Microwave-Assisted Facile Synthesis of Eu(OH)3 Nanoclusters with

Subscriber access provided by University of South Dakota

Biological and Medical Applications of Materials and Interfaces 3

Microwave-Assisted Facile Synthesis of Eu(OH) Nanoclusters with Pro-Proliferative Activity Mediated by miR-199a-3p Li Zhang, Wanglai Hu, Yadong Wu, Pengfei Wei, Liang Dong, Zongyao Hao, Song Fan, Yong-Hong Song, Yang Lu, Chaozhao Liang, and Longping Wen ACS Appl. Mater. Interfaces, Just Accepted Manuscript • DOI: 10.1021/acsami.8b10543 • Publication Date (Web): 27 Aug 2018 Downloaded from http://pubs.acs.org on September 6, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Applied Materials & Interfaces

Microwave-Assisted Facile Synthesis of Eu(OH)3 Nanoclusters with Pro-Proliferative Activity Mediated by miR-199a-3p Li Zhang#a, Wanglai Hu#b, Yadong Wu#c, Pengfei Weid, Liang Dongd, Zongyao Haoa, Song Fana, Yonghong Songc, Yang Lu*c, Chaozhao Liang*a, Longping Wen*d,e a

Department of Urology, the First Affiliated Hospital of Anhui Medical University and Institute

of Urology, Anhui Medical University, Hefei, Anhui 230022, P. R. China. b

Department of Immunology, Anhui Medical University, Hefei, Anhui 230032, P. R. China.

c

School of Chemistry and Chemical Engineering, Hefei University of Technology, Hefei, Anhui

230009, P. R. China. d

Hefei National Laboratory for Physical Sciences at Microscale, The CAS Key Laboratory of

Innate Immunity and Chronic Disease, Innovation Center for Cell Signaling Network, School of Life Sciences and Medical Center, University of Science and Technology of China, Hefei, Anhui 230027, P. R. China. e

School of Medicine, South China University of Technology, Guangzhou 510006, P. R. China.

Corresponding authors: [email protected], [email protected] and [email protected] #

These authors contributed equally to this work.

ACS Paragon Plus Environment

1

ACS Applied Materials & Interfaces 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 28

KEYWORDS: Eu(OH)3 nanoclusters, microwave-assisted synthesis, miR-199a-3p, cell proliferation; next generation sequencing ABSTRACT As a pharmaceutical excipient, dextran serves as an efficient ligand for stabilizing some clinically available inorganic nanomaterials such as iron oxide nanocrystals. Herein, dextran capped nano-sized europium (III) hydroxides [Eu(OH)3] nanoclusters (NCs) composed of 5 nm Eu(OH)3 nanoparticles have been large-scale synthesized via a microwave-accelerated hydrothermal reaction. The as-synthesized Eu(OH)3 NCs exhibited excellent physiological stability and biocompatibility both in vitro and in vivo, and possessed considerable proproliferative activities in human umbilical vein endothelial cells (HUVECs). To investigate the epigenetic modulation of Eu(OH)3 NCs-elicited proliferation, the newly-developed highthroughput next generation sequencing technology was employed herein. As a result, we have screened 371 dysregulated miRNAs in Eu(OH)3 NCs-treated HUVECs and obtained 26 potentially functional miRNAs in promoting cell proliferation. Furthermore, upregulated miR199a-3p was predicted, validated and eventually confirmed to be a crucial modulator in the proproliferative activity of Eu(OH)3 NCs by targeting zinc fingers and homeoboxes protein 1 (ZHX1). Importantly, these findings provide potential therapeutic strategy for ischemic heart/limb diseases and tissue regeneration, by combination of nanomedicine and gene therapy with Eu(OH)3 NCs and miR-199a-3p-ZHX1 axis modulation.

Introduction

with unique optical, electronic and magnetic performances, nanomaterials hold great promise in diverse biomedical applications, especially biosensor and multimodal imaging mediated diagnosis and thermal therapy for cancer.1-4 Recently, catalytic activity of nanomaterials have


2

Page 3 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


received considerable interests in biomedical area, which took considerable advantages including high response to the microenvironment of cancer and stable enzyme-mimic activity.5-8 Among these catalytic nanomaterials, europium and several other lanthanide elements-based nanomaterials elicited significant pro-proliferative and angiogenic activities like cytokines, which have been designed for damaged tissues repair in ischemic heart/limb diseases.9-10 Concretely, the as-prepared europium (III) hydroxide [Eu(OH)3] nanorods could generate reactive oxygen species (ROS) and activate mitogen activated protein kinase (MAPK), resulting in pro-proliferative and angiogenic activities.9-11 However, epigenetic effects elicited by nanosized Eu(OH)3 could probably lead to a long-term regulation of gene expression without altering the primary DNA sequences, which have not been explored so far. MicroRNAs (miRNAs) with 19-23 nucleotides length are a group of single-stranded and noncoding endogenous small RNAs which are evolutionally conserved. As crucial modulators in a variety of biological processes, miRNAs repress the translation of complementary mRNAs by forming a miRNA-induced silencing complex and function.12-13 Presently, the overwhelming majority of studies regarding miRNAs focus on their post-transcriptionally regulated roles in the alternation of protein expression levels.14-15 However, it should be noticed that through comprehensively coordinated processing events, mature miRNAs are generated and strictly modulated by a series of mechanisms, including promoter methylation, histone acetylation and even extracellular stimuli,16-17 such as exposure to CdTe quantum dots and iron oxide nanoparticles.18-19 Therefore, to further evaluate the biological activities of the nanomaterials, it is of great importance to investigate the impact of Eu(OH)3 nanomaterials treatment on miRNAs processing.


3


Page 4 of 28

The physiological stability, assembly, biocompatibility and pharmacodynamic and pharmacokinetic properties of nanomaterials are majorly depended on their surface properties.2023

As a pharmaceutical excipient, dextran serves as an efficient ligand for the capping and

stabilizing of inorganic nanomaterials,24-25 and several kinds of dextran stabilized iron oxide nanocrystals (such as Ferridex, Resovist and Ferumoxytol) have been approved for MR diagnosis by the U. S. Food and Drug Administration (FDA).20,

26-27

Previously, we have

synthesized rod-like Eu(OH)3 nanomaterials by using hydrothermal method without any surfactant.28 Herein, we synthesized dextran coated Eu(OH)3 nanoclusters via a microwaveaccelerated hydrothermal reaction, which exhibited good biocompatibility in vitro and in vivo and especially pro-proliferative activity on human umbilical vein endothelial cells (HUVECs). Moreover, we employed the newly-developed high-throughput technology named next generation sequencing (NGS) to screen dysregulated miRNAs in Eu(OH)3 nanoclusters-treated HUVEC cells, and 26 potentially functional miRNAs were found to regulate cell proliferation. Among them, miR-199a-3p was identified and confirmed to be the critical mediator of the proproliferative activity of Eu(OH)3 nanoclusters, which could directly targeted ZHX1 (Scheme 1).


4

Page 5 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1 Schematic illustration shows Eu(OH)3 NCs promoted HUVECs proliferation by upregulating miR-199a-3p which directly targeted ZHX1.

Materials and Methods Synthesis of Eu(OH)3 Nanoclusters. Eu(OH)3 nanoclusters were synthesized by a microwaveassisted hydrothermal process. Typically, 0.669 gram of europium (III) nitrate hexahydrate and 0.45 gram of dextran 10 mixture were dissolved in 29.25 ml of distilled water (DIW) in a 100 mL beaker. Subsequently, 0.75 ml of aqueous ammonium hydroxide was added into the beaker


5


Page 6 of 28

drop by drop under vigorous magnetic stirring. The stirring process should be sustained for 30 minutes. The suspension solution was then ultra-sonicated for 15 minutes. 15ml of the precursor was transferred to a 30ml microwave tube for irradiation. The temperature of the mixture was raised rapidly to 150 °C while the heating power was kept at 150 W and the pressure was kept at 240 PSI. This high pressure reaction system was kept for 10 min, then cooled down to room temperature naturally. The resulting product was ultra-sonicated for another 30 minutes. The product was washed with DIW and collected by centrifugation under 9000 rpm for 30minutes. The final product was dispersed in Tris-EDTA buffer solution. Biocompatibity Evaluation and Biodistribution Study. In vivo compatibility of Eu(OH)3 NCs was performed on ICR mice with a single intravenous injection of Eu(OH)3 NCs at a dose of 2 mg/kg (100 µL per mouse). One week later, major organs including heart, liver, lung and kidney from ICR mice and control group were harvested and fixed for hematoxylin & eosin staining, while whole blood was collected for biochemical index evaluation. Another 25 mice were divided into five groups (n = 5 for each group). Mice were intravenously injected with Eu(OH)3 NCs at a dose of 2 mg/kg. Time intervals were 2, 12, 24, 48 h and 7 d post injections (5 mice for each time point). Then, the mice were sacrificed, and heart, liver, spleen, lung, kidney were collected. These organs were then weighed and put into glass tubes with 5 mL HNO3, which were heated to 120 °C overnight until all organs were decomposed, and the excessive HNO3 solution was expelled. After cooling down thoroughly, each sample was diluted to 10 mL with deionization water and Eu element contents were measured by inductively coupled plasmaatomic emission spectrometry (ICP-AES). The Eu(OH)3 NCs amount was normalized to the concentration per gram tissue weight. All in vivo evaluations were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National


6

Page 7 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Institutes of Health. All of the animal use protocols of in vivo compatibility were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of Anhui Medical University (LLSC20170344). Cell Viability, EdU (5-ethynyl-2’-deoxyuridine) and Clonogenic Assays. HUVECs were seeded in 96-well plate to incubate for 24 h at a density of 1×103 cells per well. After 72 h exposure to Tris-EDTA buffer or Eu(OH)3 nanoclusters in the presence or absence of miR-199a3p mimics, inhibitors and scramble control RNAs, cell proliferation was measured by standard MTT assay at wavelength 490 nm with ELx800 Microplate Reader (Bio-Tek Instruments, USA). The EdU assay was performed using the EdU Cell Proliferation Assay Kit (C10310-1, RiboBio, China) strictly following the manufacture’s protocol. Briefly, HUVECs were seeded in 24-well plate at a density of 1.5×104 cells per well and incubated under standard condition with TE buffer or 50µg/mL Eu(OH)3 NCs for 72 h, then the cells were incubated with medium containing 50 µM EdU for 2 h, fixed in 4% paraformaldehyde, incubated with glycine, washed with PBS and permeabilized in 0.5% Triton X-100. Apollo 567 fluorescent dye was added to each well and incubated for 30 min at room temperature followed by PBS washing with 0.5% Triton X-100. Subsequently, the DNA contents of cells in each well were stained with Hoechst 33342 (5 µg/mL) for 30 min, and the proportion of cells incorporating EdU was determined by fluorescence microscope (Olympus IX71, Japan). For the clonogenic assay, HUVECs were seeded in 12-well plate at a density of 2×103 cells per well and incubated under standard condition with TE buffer or 50 µg/mL Eu(OH)3 NCs for two weeks, with refreshment of medium twice a week. Then the cells were fixed in 4% paraformaldehyde and stained with 0.1% crystal violet (A600331, Sangon Biotech. China).


7


Page 8 of 28

Reverse Transcription and Quantitative Real-Time PCR. The reverse transcription of the extracted total RNA was conducted by using a PrimeScript RT reagent kit (Takara Japan) on the Applied Biosystems 7500 Real-Time PCR System (Life Technologies, USA). Reverse transcription

primers:

miR-199a-3p,

GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTAACCAA; U6, CGCTTCACGAATTTGCGTGTCAT. miR-199a-3p levels were measured by quantitative real-time PCR (qRT-PCR) with the SYBR Green PCR Kit (Takara, Japan). The expression levels of miR-199a-3p were quantified by using SYBR Premix Ex Taq II (Tli RNaseH Plus) (Takara,

Japan).

Real-time

primers

sequences

were

as

follows:

(miR-199a-3p:

Forward:CGGGCACAGTAGTCTGCACA; Reverse:CAGTGCGTGTCGTGGAGT; pri-miR199a-3p:

Forward:

GTGGTTTCCTTGGCTGCTCAG,

CCAGGCCCTCGAATCTTCTAT;

internal

Forward:GCTTCGGCAGCACATATACTAAAAT;

control

Reverse: U6

RNA: Reverse:

CGCTTCACGAATTTGCGTGTCAT). All primers were synthesized from Sangon Biotech. (Shanghai, China). The 2-∆∆CT formula was used to calculate fold changes: ∆Ct=CtmiR-199a-3p-CtU6. Statistical Analysis. All of the data were expressed as Mean±S.D. and analyzed by two-tailed student’s t-tests. *p < 0.05, **p < 0.01 and ***p < 0.001 were considered statistically significant.

Results and discussion Synthesis and Characterization of Eu(OH)3 Nanoclusters Microwave-heating is an important method for organic chemistry29 and nanocrystals synthesis.30 Compared with conventional heating by oil bath and hydrothermal reactions in autoclave, microwave irradiation-assisted synthesis possesses the transparent advantages of time-saving and


8

Page 9 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


uniform heating process due to the direct coupling of microwave irradiation to both the precursor and solvent molecules. In addition, in the process of microwave irradiation-assisted synthesis, experimental parameters, such as power, pressure, temperature and heating rate, could be modified in a real-time manner. In our previous reports, we have successfully synthesized PVP coated MnO nanocrystals31 and Ni-Co alloy nanostructures32 in a single-mode microwave synthesis system (Discover, CEM Corp, USA) within short time. Thus, microwave-irradiation mediated synthesis is a promising way for the quick and large-amount synthesis of highperformance nanocrystals. Herein, with the introduction of dextran, uniform and stable Eu(OH)3 nanoclusters (NCs) modified by dextran were synthesized by microwave-accelerated hydrothermal reaction, and ultra-sonication was performed before and after microwave-assisted heating process to avoid aggregation. The crystal structure of determined by X-ray diffraction (XRD) pattern shown in Figure 1a indicated the as-synthesized product was hexagonal phase of europium(III) hydroxide (JCPDS Card No:17-0781), and two main characteristic (101) and (211) peaks were indexed. The morphology of the resultant product was further characterized by transmission electron microscopy (TEM). As shown in Figure 1b and 1c, representative nanoclusters composed of approximately 5 nm Eu(OH)3 nanoparticles were observed, which were similar with commercial dextran capped iron oxide nanocrystals. Microwave heating realized the fast nucleation and growth in a short period to avoid the formation of large particles.30,

33

Due to the ultrasmall size of nanoparticles, the XRD peaks were obviously

broadened. The synthetic procedure for dextran-coated Eu(OH)3 NCs herein involved the formation of the europium hydroxide core in the presence of dextran as both stabilizer and capping agent. The average hydrodynamic size of fresh prepared Eu(OH)3 NCs was about 80.2 nm from dynamic light scattering (DLS) data (Figure 1d), which was a little larger than the


9


Page 10 of 28

observed size in TEM images. Thermogravimetric analysis (TGA) was further used to determine the chemical composition of the as-synthesized Eu(OH)3 NCs (Figure S1). The decomposition of the as-synthesized sample was attributed to the desorption of water molecules, thermal decomposition process of dextran, and the conversion of Eu(OH)3 to EuOOH and final transformation to Eu2O3.34-35 The total weight loss of the NCs over the temperature range of 50800 oC is 48.6%, and the content of inorganic Eu(OH)3 is calculated to be 56.06%. X-ray photoelectron spectroscopy (XPS) measurement was performed to confirm the phase of dextrancoated Eu(OH)3 NCs (Figure S2). To investigate the advantages of using dextran, Eu(OH)3 nanocrystals without dextran were synthesized following the same experimental procedure (Figure S3 and S4). The leakage of free europium ion from Eu(OH)3 NCs in physiological conditions (10% FBS+DMEM) was quantitatively analyzed by ICP-AES, indicating no obvious leakage of free Eu ion after 72 h (Figure 1e). The haemolysis rate of Eu(OH)3 NCs was calculated to be 1.4%, which indicated the promising hemo-safety (Figure 1f). The surface dextran on the resultant Eu(OH)3 NCs ensured their excellent dispersibility. The stability of Eu(OH)3 NCs in physiological conditions was characterized in 10% FBS+DMEM as shown in Figure S5 and the hydrodynamic sizes of Eu(OH)3 NCs in different media were shown in Table S1.


10

Page 11 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Characterization of Eu(OH)3 NCs. (a) XRD pattern of as-synthesized Eu(OH)3 NCs. (b-c) Representative TEM images of Eu (OH)3 NCs with different magnifications. The inset is a digital photo of an aqueous dispersion of the Eu(OH)3 NCs (2 mg/mL). (d) The hydrodynamic size distribution of fresh prepared Eu(OH)3 NCs in DIW. (e) Analysis of the leaked free europium ion from Eu(OH)3 NCs in 10% FBS+DMEM. (f) The haemolysis rate of Eu(OH)3 NCs.

Biodistribution and Biocompatibility of Eu(OH)3 NCs in vivo. Biodistribution analysis showed that Eu(OH)3 NCs presented appreciable accumulation in the reticuloendothelial systems (RES) organs such as liver and spleen at 2 h post injection (Figure S6), as the results of phagocytose by the Kupffer cells and spleen macrophages in these two organs.36-37 Thus, to further confirm the safety of Eu(OH)3 NCs in vivo, histopathological analysis and study of blood biochemistry were conducted. Hematoxylin and eosin (H&E) staining confirmed that no obvious tissue damage or inflammation in these main organs was induced. Meanwhile, blood chemistry analysis showed that major hepatic and renal functional


11


Page 12 of 28

parameters of mice were within normal range, indicating no noticeable dysfunction induced by Eu(OH)3 NCs (Figure 2).

Figure 2. In vivo biocompatibility of Eu(OH)3 NCs. (a) Hematoxylin and eosin (H&E) stained pathological sections of main organs and (b) Blood chemistry analysis of mice after i.v. injection of Eu(OH)3 NCs (2mg/kg) after 7 days. The scale bars are 50 µm.

Pro-Proliferative Activity of Eu(OH)3 NCs and SmRNA-Sequencing. It is well-established that promoting endothelial cells proliferation and MAPK activation are the representative activities possessed by Eu(OH)3 nanomaterials.9 Thus, we initially verified the proliferative assay for HUVECs treated with as-prepared Eu(OH)3 NCs by referring to the concentration of 50 µg/mL Eu(OH)3 nanorods which were proven to be most effective for


12

Page 13 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


stimulating cell growth.9 These NCs presented a time-dependent increase in endothelial cell proliferation compared with treatment with TE buffer as vehicle control (Figure 3a). Meanwhile, the EdU assay showed that proliferation capacity of HUVECs with Eu(OH)3 NCs stimulation was significantly higher compared with TE buffer treatment (Figure 3b and 3c). Besides, the Eu(OH)3 NCs treated HUVECs could form significantly more colonies than the control group (Figure 3d). Later on, western blot analysis clearly showed that MAPK phosphorylation occurred in the presence of Eu(OH)3 NCs treatment (Figure 3e). Based on the previous evidence, we have confirmed the biological activities of Eu(OH)3 NCs, and then the miRNA profile of HUVECs treated with Eu(OH)3 NCs could be explored. Ever since, quantitative reverse-transcription polymerase chain reaction (qRT-PCR), Northern blotting and microarrays have been extensively used for miRNA abundance detection.38-39 Recently, with the high-throughput available data, high specificity and sensitivity, NGS technique has been gradually applied to profiling of small RNAs even with extremely low abundance.40-41 Meanwhile, considering the chromosomal locations of miRNAs are frequently between genes with their own transcriptional elements, which can make miRNAs regulation more promptly adapting to the extracelluar stimuli,12-13 we harvested the HUVECs treated with TE buffer or Eu(OH)3 NCs for 24 h and then conducted the NGS to obtain the altered expression profile of the miRNAs. As a result, 13,737,088 (out of 15,629,001 reads) and 12,044,517 sequencing reads (out of 13,737,133 reads) aligned to the human genome sequencing dataset were obtained, representing 334,910 (out of 512,542) and 368,220 (out of 588,552) unique tags of HUVECs treated with TE buffer or Eu(OH)3 NCs. (Figure 3f) Among which, 7,429 unique tags corresponding to 11,011,664 reads and 7,838 unique tags corresponding to 8,103,361 reads were matched to known miRNAs for TE buffer or Eu(OH)3 NCs-treated HUVECs, respectively (Figure 3g).


13


Page 14 of 28

Figure 3. Pro-proliferative activity of Eu(OH)3 NCs and genome mapping. (a) The cell number of HUVECs treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for indicated days was determined by cell counter. Mean ± S.D., n = 3, *p < 0.05, **p < 0.01 and ***p < 0.001, compared with the control of each group. (b) HUVECs treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 72 h and then were stained with EdU, the nuclei were visualized by Hoechst 33342 staining. (c) The ratio of EdU-positive cells to total Hoechst 33342-positive cells was presented as Mean ± S.D. from triplicate experiments, *p < 0.05, compared with the control group. (d) HUVECs were grown in culture medium containing TE buffer or 50 µg/ml Eu(OH)3 NCs for 2 weeks. Then cells in each well were fixed at the same time, stained and photographed. The scale bars are 200 µm for (b) and 1 cm for (d). (e) HUVECs were treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 24h, then the cell lysates were subjected to WB analysis with Phospho-ERK and ERK antibodies, GAPDH served as a loading control. Genome mapping and distribution of RNAs among different categories. (f) Total reads and (g) Unique tags aligned to the human genome sequence were annotated and classified as miRNA, RNA family (Rfam), Repeat, mRNA, piRNA, partial tags and reads were not annotated.


14

Page 15 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The rest of sequencing reads were matched into rRNAs, tRNAs, sRNAs, snRNAs, snoRNAs and other RNA types. In view of that rRNAs were essential for protein synthesis and several miRNAs were originated from the internal transcribed spacers of the rRNAs,42 it was reasonable that proliferative Eu(OH)3 NCs treatment led to more rRNAs production (Figure S7a). The majority of the sequencing clean reads were 22 nucleotides (nt) in size, consistently followed by 23-nt and 21-nt RNA fragments, which were within the typical size range of registered miRNAs (Figure 4a and 4b). Furthermore, the analysis of each unique tag on chromosome location indicated there was no difference of chromosome distributions between the TE buffer or Eu(OH)3 NCs-treated HUVECs, with chromosome 1 harboring most of the unique tags (Figure S7b and S7c). As stated above, the expression levels of target mRNAs can be regulated by relevant miRNAs, leading to a series of physiological or pathological alternations. Namely, the dysregulated expression of miRNAs are likely to elicit changes in cell states.18-19 Thus, it was of greatest importance to identify the altered expression profiles of miRNAs for exploring the potential roles of miRNAs in Eu(OH)3 NCs-promoted HUVECs proliferation. To assess the potentially distinct miRNA abundance after Eu(OH)3 NCs treatment, we used ‘volcano plot’, a useful visualization method that can display fold-change on X-axis and p-value on Y-axis simultaneously.43 As shown in Figure 4c, red points have both small p value2, which could be regarded as authentically dysregulated miRNAs. To eliminate the extremely low-abundance miRNAs, additional filtering was applied with a cut-off of less than average 5 reads count. Then we identified 371 miRNAs, consisting of 104 (28.03%) miRNAs that were upregulated and 267 (71.97%) that were downregulated in Eu(OH)3 NCs-treated HUVECs compared with control treatment (Figure 4c). A more stringent cut-off, eliminating


15


Page 16 of 28

those with less than 50 reads count in either sequenced sample, revealed 26 significantly dysregulated miRNAs in HUVECs after Eu(OH)3 NCs treatment (Figure 4d).

Figure 4. Length distribution of clean reads and deregulated miRNAs revealed by smRNA sequencing. Length distribution of clean reads from small RNA NGS of HUVECs treated with (a) TE buffer or (b) 50 µg/mL Eu(OH)3 NCs for 24h. Sequences with 21-24 nucleotides length occupied the majority part in the whole detected sequences. (c) The volcano plot generated by miRNAs profile in HUVECs treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 24h. The vertical and horizontal dashed lines corresponded to 2-fold up and down-regulation; and a p value of 0.05, respectively. The red points represented the significantly differentially expressed miRNAs. (d) The detailed dysregulated miRNAs with statistical significance after stringent cutoff of less than 50 reads count in each sequenced cells.

The Effects of miR-199a-3p-ZHX1 Axis on Pro-Proliferative Activity of Eu(OH)3 NCs


16

Page 17 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Among these potentially important miRNAs, the most significantly upregulated one was miR199a-3p, a miRNA located on chromosome 19p13.2 within intron 16 of the host gene DNM2 (Dynamin 2). miR-199a-3p was initially discovered from the sequences of mouse and Fugu rubripes, and subsequently identified from mouse skin cells and found to be highly expressed in hair follicles.44-45 Considering that hair follicle growth could be promoted by the angiogenic and pro-proliferative factors,46-48 the properties shared by Eu(OH)3 NCs (Figure 3a-d and Figure S8), we speculated that miR-199a-3p might play a role in the Eu(OH)3 NCs-elicited proliferation of HUVECs. To validate the upregulation of miR-199a-3p as profiled by NGS, qRT-PCR was performed on the HUVECs treated with TE buffer or Eu(OH)3 NCs. As shown in Figure 5a, MTT assay indicated the pro-proliferative activity of Eu(OH)3 NCs, meanwhile, the mature miR199a-3p and pri-miR-199a-3p expression levels were documented to be statistically higher after Eu(OH)3 NCs treatment than vehicle control group (Figure 5b and 5c), indicating Eu(OH)3 NCs indeed elicited the upregulated expression of miR-199a-3p. Subsequently, to demonstrate the role of miR-199a-3p in the cell cycle, HUVECs were transfected with miR-199a-3p inhibitors or scramble control RNAs and then treated with Eu(OH)3 NCs or TE buffer. Cell cycle assay showed that HUVECs treated with Eu(OH)3 NCs had shortened G1-phase cell cycles as compared with TE buffer treatment, which data were consistent with the aforementioned cell viability MTT assay. Notably, miR-199a-3p inhibitors transfected to HUVECs treated with Eu(OH)3 NCs had a significant increase in G1-phase population as compared with scramble control transfectants, indicating the G1-phase cell cycle arrest (Figure 5d). Besides of the cell cycle assay, cell counter assay was also introduced to obtain the similar results (Figure 5e). All these results strongly suggested that the elevated levels of miR-199a-3p after Eu(OH)3 NCs treatment should play a critical role in the rapid proliferation of HUVECs.


17


Page 18 of 28

Figure 5. The effects of miR-199a-3p on pro-proliferative activity of Eu(OH)3 NCs. (a) Cell proliferation of HUVECs treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 72h was determined by MTT assay. (b) mature miR-199a-3p and (c) pri-miR-199a-3p expression were evaluated by qRT-PCR analysis in HUVECs treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 24h. HUVECs were transfected with miR-199a-3p inhibitors or scramble inhibitors, 24h after transfection, cells were treated with TE buffer or 50 µg/mL Eu(OH)3 NCs (d) for another 72h to evaluate G1 phase and (e) for indicated days to determine cell number by cell counter. Mean± S.D., n = 3, *p < 0.05, **p < 0.01 and ***p < 0.001, compared with the control of each group.

Generally, a gene target could be regulated by several distinct miRNAs, meanwhile, a miRNA could target the 3’-UTRs of several mRNAs and negatively regulated the translation of them, depending on the cell types and different stages of the modulated biological processes.49-50 For instance, as a co-chaperone protein interacting with Hsc/Hsp70, CHIP could be directly targeted by miR-1178 in pancreatic cancer cells,51 while we also found CHIP was a downstream target of


18

Page 19 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


miR-21 in human umbilical cord blood-derived mesenchymal stem cells.52 A series of direct targets downstream of miR-199a-3p, including Smad4, MAP3K11, CD44, Caveolin-2 and zincfingers and homeoboxes-1 (ZHX1), have been revealed by bioinformatics analysis.53-55 ZHX1 consists of five homeodomains and two C2H2 zinc finger motifs, which could induce G1/S arrest and enhance apoptosis through activating Bax and cleaving caspase-3 while depressing Bcl-2.56 Of note, it has been also demonstrated in gastric cancer cells that 3’-UTR of ZHX1 could be targeted by miR-199a-3p for RNA degradation and subsequently promoted cell proliferation with suppressed apoptosis.54 Similarly, we found that HUVECs expressing ZHX1 shRNAs possessed an increased proliferation rate, verifying that knock-down of ZHX1 expression could exhibit the pro-proliferative activity (Figure 6a and 6b). Furthermore, to illustrate the function of miR-199a-3p-ZHX1 axis on HUVECs, we transiently transfected HUVECs with the miR-199a-3p mimics or scramble control for 36 h. As shown in Figure 6c, there was a significant decrease of ZHX1 expression in miR-199a-3p mimics group compared with scramble control transfectants. Intriguingly, HUVECs treated with Eu(OH)3 NCs for 72h also decreased the expression of ZHX1 (Figure 6d). To lend more direct evidences that Eu(OH)3 NCs could drive miR-199a-3p to target ZHX1 for modulating the proliferation, we firstly transfected HUVECs with miR-199a-3p inhibitors or scrambles and treated cells with Eu(OH)3 NCs or TE buffer for 72h, respectively. As a result, MTT assay again indicated the proproliferative activity of Eu(OH)3 NCs, and proved that miR-199a-3p inhibitors could attenuate this activity in promoting cell growth (Figure 6e). More importantly, the downregulated ZHX1 expression caused by Eu(OH)3 NCs treatment was found to be significantly restored after miR199a-3p inhibitors transfection (Figure 6f and 6g). These fascinating results strongly demonstrated that Eu(OH)3 NCs promoted HUVECs proliferation via inducing upregulated


19


Page 20 of 28

expression of miR-199a-3p which can directly target ZHX1. Furthermore, to evaluate whether the miR-199a-3p was specific to regulate Eu(OH)3 NCs-elicited pro-proliferation via ZHX1 inhibition, we have transfected HUVECs with mimics or inhibitors of miR-365a-3p, the upregulated miRNA second only to miR-199a-3p after Eu(OH)3 NCs treatment (Figure 4d) and was widely accepted to promote cell growth in several cancers.57-58 As shown in Figure S9a, miR-365a-3p mimics induced significantly increased cell proliferation, while miR-365a-3p inhibitors could decrease cell proliferation compared with control treatment. Importantly, we found there were no obvious protein level changes of ZHX1 after miR-365a-3p mimics or inhibitors transfection, indicating miR-365a-3p could not target ZHX1 for cell proliferation (Figure S9b). These results confirmed that miR-199a-3p-ZHX1 axis was specific in regulation of Eu(OH)3 NCs-elicited pro-proliferation.

Figure 6. Proliferation of HUVECs modulated by miR-199a-3p-ZHX1 axis. (a) Cell lysates of HUVECs expressing control shRNA and ZHX1 shRNAs were subjected to WB analysis with ZHX1 antibodies. (b) Cell proliferation of HUVECs expressing control shRNA and ZHX1 shRNAs was determined by MTT assay for 72 h. c-d) HUVECs were transfected with scramble


20

Page 21 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mimics or miR-199a-3p mimics for 36h (c) or treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 72h (d), and then the cell were subjected to WB analysis with ZHX1 antibodies. (e-g) HUVECs with and without miR-199a-3p inhibitors or scramble inhibitors transfection were treated with TE buffer or 50 µg/mL Eu(OH)3 NCs for 72h. (e) MTT assay was performed to measure the relative cell viability, (f) the cell lysates were subjected to WB analysis with ZHX1 antibodies, and (g) protein levels were quantified by densitometric analysis relative to GAPDH. In all the WB analyses, GAPDH served as a loading control. Mean ± S.D., n = 3, *p < 0.05 and **p < 0.01, compared with the control of each group.

Conclusions In summary, we have synthesized the biocompatible Eu(OH)3 NCs with a modified microwave-assisted hydrothermal method. Giving that the NCs could activate MAPK and possessed the pro-proliferative activity in HUVECs, a recently developed high-throughput technology named NGS was introduced to screen the dysregulated miRNAs, which may play crucial roles in Eu(OH)3 NCs-mediated cell growth promotion. Among the potentially functional miRNAs in regulating cell proliferation, miR-199a-3p was identified by bioinformatics analysis and confirmed to be a participant in the pro-proliferative activity of Eu(OH)3 NCs by directly targeting ZHX1. Our current findings could be beneficial to design effective therapeutic strategy for ischemic diseases and promote tissue regeneration, which may be facilitated by Eu(OH)3 NCs administration and miR-199a-3p-ZHX1 axis regulation. Given that enormous progresses based on bioresponsive and immunomodulatory nanomaterials have been achieved in diagnosis and therapy of various diseases,59-63 the approach reported herein for exploring the modulators in the cellular and molecular behaviors of Eu(OH)3 NCs can be potentially applied towards other biofunctional nanomaterials or even nanodrugs.


21


Page 22 of 28

Supporting Information. Additional Materials

and Methods; thermogravimetric analysis;

X-ray photoelectron

spectroscopy; comparison with Eu(OH)3 NRs; hydrodynamic size in different media; Biodistribution in vivo; the proportion of Rfam and chromosome locations of sequencing tags and pro-angiogenic activity analysis

Acknowledgments This work was supported by the National Natural Science Foundation of China (No. 31430028; No. 81630019; No. 81401518; No. 51572067; No. 21501039; No. 81601600; No. 51702309), the China Postdoctoral Science Foundation (No. 2016M590576; No. 2017T100455), Anhui Provincial Institutes for Translational Medicine (No. 2017ZHYX02), Cultivation Project of Young Top-Notch Talent Support from Anhui Medical University (AHMU), Sci-Tech Funding Support from AHMU (No. 2015XKJ092), Funding for Distinguished Young Scientists of the First Affiliated Hospital of AHMU), and the Fundamental Research Funds for the Central Universities (JZ2018HGPA0269).

References (1)

Shu, J.; Tang, D., Current Advances in Quantum-Dots-Based Photoelectrochemical Immunoassays. Chem-

Asian J. 2017, 12, 2780-2789. (2)

Lv, S.; Zhang, K.; Zeng, Y.; Tang, D., Double Photosystems-Based 'Z-Scheme' Photoelectrochemical

Sensing Mode for Ultrasensitive Detection of Disease Biomarker Accompanying Three-Dimensional DNA Walker. Anal. Chem. 2018, 90, 7086-7093. (3)

Dong, Z.; Feng, L.; Hao, Y.; Chen, M.; Gao, M.; Chao, Y.; Zhao, H.; Zhu, W.; Liu, J.; Liang, C.; Zhang,

Q.; Liu, Z., Synthesis of Hollow Biomineralized CaCO3-Polydopamine Nanoparticles for Multimodal ImagingGuided Cancer Photodynamic Therapy with Reduced Skin Photosensitivity. J. Am. Chem. Soc. 2018, 140, 21652178.


22

Page 23 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(4)

Zhao, R.; Han, X.; Li, Y.; Wang, H.; Ji, T.; Zhao, Y.; Nie, G., Photothermal Effect Enhanced Cascade

Targeting Strategy for Improved Pancreatic Cancer Therapy by Gold Nanoshell@Mesoporous Silica Nanorod. ACS Nano 2017, 11, 8103-8113. (5)

Liu, J. N.; Bu, W. B.; Shi, J. L., Chemical design and synthesis of functionalized probes for imaging and

treating tumor hypoxia. Chem. Rev. 2017, 117, 6160-6224. (6)

Wei, H.; Wang, E., Nanomaterials with enzyme-like characteristics (nanozymes): next-generation artificial

enzymes. Chem. Soc. Rev. 2013, 42, 6060-6093. (7)

Lin, Y.; Ren, J.; Qu, X., Catalytically active nanomaterials: a promising candidate for artificial enzymes.

Acc. Chem. Res. 2014, 47, 1097-1105. (8)

Gao, L. Z.; Zhuang, J.; Nie, L.; Zhang, J. B.; Zhang, Y.; Gu, N.; Wang, T. H.; Feng, J.; Yang, D. L.;

Perrett, S.; Yan, X., Intrinsic peroxidase-like activity of ferromagnetic nanoparticles. Nat. Nanotechnol. 2007, 2, 577-583. (9)

Patra, C. R.; Bhattacharya, R.; Patra, S.; Vlahakis, N. E.; Gabashvili, A.; Koltypin, Y.; Gedanken, A.;

Mukherjee, P.; Mukhopadhyay, D., Pro-angiogenic properties of europium(III) hydroxide nanorods. Adv. Mater. 2008, 20, 753-756. (10)

Das, S.; Singh, S.; Dowding, J. M.; Oommen, S.; Kumar, A.; Sayle, T. X. T.; Saraf, S.; Patra, C. R.;

Vlahakis, N. E.; Sayle, D. C.; Self, W. T.; Seal, S., The induction of angiogenesis by cerium oxide nanoparticles through the modulation of oxygen in intracellular environments. Biomaterials 2012, 33, 7746-7755. (11)

Patra, C. R.; Kim, J.-H.; Pramanik, K.; d'Uscio, L. V.; Patra, S.; Pal, K.; Ramchandran, R.; Strano, M. S.;

Mukhopadhyay, D., Reactive oxygen species driven angiogenesis by inorganic nanorods. Nano Lett. 2011, 11, 49324938. (12)

Dong, H.; Lei, J.; Ding, L.; Wen, Y.; Ju, H.; Zhang, X., MicroRNA: function, detection, and bioanalysis.

Chem. Rev. 2013, 113, 6207-6233. (13)

Duan, R.; Zhang, Z.; Zheng, F.; Wang, L.; Guo, J.; Zhang, T.; Dai, X.; Zhang, S.; Yang, D.; Kuang, R.;

Wang, G.; He, C.; Hakeem, A.; Shu, C.; Yin, P.; Lou, X.; Zeng, F.; Liang, H.; Xia, F., Combining Protein and miRNA Quantification for Bladder Cancer Analysis. ACS Appl. Mater. Interfaces 2017, 9, 23420-23427. (14)

Krzeszinski, J. Y.; Wei, W.; Huynh, H.; Jin, Z. X.; Wang, X. D.; Chang, T. C.; Xie, X. J.; He, L.; Mangala,

L. S.; Lopez-Berestein, G.; Sood, A. K.; Mendell, J. T.; Wan, Y. H., miR-34a blocks osteoporosis and bone metastasis by inhibiting osteoclastogenesis and Tgif2. Nature 2014, 512, 431-435. (15)

Wu, M.-Z.; Cheng, W.-C.; Chen, S.-F.; Nieh, S.; O'Connor, C.; Liu, C.-L.; Tsai, W.-W.; Wu, C.-J.; Martin,

L.; Lin, Y.-S.; Wu, K.-J.; Lu, L.-F.; Belmonte, J. C. I., miR-25/93 mediates hypoxia-induced immunosuppression by repressing cGAS. Nat. Cell Biol. 2017, 19, 1286-1296. (16)

Piwecka, M.; Glazar, P.; Hernandez-Miranda, L. R.; Memczak, S.; Wolf, S. A.; Rybak-Wolf, A.; Filipchyk,

A.; Klironomos, F.; Jara, C. A. C.; Fenske, P.; Trimbuch, T.; Zywitza, V.; Plass, M.; Schreyer, L.; Ayoub, S.; Kocks, C.; Kuhn, R.; Rosenmund, C.; Birchmeier, C.; Rajewsky, N., Loss of a mammalian circular RNA locus causes miRNA deregulation and affects brain function. Science 2017, 357, 1254.


23


(17)

Page 24 of 28

Lim, D.; Byun, W. G.; Koo, J. Y.; Park, H.; Park, S. B., Discovery of a small-molecule inhibitor of protein-

microRNA interaction using binding assay with a site-specifically labeled Lin28. J. Am. Chem. Soc. 2016, 138, 13630-13638. (18)

Li, S.; Wang, Y.; Wang, H.; Bai, Y.; Liang, G.; Wang, Y.; Huang, N.; Xiao, Z., MicroRNAs as participants

in cytotoxicity of CdTe quantum dots in NIH/3T3 cells. Biomaterials 2011, 32, 3807-3814. (19)

Li, S.; Wang, H.; Qi, Y.; Tu, J.; Bai, Y.; Tian, T.; Huang, N.; Wang, Y.; Xiong, F.; Lu, Z.; Xiao, Z.,

Assessment of nanomaterial cytotoxicity with SOLiD sequencing-based microRNA expression profiling. Biomaterials 2011, 32, 9021-9030. (20)

Laurent, S.; Forge, D.; Port, M.; Roch, A.; Robic, C.; Elst, L. V.; Muller, R. N., Magnetic iron oxide

nanoparticles: synthesis, stabilization, vectorization, physicochemical characterizations, and biological applications. Chem. Rev. 2008, 108, 2064-2110. (21)

Chen, G. Y.; Roy, I.; Yang, C. H.; Prasad, P. N., Nanochemistry and nanomedicine for nanoparticle-based

diagnostics and therapy. Chem. Rev. 2016, 116, 2826-2885. (22)

Li, F. Y.; Lu, J. X.; Kong, X. Q.; Hyeon, T.; Ling, D. S., Dynamic nanoparticle assemblies for biomedical

applications. Adv. Mater. 2017, 29, 1605897. (23)

Ling, D. S.; Hackett, M. J.; Hyeon, T., Surface ligands in synthesis, modification, assembly and biomedical

applications of nanoparticles. Nano Today 2014, 9, 457-477. (24)

Arami, H.; Khandhar, A.; Liggitt, D.; Krishnan, K. M., In vivo delivery, pharmacokinetics, biodistribution

and toxicity of iron oxide nanoparticles. Chem. Soc. Rev. 2015, 44, 8576-8607. (25)

Swierczewska, M.; Han, H. S.; Kim, K.; Park, J. H.; Lee, S., Polysaccharide-based nanoparticles for

theranostic nanomedicine. Adv. Drug Deliv. Rev. 2016, 99, 70-84. (26)

Tassa, C.; Shaw, S. Y.; Weissleder, R., Dextran-coated iron oxide nanoparticles: a versatile platform for

targeted molecular imaging, molecular diagnostics, and therapy. Acc. Chem. Res. 2011, 44, 842-852. (27)

Lee, N.; Yoo, D.; Ling, D.; Cho, M. H.; Hyeon, T.; Cheon, J., Iron oxide based nanoparticles for

multimodal imaging and magnetoresponsive therapy. Chem. Rev. 2015, 115, 10637-10689. (28)

Wei, P. F.; Zhang, L.; Nethi, S. K.; Barui, A. K.; Lin, J.; Zhou, W.; Shen, Y.; Man, N.; Zhang, Y. J.; Xu, J.;

Patra, C. R.; Wen, L. P., Accelerating the clearance of mutant huntingtin protein aggregates through autophagy induction by europium hydroxide nanorods. Biomaterials 2014, 35, 899-907. (29)

Mehtaa, V. P.; Van der Eycken, E. V., Microwave-assisted C-C bond forming cross-coupling reactions: an

overview. Chem. Soc. Rev. 2011, 40, 4925-4936. (30)

Baghbanzadeh, M.; Carbone, L.; Cozzoli, P. D.; Kappe, C. O., Microwave-assisted synthesis of colloidal

inorganic nanocrystals. Angew. Chem. Int. Ed. 2011, 50, 11312-11359. (31)

Lu, Y.; Zhang, L.; Li, J.; Su, Y.-D.; Liu, Y.; Xu, Y.-J.; Dong, L.; Gao, H.-L.; Lin, J.; Man, N.; Wei, P.-F.;

Xu, W.-P.; Yu, S.-H.; Wen, L.-P., MnO Nanocrystals: A Platform for Integration of MRI and Genuine Autophagy Induction for Chemotherapy. Adv. Funct. Mater. 2013, 23, 1534-1546.


24

Page 25 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(32)

Dong, L.; Liu, Y.; Lu, Y.; Zhang, L.; Man, N.; Cao, L.; Ma, K.; An, D.; Lin, J.; Xu, Y.-J.; Xu, W.-P.; Wu,

W.-B.; Yu, S.-H.; Wen, L.-P., Tuning Magnetic Property and Autophagic Response for Self-Assembled Ni-Co Alloy Nanocrystals. Adv. Funct. Mater. 2013, 23, 5930-5940. (33)

Zhu, Y. J.; Chen, F., Microwave-assisted preparation of inorganic nanostructures in liquid phase. Chem.

Rev. 2014, 114, 6462-6555. (34)

Pol, V.; Palchik, O.; Gedanken, A.; Felner, I., Synthesis of europium oxide nanorods by ultrasound

irradiation. J. Phys. Chem. B 2002, 106, 9737-9743. (35)

Pumera, M.; Cabala, M.; Veltruska, K.; Ichinose, I.; Tang, J., Nanoprecise spontaneous coating of carbon

nanotubes with a europium hydroxide layer. Chem. Mater. 2007, 19, 6513-6517. (36)

Yu, J.; Yin, W. Y.; Peng, T.; Chang, Y. N.; Zu, Y.; Li, J.; He, X.; Ma, X. Y.; Gu, Z. J.; Zhao, Y. L.,

Biodistribution, excretion, and toxicity of polyethyleneimine modified NaYF4: Yb, Er upconversion nanoparticles in mice via different administration routes. Nanoscale 2017, 9, 4497-4507. (37)

Hao, J.; Song, G.; Liu, T.; Yi, X.; Yang, K.; Cheng, L.; Liu, Z., In Vivo Long-Term Biodistribution,

Excretion, and Toxicology of PEGylated Transition-Metal Dichalcogenides MS2 (M = Mo, W, Ti) Nanosheets. Adv. Sci. 2017, 4, 1600160. (38)

Git, A.; Dvinge, H.; Salmon-Divon, M.; Osborne, M.; Kutter, C.; Hadfield, J.; Bertone, P.; Caldas, C.,

Systematic comparison of microarray profiling, real-time PCR, and next-generation sequencing technologies for measuring differential microRNA expression. Rna-a Publication of the Rna Society 2010, 16, 991-1006. (39)

Matsuura, K.; De Giorgi, V.; Schechterly, C.; Wang, R. Y.; Farci, P.; Tanaka, Y.; Alter, H. J., Circulating

let-7 levels in plasma and extracellular vesicles correlate with hepatic fibrosis progression in chronic hepatitis C. Hepatology 2016, 64, 732-745. (40)

t Hoen, P. A. C.; Friedlander, M. R.; Almlof, J.; Sammeth, M.; Pulyakhina, I.; Anvar, S. Y.; Laros, J. F. J.;

Buermans, H. P. J.; Karlberg, O.; Brannvall, M.; den Dunnen, J. T.; van Ommen, G. J. B.; Gut, I. G.; Guigo, R.; Estivill, X.; Syvanen, A. C.; Dermitzakis, E. T.; Lappalainen, T.; Consortium, G., Reproducibility of highthroughput mRNA and small RNA sequencing across laboratories. Nat. Biotechnol. 2013, 31, 1015-1022. (41)

Wen, J. Y.; Mohammed, J.; Bortolamiol-Becet, D.; Tsai, H.; Robine, N.; Westholm, J. O.; Ladewig, E.;

Dai, Q.; Okamura, K.; Flynt, A. S.; Zhang, D. Y.; Andrews, J.; Cherbas, L.; Kaufman, T. C.; Cherbas, P.; Siepel, A.; Lai, E. C., Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines. Genome Res. 2014, 24, 1236-1250. (42)

Son, D. J.; Kumar, S.; Takabe, W.; Kim, C. W.; Ni, C. W.; Alberts-Grill, N.; Jang, I. H.; Kim, S.; Kim, W.;

Kang, S. W.; Baker, A. H.; Seo, J. W.; Ferrara, K. W.; Jo, H., The atypical mechanosensitive microRNA-712 derived from pre-ribosomal RNA induces endothelial inflammation and atherosclerosis. Nat. Commun. 2013, 4, 15. (43)

Westermann, A. J.; Foerstner, K. U.; Amman, F.; Barquist, L.; Chao, Y.; Schulte, L. N.; Mueller, L.;

Reinhardt, R.; Stadler, P. F.; Vogel, J., Dual RNA-seq unveils noncoding RNA functions in host-pathogen interactions. Nature 2016, 529, 496-501. (44)

Lim, L. P.; Lau, N. C.; Weinstein, E. G.; Abdelhakim, A.; Yekta, S.; Rhoades, M. W.; Burge, C. B.; Bartel,

D. P., The microRNAs of caenorhabditis elegans. Gene. Dev. 2003, 17, 991-1008.


25


(45)

Page 26 of 28

Yi, R.; O'Carroll, D.; Pasolli, H. A.; Zhang, Z. H.; Dietrich, F. S.; Tarakhovsky, A.; Fuchs, E.,

Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs. Nat. Genet. 2006, 38, 356-362. (46)

Takahashi, T.; Kamiya, T.; Hasegawa, A.; Yokoo, Y., Procyanidin oligomers selectively and intensively

promote proliferation of mouse hair epithelial cells in vitro and activate hair follicle growth in vivo. J. Invest. Dermatol. 1999, 112, 310-316. (47)

Zen, A. A. H.; Nawrot, D. A.; Howarth, A.; Caporali, A.; Ebner, D.; Vernet, A.; Schneider, J. E.;

Bhattacharya, S., The retinoid agonist tazarotene promotes angiogenesis and wound healing. Mol. Ther. 2016, 24, 1745-1759. (48)

Cheng, H.; Zhang, J.; Li, J.; Jia, M.; Wang, Y.; Shen, H., Platelet-rich plasma stimulates angiogenesis in

mice which may promote hair growth. Eur. J. Med. Res. 2017, 22, 39. (49)

Lewis, B. P.; Burge, C. B.; Bartel, D. P., Conserved seed pairing, often flanked by adenosines, indicates

that thousands of human genes are microRNA targets. Cell 2005, 120, 15-20. (50)

Miranda, K. C.; Huynh, T.; Tay, Y.; Ang, Y.-S.; Tam, W.-L.; Thomson, A. M.; Lim, B.; Rigoutsos, I., A

pattern-based method for the identification of microRNA binding sites and their corresponding heteroduplexes. Cell 2006, 126, 1203-1217. (51)

Cao, Z.; Xu, J.; Huang, H.; Shen, P.; You, L.; Zhou, L.; Zheng, L.; Zhang, T.; Zhao, Y., MiR-1178

promotes the proliferation, G1/S transition, migration and invasion of pancreatic cancer cells by targeting CHIP. PLoS ONE 2015, 10, e0116934 (52)

Zhou, Y.; Zhu, Y.; Zhang, L.; Wu, T.; Wu, T.; Zhang, W.; Decker, A. M.; He, J.; Liu, J.; Wu, Y.; Jiang, X.;

Zhang, Z.; Liang, C.; Zou, D., Human stem cells overexpressing miR-21 promote angiogenesis in critical limb ischemia by targeting CHIP to enhance HIF-1 activity. Stem Cells 2016, 34, 924-934. (53)

Zhang, Y.; Fan, K.-J.; Sun, Q.; Chen, A.-Z.; Shen, W.-L.; Zhao, Z.-H.; Zheng, X.-F.; Yang, X., Functional

screening for miRNAs targeting Smad4 identified miR-199a as a negative regulator of TGF-beta signalling pathway. Nucleic Acids Res. 2012, 40, 9286-9297. (54)

Wang, Z.; Ma, X.; Cai, Q.; Wang, X.; Yu, B.; Cai, Q.; Liu, B.; Zhu, Z.; Li, C., MiR-199a-3p promotes

gastric cancer progression by targeting ZHX1. Febs Lett. 2014, 588, 4504-4512. (55)

Shatseva, T.; Lee, D. Y.; Deng, Z.; Yang, B. B., MicroRNA miR-199a-3p regulates cell proliferation and

survival by targeting caveolin-2. J. Cell Sci. 2011, 124, 2826-2836. (56)

Ma, X.; Huang, M.; Wang, Z.; Liu, B.; Zhu, Z.; Li, C., ZHX1 inhibits gastric cancer cell growth through

inducing cell-cycle arrest and apoptosis. J. Cancer 2016, 7, 60-68. (57)

Zhang, C. Z.; Chen, S.-L.; Wang, C.-H.; He, Y.-F.; Yang, X.; Xie, D.; Yun, J.-P., CBX8 Exhibits

Oncogenic Activity via AKT/beta-Catenin Activation in Hepatocellular Carcinoma. Cancer Res. 2018, 78, 51-63. (58)

Wang, Y.; Zhang, S.; Bao, H.; Mu, S.; Zhang, B.; Ma, H.; Ma, S., MicroRNA-365 promotes lung

carcinogenesis by downregulating the USP33/SLIT2/ROBO1 signalling pathway. Cancer Cell Int. 2018, 18. (59)

Zhang, Y.; Cui, Z.; Kong, H.; Xia, K.; Pan, L.; Li, J.; Sun, Y.; Shi, J.; Wang, L.; Zhu, Y.; Fan, C., One-Shot

Immunomodulatory Nanodiamond Agents for Cancer Immunotherapy. Adv. Mater. 2016, 28, 2699-2708.


26

Page 27 of 28 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(60)

Qiu, Z.; Shu, J.; Tang, D., Bioresponsive Release System for Visual Fluorescence Detection of

Carcinoembryonic Antigen from Mesoporous Silica Nanocontainers Mediated Optical Color on Quantum DotEnzyme-Impregnated Paper. Anal. Chem. 2017, 89, 5152-5160. (61)

Lv, S.; Li, Y.; Zhang, K.; Lin, Z.; Tang, D., Carbon Dots/g-C3N4 Nanoheterostructures-Based Signal-

Generation Tags for Photoelectrochemical Immunoassay of Cancer Biomarkers Coupling with Copper Nanoclusters. ACS Appl. Mater. Interfaces 2017, 9, 38336-38343. (62)

Qiu, Z.; Shu, J.; Tang, D., Near-Infrared-to-Ultraviolet Light-Mediated Photoelectrochemical Aptasensing

Platform for Cancer Biomarker Based on Core Shell NaYF4:Yb,Tm@TiO2 Upconversion Microrods. Anal. Chem. 2018, 90, 1021-1028. (63)

You, L.; Wang, J.; Liu, T.; Zhang, Y.; Han, X.; Wang, T.; Guo, S.; Dong, T.; Xu, J.; Anderson, G. J.; Liu,

Q.; Chang, Y.-Z.; Lou, X.; Nie, G., Targeted Brain Delivery of Rabies Virus Glycoprotein 29-Modified Deferoxamine-Loaded Nanoparticles Reverses Functional Deficits in Parkinsonian Mice. ACS Nano 2018, 12, 41234139.


27


Page 28 of 28

Table of Contents/Abstract Graphic


28

Microwave-Assisted Facile Synthesis of Eu(OH)3 Nanoclusters with

Recommend Documents