microenvironment-driven

charge-conversion and size-shrinkage and controlled gene release ability inside the cells facilitated by GSH-triggered HPAP degradability. Such blood-tissue-cells cascaded responsive hybrid carbon dots not only act as a theranostic agent for bioimaging and tracing carrier distribution, but also leads to enhanced and selective



Page 20 of 48

tumor inhibition efficiency in vitro and in vivo with excellent cellular, blood and intravital compatibility. Our strategy of imaging-traceable cancer precise therapy not just provides a multifunctional solution, but more lies in integrating carrier nanoproperty (i.e., charge, size or stability) transitions in a multi-step cascaded manner adapt to microenvironment variation during the delivery and synchronizing imaging tracking into precision medicine which may be the forthcoming direction for designing efficient carrier in cancer theranostics. 4 Material and methods 4.1 Materials 1-(2-aminoethyl)-piperazine (AEPZ), cystamine dihydrochloride, Acryloyl chloride, citric acid, 4-dimethylaminopyridine (DMAP), N-hydroxy-succinimide (NHS), 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC·HCl), mPEG-OH (2000 Da), succinic anhydride (SA) and 2,3-dimethylmaleic anhydride (DMMA) were purchased from Aladdin Industrial Corporation (Shanghai, China). Branch PEI with an average weight of 600 Da and 25 kDa (bPEI600 and bPEI25k) were purchased from Sigma-Aldrich (USA). All the solvents were purchased from Guangzhou Chemical Reagent (China) and without further purification. Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS) and penicillin streptomycin were purchased from Invitrogen Corporation (Washington, USA). MCF-7 (human breast adenocarcinoma cell line) and HUVECs (Human Umbilical Vein Endothelial Cells) was obtained from Southern Medical University in Guangzhou. Fresh blood was provided by healthy and consenting volunteers and collected in sodium citrate tube. 4.2 Synthesis of HPAP-CDs As the main component of disulfide bonds containing hyperbranched poly(amido amine)

with

polyethyleneimine

(600

Da)

end-capped

N,N’-bis(acryloyl)cystamine (BAC) was synthesized as previous report

(HPAP), 55

. In brief,

cystamine dihydrochloride (0.25 g) was added into distilled water (11 mL) in flask at


Page 21 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ice bath. Then, acryloyl chloride (6.6 mL) in dichloromethane (v/v = 50%) and 4.4 mL aqueous NaOH solution (0.40 g/mL) were added dropwise to the flask. Subsequently, the mixture was stirred at room temperature for another 6 h. BAC was extracted from dichloromethane and washed three times with distilled water. The product was obtained after rotary evaporation with yield of 82%. The HPAP were synthesis by one-pot two-step Michael addition polymerization 56

. In brief, BAC (1.5 mmol) was dissolved in 10 mL 200 mM CaCl2 methanol/water

(v/v = 3/1) solution at room temperature. Then AEPZ (0.75 mmol) was added dropwise to the mixture with stirring under nitrogen atmosphere at 50 oC for 30 h. After that, bPEI600 (0.75 mmol) was added to the mixture for another 8h to terminate vinyl groups. Finally, the mixture was dialyzed in distilled water for 2d (MWCO = 3500). HPAP functionalized carbon dots (HPAP-CDs) were prepared by one step strategy of microwave-assisted process with citric acid and HPAP as precursor. Briefly, 250 mg citric acid and 100 mg HPAP were mixed in 5 mL 0.05 M HCl in a 50 ml flask. The homogeneous solution was treated with a Microwave Synthesis Reactor (XH-MC-1, XiangHu Science and Technology Development Co., Ltd, Beijing) and reacted for 3 mins. The product was diluted and dialyzed against pure water for 24 h (MWCO = 1000 Da, USA). The residue was lyophilized to yield yellow solid. 4.3 Synthesis of mPEG-PEI-DMMA (PPD) For mPEG-COOH synthesis, mPEG-OH (10 g, 2000 Da), succinic anhydride (2.5 g) and DMAP (240 mg) were stirred in DMF (50 mL) at 75 oC under nitrogen atmosphere for 24 h. The mixture was dialyzed against water for 24 h (MWCO = 1000 Da). For mPEG-PEI synthesis, mPEG-COOH (100 mg), EDC·HCl (447 mg), NHS (288 mg) were mixed in H2O (25 mL). After reacting at room temperature for 2 h, bPEI600 (167 mg) was added and the reaction was continued at room temperature for another 24 h. For mPEG-PEI-DMMA (PPD) or mPEG-PEI-SA (PPS) synthesis, mPEG-PEI (100 mg) was stirred in aqueous solution (pH 8.5) for 3 h. 2,3-dimethylmaleic anhydride (121 mg) or succinic anhydride (96 mg) was added and



Page 22 of 48

kept the pH in the range of 8-9. After reacting at room temperature for 5 h, the mixture was dialyzed against water (pH = 8−9) for 48 h by using a dialysis membrane with MWCO of 1000 Da. 4.4 Preparation of PPD@HPAP-CDs/pDNA complexes For PPD@HPAP-CDs/pDNA or PPS@HPAP-CDs/pDNA preparation, the mixture of HPAP-CDs and pDNA was firstly incubated at room temperature for 15 min. Then the negatively charged PPD or PPS (0.1 mL, 10 mg/mL in water) was added to the positively charged mixture of HPAP-CDs/pDNA to incubate for 15 min. The final ratio of PPD/ HPAP-CDs/pDNA was 40/20/1. 4.5 Physicochemical properties characterization 1

H NMR spectra of mPEG-OH, mPEG-COOH, mPEG-PEI, mPEG-PEI-DMMA,

mPEG-PEI-SA, BAC, HPAP and HPAP-CDs were obtained using a 300 MHz NMR spectrometer (AVANCEIII 300MHz, Bruker, Germany). D2O was used as the solvent. IR spectra were measured on a Fourier transformed infrared spectrophotometer (Bruker,

VERTEX

70,

Germany).

The

morphology

of

HPAP-CDs

and

PPD@HPAP-CDs/pDNA were observed by High-resolution transmission electron microscope (HRTEM, JEM-2100F, JEOL). The UV-visible absorption spectrum of HPAP and HPAP-CDs was recorded using an UV-visible spectrophotometer (UV-2500, Shimadzu Corporation, Japan). The fluorescence emission spectra of HPAP-CDs aqueous solution were recorded on fluorescence spectrophotometer (F-7000, Hitachi High-Technologies Corp., Tokyo, Japan) under excitation wavelength in 320-600 nm. 4.6 Quantum yield measurements The quantum yields of HPAP-CDs were determined by Fluorescence spectrophotometer, using quinine sulfate as reference fluorophore. The formula for calculating quantum yield (QY) was according to Φ = ΦR(I/IR)(AR/A)( η2/ηR2) Where Φ means the quantum yield, I means the integrated fluorescence intensity,


Page 23 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


A indicates the absorbance intensity, and η means the refractive index of solvent. 4.7 Cell imaging Cancer cell lines of human breast tumor (MCF-7), hepatocellular carcinoma (Hep G2) and cervix adenocarcinoma (Hela) cells and normal tissue cell line umbilical vein endothelial cells (HUVEC) were seeded in culture plates and incubated for 24 h. After replacing culture medium with DMEM containing HPAP-CDs (80 µg/mL), cells were incubated for another 3 h. Then the cells were washed with PBS twice and observed by confocal laser scanning microscope (Zeiss, Germany, LSM 880) under excitation wavelength of 405 nm, 488 nm and 543 nm. 4.8 GSH-responsive measurement of HPAP-CDs The molecular weights of HPAP-CDs before and after GSH (10 mM) treatment were measured by gel permeation chromatography (GPC) (Viscotek Model 270, Malvern Instruments Ltd., MA, USA) with flow rate at 1.0 mL/min and poly(ethylene oxide) as standard. The particle sizes of HPAP-CDs before and after GSH (10 mM) treatment were measured by dynamic light scattering (DLS). 4.9 Determination of gene condensation and release In order to assess the pDNA condensation and GSH-triggered gene release ability of HPAP-CDs, HPAP-CDs/pDNA complex was electrophoresed at different w/w ratios (1, 3, 5, 10 and 30) on 1% agarose gels containing GoldView II (Sigma) with Tris-acetate-EDTA (TAE) buffer at 120 V for 40 min, and the above samples treated with 10 mM GSH were also subjected to gel retardation assay. Naked pDNA was used as a control. pDNA motion retardation were revealed by irradiation with UV transilluminator (Bio-Rad, USA). Confocal laser scanning microscopy (CLSM) was employed to observe gene release form PPD@HPAP-CDs/pDNA inside cells. MCF-7 cells were seeded into confocal dish for 24 h. Then, the medium was replaced by DMEM containing HPAP-CDs/pDNA-Cy5 and the cells were incubated for another 2h, 4h, or 8h, respectively. After incubating for predetermined time, the cells were washed with PBS twice, and fixed by 4% formaldehyde. Finally, the fluorescence



Page 24 of 48

images were acquired by a confocal laser scanning microscopy (LSM780, Zeiss, Germany). 4.10 Particle size and zeta potential measurements at different pH values The pH-triggered charge reversal and size shrinkage of PPD@HPAP-CDs/pDNA was verified by zeta potential analysis and DLS at different pH values (pH 6.8 and 7.4), and both HPAP-CDs/pDNA and PPS@HPAP-CDs/pDNA were set as control groups.

All

groups

(HPAP-CDs/pDNA,

PPD@HPAP-CDs/pDNA

and

PPS@HPAP-CDs/pDNA) were dissolved in PBS to obtain final concentration of 100 µg/mL. Zeta potential and particle sizes were measured at 25 oC by Malvern Zetasizer Nano ZS. 4.11 Cellular uptake analysis MCF-7 cells were seeded in culture plate for 24h. Then the medium was replaced with complete DMEM medium (pH 6.8 or 7.4) containing PBS control, PPD@HPAP-CDs/pDNA or PPS@HPAP-CDs/pDNA respectively. The cellular uptake ratio was measured by flow cytometry and the fluorescence was detected with a 488 nm band-pass filter. 4.12 Biocompatibility evaluation 4.12.1 Serum stability measurement of PPD@HPAP-CDs/pDNA To assess the serum stability of nanoparticles, the HPAP-CDs/pDNA and PPD@HPAP-CDs/pDNA were added into PBS containing 10% FBS at 37 °C. The particle sizes of complexes were measured by DLS at 0, 15, 30, 60 and 180 min. 4.12.2 In vitro cytotoxicity assay Human Umbilical Vein Endothelial Cells (HUVECs) were seeded in culture plate and culture for 24 h. Subsequently, the medium was replaced by in the same volume of DMEM medium (pH 6.8 or 7.4) containing PPD@HPAP-CDs/pDNA and HPAP-CD/pDNA at concentrations of 10-200 µg/mL. Then, the medium was replaced with fresh medium supplemented with CCK-8 solution and then incubated for another 2 h. After gentle agitation for 1 min, the absorbance at 450 nm was recorded by


Page 25 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Thermo MK3 microplate reader. 4.12.3 Blood compatibility evaluation For hemolysis assay, 50 µL RBCs suspension (16% v/v in PBS) was incubated with 1 mL PPD@HPAP-CDs/pDNA or HPAP-CDs/pDNA at concentrations from 10 to 500 µg/mL, PBS (negative control) and pure water (complete hemolysis control) were set as control groups. After being incubated for 12 h, the RBC suspensions were centrifuged and the supernatants were added in 96-well plate and measured at 540 nm with microplate reader (Multiskan MK3, Thermo scientific) to detect hemoglobin release from the RBCs. The hemolysis rate of PPD@HPAP-CDs/pDNA or HPAP-CDs/pDNA treated RBCs were calculated by comparing the absorbance values at 540 nm to that of the complete hemolysis sample. For thromboelastography (TEG) assay, fresh citrate-anticoagulated whole blood (900 µL) was mixed with 100 µL of PPD@HPAP-CDs/pDNA, HPAP-CDs/pDNA or PBS (negative control) respectively in a kaolin-containing tube. Then blood/sample mixture (340 µL) and CaCl2 solutions (0.2 M, 20 µL) were mixed in a TEG test cup and the blood clotting process was immediately recorded at 37 °C on a Thromboelastograph Hemostasis System 5000 (Haemoscope Corporation, Niles, IL, USA). 4.13 Cellular transfection MCF-7 cells were seeded into culture plates for 24 h. Then culture medium was replaced with 500 µL/well fresh DMEM at different pH values (7.4 and 6.8). For cellular transfection assay, bioluminescent enzyme GLuc (pGL3) plasmids were used as reporter genes. After the complex containing pGL3 were added to each well, the plates were returned to the incubator for another 4 h. After that, culture medium was replaced with fresh DMEM containing 10% FBS, and the plates were continued to incubate for 48 h. The transfection efficiency of PPD@HPAP-CDs/pDNA was determined at different pH (7.4 and 6.8) using Bright-Glo luciferase assay system by fluorescence microplate reader. PEI/pDNA and PBS were set as the positive control and negative control respectively.



Page 26 of 48

4.14 Cell proliferation inhibition For cells apoptosis assay, the TRAIL pDNA was used as the therapy gene in this experiment. The procedure was the same as transfection assay. After transfection, cells were collected and detected by flow cytometry after stained with the Annexin V-PE and 7-AAD to detect cell apoptosis (BD Biosciences) according to the suggested procedure. To further investigate whether PPD@HPAP-CDs/TRAIL has different inhibition effect to tumor cells and normal cells, CCK-8 assay was conducted according to above transfection procedures. MCF-7 cells and HUVECs cells were used and measurement of cell proliferation inhibition was performed at pH 7.4 and 6.8. 4.15 RT-qPCR and western blotting In order to prove the TRAIL mediated apoptosis signaling pathway was activated, Real-time qPCR and western blotting were employed in mRNA level and protein level respectively. For Real-time qPCR analysis, similar cell culture and treatments were performed as above cell apoptosis assay. After washing with PBS, total RNA was isolated from MCF-7 cells using Trizol. Real-time PCR was carried out using a Stepone plus RT-qPCR system (ABI, USA). Human β-actin was used as internal control to normalize the variability in expression. Experiment was repeated three times to verify the repeatability. The following specific primers sets that are consensus region among isoforms were used for qPCR; Forward (5’--3’) β-actin Bax Bit

Reverse (5’--3’)

CACCCAGCACAATGAAGATCAAGAT

CCAGTTTTTAAATCCTGAGTCAAGC

TGACGGCAACTTCAACTGGG

ATCAGTTCCGGCACCTTGGT

AATACCGCCGCTGAGAACACT

CCCTGGGCTTTCTTCTGTCTG

Caspase-3

CAAATGGACCTGTTGACCTGAA

CACAAAGCGACTGGATGAACC

Caspase-8

CCATGGCGAAGGCAATCAC

CCAGCAGGCAGCGTGTAAAC

Caspase-9 TRAIL

CAGAGATTCGCAAACCAGAGG

GGACTCACGGCAGAAGTTCAC

GAAGATGACAGTTATTGGGACCC

CTTGGAGTCTTTCTAACGAGCTG

For western blotting analysis, cells were lysed and sonicated in ice-cold SDS lysis buffer supplemented with PMSF and protease inhibitor (PI). After cell lysates were collected by centrifugation, proteins were separated by SDS-PAGE, and then


Page 27 of 48 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transferred to polyvinylidene Fluoride (PVDF) membrane which was subsequently blocked with 5% skimmed milk on a horizontal shaker for 1 h. The membranes were incubated with primary antibodies (Anti-β-actin, anti-TRAIL, anti-caspase-3, anti-caspase-8 and anti-caspase-9 monoclonal antibody (Cell Signaling Technology, USA)) over night at 4 oC, followed by incubation with HRP-conjugated anti-rabbit antibodies at 25 oC for 2 h. Finally, bands were visualized using a Bio-rad ChemiDoc XRS System. 4.16 In Vivo imaging in Xenografted Nude Mice BALB/c nude mice (6-8 weeks old) were purchased from Beijing Huafukang Bioscience Co. Inc. (Beijing, China) and were housed in Laboratory Animal Center of Jinan University (SPF grade). And all animals received care in compliance with the guidelines outlined in the Guide for the Care and use of Laboratory Animals. The xenograft tumor model was generated by subcutaneous injection of MCF-7 cells (5×106 for each mouse) in flanks of each mouse. When the tumor volume reached 200 mm3, the mice were injected with 100 µL of PPD@HPAP-CDs/pDNA, HPAP-CDs/pDNA or PBS via intravenous injection. The dose of pDNA each injection was 40 µg per mouse. After 8h, the mice were sacrificed and the solid tumor tissue and major organs were harvested. Ex vivo imaging of accumulation of HPAP-CDs complexes within tumors and major organs was performed with fluorescence images and then captured by In-vivo FX Pro (Bruker, USA). Besides in vivo

fluorescence

imaging

of

MCF-7

tumor-bearing

mice

treated

with

PPD@HPAP-CDs/pDNA (40 µg pDNA/mouse) were conducted via both intratumoral and intravenous injection to valuate in vivo tracking ability. 4.17 In Vivo Antitumor Activity and histopathological analysis The tumor model with MCF-7 xenograft was established as described above. When the tumor volume was around 100 mm3 after implantation, the mice were randomly divided into 4 groups (5 mice per group). They were treated with PBS, PPD@HPAP-CDs/TRAIL, HPAP-CDs/TRAIL and PEI/TRAIL by intravenous injection once every other day. The dose of TRAIL pDNA each injection was 40 µg ACS Paragon Plus Environment


per mouse. The tumor size and body weights were measured every day after the treatment. The tumor volume was calculated according to the formula: tumor volume (mm3) =0.5 × length × width2. Paraffin-embedded 5 µm thick tumor sections were obtained for the terminal transferase dUTP nick-end labeling (TUNEL) assay. Histology analysis was carried out at the 16th day after the treatment, the major organs (heart, liver, spleen, lung and kidney) and tumor was collected and fixed with 4% formaldehyde. To evaluate the potential side effects by various formulations, the sliced organs and tumors (3−5 mm) were stained with hematoxylin and eosin (H&E), and examined on a Zeiss upright microscope (Axio Scope A1). 4.18 Statistical analysis Group data were reported as mean standard deviation (SD). Student’s t-test was adopted to calculate the statistical differences (significant for *p

Microenvironment-Driven Cascaded Responsive ... - ACS Publications

Recommend Documents