Mirror-Image Thymidine Discriminates against ... - ACS Publications

Subscriber access provided by UNIVERSITY OF CONNECTICUT

Article

Mirror-image Thymidine Discriminates against Incorporation of dNTP into DNA and Repairs Itself by DNA Polymerases Yating Xiao, Qingju Liu, XinJing Tang, Zhenjun Yang, Li Wu, and Yujian He Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00301 • Publication Date (Web): 07 Jul 2017 Downloaded from http://pubs.acs.org on July 9, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Figure 1 62x35mm (300 x 300 DPI)

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60



Page 2 of 37

Page 3 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60





1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4 140x90mm (300 x 300 DPI)


Page 4 of 37

Page 5 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60





1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6 150x124mm (300 x 300 DPI)


Page 6 of 37

Page 7 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC 26x20mm (300 x 300 DPI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 37

Mirror-image Thymidine Discriminates against Incorporation of dNTP into DNA and Repairs Itself by DNA Polymerases Yating Xiao,†,§ Qingju Liu,†,§ Xinjing Tang,‡ Zhenjun Yang,‡ Li Wu *,†,‡ and Yujian He*,†,‡ †School of Chemistry and Chemical Engineering, University of Chinese Academy of Sciences, Beijing 100049, China ‡State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Peking University, Beijing 100191, China KEYWORDS: L-Thymidine, DNA polymerase, primer extension, mismatch, repair ABSTRACT DNA polymerases are known to recognize preferably D-nucleotides over L-nucleotides during DNA synthesis. Here, we report that several general DNA polymerases catalyse polymerization reactions of nucleotides directed by the DNA template containing an L-thymidine (L-T). The results display that 5’-3’ primer extension of natural nucleotides get to the end at chiral modification site with Taq and Phanta Max DNA polymerases, but the primer extension proceeds to the end of the template catalyzed by Deep Vent (exo-), Vent (exo-) and Therminator DNA polymerases. Furthermore, templating

L-nucleoside

displays a lag in the dNTP

incorporation rates relative to natural template by kinetics analysis and polymerase chain


1

Page 9 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


reactions were inhibited with the DNA template containing two or three consecutive L-Ts. Most interestingly, no single base mutation or mismatch mixture corresponding to the location of L-T in the template was found, which is physiologically significant since they provide a theoretical basis on the involvement of DNA polymerase in the effective repair of L-T that may lead to cytotoxicity. INTRODUCTION The origin of homochirality in life on the earth is still a puzzle. Any abiotic synthesis of a nucleotide would yield equal amounts of the D- and L- isomers, while the nucleic acids which construct living bodies are only composed of D-nucleotides.1, 2 Therefore, D-stereochemistry is essential for the formation of higher-order structures and the biological functions of nucleic acid. In general, the unnatural L-nucleosides or L-nucleotides are not recognized by natural enzymes with D-stereoselectivity. It’s acknowledged that L-nucleoside analogs have been used as antiviral drugs.3 Lamivudine and telbivudine are approved drugs, whereas emtricitabine is currently in clinical trials for this purpose.4 However, it’s reported that the three L-nucleotide drugs (lamivudine, emtricitabine and telbivudine) have clinical side effects and some of them are likely associated with the inhibition of human DNA polymerases.5 Owing to its strong Dstereoselectivity, DNA polymerase preferentially binds and incorporates D-dNTPs over unnatural nucleotides with L-stereochemistry (L-dNTPs) during DNA synthesis. Whereas, it’s reported that non-physiological nucleotide analogs can be incorporated by many DNA polymerases, it is possible for a polymerase to relax its D-stereoselectivity to bind and incorporate L-dNTPs or their analogs.5 Once incorporated, with the tautomeric equilibrium reestablished, L-nucleoside might hinder or block entirely the biological function of the nucleic acid. In another, more whimsical form, L-nucleoside might be found as precipitating factor of oligonucleotide conformational


2


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 37

disease similar to protein conformational diseases such as Bovine encephalopathy BSE.6 Thus, we wonder what happens to the mirror-image molecular system containing L-thymidine during their replication and transcription, and whether it would bring about deleterious effects during evolution of functional nucleic acid. Early in the development of non-enzymatic template-directed polymerization, the effect of Ldeoxycytidine (L-dC) on the nonenzymatic oligomerization of guanosine 5’-phosphoro-2’methylimidazole from a poly(D-deoxycytidine, D-C) template had been studied in some detail.7-10 Results demonstrated even if a ‘predominately D-metabolism’ existed, a small proportion of Lmonomers in the template would not lead to the termination of replication.9 Previous work in this area has been limited by the absence of polymerases that could be used to study alternative chemistries of life. As this paradigm is now changing, the possibility that enantiomeric nucleic acid could be replicated as a genetic system has also been examined to exhibit the characteristic signature of heredity and evolution.11, 12 Most focus was on the incorporation of enantiomeric nucleoside 3’-triphosphates as substrate into DNA by DNA polymerase

13-17

and the

representative work were achieved by Szostak and Herdewijn’s group 18-20, Zhang’s group 21 and Suo’s group.22,

23

For example, Szostak and Herdewijn examined incorporation of α-L-

threofuranosyl nucleoside 3’-triphosphates (tNTPs) into DNA duplexes by DNA polymerases, although the chemical structure of tNTPs is rather different from that of the natural 2’ deoxyribonucleoside 5’-triphosphates (dNTPs).18 Zhang et al found that the L-isomers of 2’deoxy-2’-isoadenosine 5’-triphosphate (iATP) can be incorporated into DNA chain by Vent (exo-) and Deep Vent (exo-) DNA polymerases.21 On the basis, Matsuda et al investigated the synthesis of 2’-deoxy-2’-isonucleoside 5’-triphosphates (iNTPs) having the four natural nucleobases and their incorporation into primer-template duplexes with different recognition


3

Page 11 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mechanisms.24 Recently, Suo et al established a structural basis for the discrimination against LdNTPs by DNA polymerases or reverse transcriptases based on several high-resolution ternary crystal structures of a prototype Y-family DNA polymerase, DNA, and D-dCTP, D-dCDP, LdCDP, or the diphosphates and triphosphates of lamivudine and emtricitabine. The data indicate that L-dCTP and its two analogs, like D-dCTP, formed Watson-Crick base pairing with the templating base dG and interacted with the active site residues.23 Here, we used

L-thymidine

as model for examining enantiomeric effect of templating

nucleoside on incorporating nucleoside triphosphate opposite

L-T

in the template. We

synthesized several oligonucleotide templates containing L-T at special site by phosphoramidite method 25, screened different types of conventional DNA polymerases such as Taq, Vent (exo-), Deep Vent (exo-), Therminator and Phanta Max DNA polymerases for polymerization reactions and investigated incorporation rate of nucleotides opposite L-T in the template. Additionally, we set out to measure the base-pairing fidelity of L-T by sequencing the primer-extension products directed by DNA templates containing L-T. Thus, our experiments on primer-extension directed by L-T-contained template revealed not only the polymerase bypass problem but also the DNA replication fidelity. Also, kinetic analysis of the rates and determination of fidelity of nucleotide incorporation would be useful in understanding the requirements for homochiral D-nucleosides rather than L-nucleosides as building blocks during in vitro DNA replication. RESULTS AND DISCUSSION Primer-extension reactions by using various DNA polymerases. For our first attempt at the polymerase reaction, we used 5’-FAM-labeled 17-mer DNA primer (P-17) and 25-mer DNA template (T-25) for the in vitro DNA replication system (Figure 1a). L-T was placed in the DNA template and at the first elongation position of primer. We selected five different kinds of DNA


4


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 37

Figure 1. (a) Sequences for 17-mer primer and template containing L-thymidine at the first elongation position of the primer. ‘TL’ represents L-thymidine (L-T). (b) Primerextension experiments. A 25 µL of preincubated solution of 0.8 µM 17-mer-primer/25mer-template and 0.04 U/µL enzyme were mixed with a solution of four dNTPs (0.4 mM each) and incubated at 55oC for 1.5 h. Each enzyme added is indicated on the top of its corresponding lane, and their bands in the odd lanes and the even lanes indicate 25-mer natural template and T-25, respectively. polymerases for screening to elongate P-17 from T-25 in the presence of all four dNTPs. If the polymerase is able to extend the primer to the end of the DNA template, it will produce a fulllength product that is extended by 25-mer DNA template. However, if the polymerase is unable to read through the L-T residue, it will produce a truncated product that is easily detected by denaturing PAGE. Analysis of the resulting primer-extension assay products is shown in Figure 1 and Figure S1S5. As a negative control, P-17 was hybridized to the 25-mer natural template or the modified template and incubated without any enzyme. Incubation products took on bands at the same position as the position of only 17-mer primer (Figure 1, lanes 1-4). As a positive control, P-17 was hybridized to the 25-mer natural DNA template and incubated with each enzyme, primer


5

Page 13 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


extended to the end of the DNA template (Figure 1, lanes 5, 7, 9, 11 and 13). However, with Taq DNA polymerase, a typical A-family DNA polymerase, P-17 terminated opposite L-T in the T-25 (Figure 1, lane 6). Furthermore, the polymerase was unable to read through L-T in the template by optimizing polymerization reaction conditions (Figure S1). Likewise, Phanta Max DNA polymerase was not suitable for incorporation of dNTPs into the primer directed by the L-Tcontained template (lane 8 in Figure 1, and Figure S2). In contrast, Vent (exo-), Deep Vent (exo-) and Therminator DNA polymerases, as representatives of B-family DNA polymerase, were able to incorporate nucleotides opposite L-T and elongate the primer to the end of T-25 (Figure 1, lanes 10, 12 and 14). Among them, Therminator has been shown to be more effective DNA polymerase for the incorporation of nucleotides than Deep Vent (exo-) and Vent (exo-) DNA polymerases because primer-extension reactions generate the 25-nt-long DNA sequence in about 100% yield (Figures S3-S5). Consecutive L-Ts block primer-extension reactions by DNA polymerases. We designed further primer-extension reactions using 5’-FAM-labeled 24-mer DNA primer (P-24) and 51-mer DNA templates containing 0-3 consecutive L-T residues in the central region. The natural template and the template that contains one L-T at the N+3 position from the 3’-end of the primer were designated to be T0 and T1, respectively (Figure 2a). Sequences for consecutive two L-Ts inserted N+2 and N+3 positions, and consecutive three L-Ts inserted N+1, N+2 and N+3 positions, were designated to be T2 and T3, respectively, as shown in Figure 2a. Therminator and Deep Vent (exo-) DNA polymerases were examined to copy T1, T2, T3 and the corresponding natural DNA template (T0). Similar to T-25, primer extension directed by T1 containing a single L-T, when catalyzed by either DNA polymerase, was observed (Figures 2b, 2c and Figure S6). These results indicated that these primer-extension reactions are not impacted


6


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 37

Figure 2. (a) Primer and templates containing 0-3 consecutive L-Ts for the primerextension system. ‘TL’ represents

L-thymidine

(L-T). Primer extensions through 0-3

consecutive L-Ts in the 51-mer DNA template with (b) Therminator DNA polymerase and (c) Deep Vent (exo-) DNA polymerase. A preincubated solution of 0.8 µM 17-merprimer/25-mer-template and 0.04 U enzyme were mixed with a solution of four dNTPs (0.4 mM each) and incubated at 55oC for 1.5 h. by template of varying length, and nucleotide insertion opposite L-T is independent on the type of these DNA polymerases. Unexpectedly, the nucleotide insertion reactions across two L-Ts occurred efficiently and following elongations were also achieved for T2 with Therminator DNA polymerase, whereas dNTPs insertions were unable to surpass two L-Ts with Deep Vent (exo-) DNA polymerase. The primer extensions directed by template T3 containing three L-Ts were inhibited for both enzymes (Figures 2b and 2c). One possible reason for primer-extension reactions not bypassing consecutive L-T residues is that templating L-nucleoside modestly alters the local structure of DNA strands. Overall structural information of the two or three consecutive

L-Ts

modified DNAs and the

corresponding natural DNA was obtained with CD (Figure S7). All DNA strands showed similar characteristic peaks, a positive peak around 280 nm and a negative peak around 250 nm.


7

Page 15 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


However, the intensity of peaks for the L-Ts modified DNAs increased to some degree, indicating the consecutive L-Ts modified DNAs formed different distorted structures due to change of stacking interaction as compared with the natural DNA. Of particular note, the elongation, which surpassed the N+2 position, was observed for Therminator DNA polymerase, and the major bands were the N+2 products for T3 (Figure 2b). Differently, the elongation with Deep Vent (exo-) DNA polymerase only surpassed the N+1 position, and the major bands at the N and N+1 position were observed for T2, whereas the elongation of the template T3 could surpass the three consecutive L-Ts to give N+1, N+2 and N+3 products, in which N+2 product was the main product (Figure 2c). These suggested that primer extension can bypass the first L-T in the two-L-T-contained template and the two L-Ts in the three-L-T-contained template, respectively, although they were not able to achieve following elongations. Kinetics analysis of nucleotide incorporation opposite L-T in the template. Since Deep Vent (exo-), Vent (exo-) and Therminator DNA polymerases can incorporate dNTPs into the DNA primer directed by the template containing a single L-T, the kinetics of polymerization reaction was determined to confirm the effect of L-T on in vitro DNA replication. Running start assays were employed to examine the response of DNA polymerases to a site specifically placed L-T

lesion in the template relative to the corresponding natural template. Figures 3a and 3b show

the results of co-incubation of P-17 annealed to 25-mer natural DNA template and 25-mer L-T modified DNA template (T-25), in the presence of all four dNTPs and Vent (exo-) DNA polymerase for various times, respectively. Figures 3c and 3d show the results of co-incubation in same conditions as that of Figures 3a and 3b except that Vent (exo-) is changed into Deep Vent (exo-). Clearly, very rapid dNTP incorporation into primer directed by natural DNA template was observed in Figure 3a. Vent (exo-) started to synthesize the full-length product after


8


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 37

Figure 3. Time course of primer extension reactions conducted with 25-mer natural DNA template and T-25 by Vent (exo-) and Deep Vent (exo-) DNA polymerase. A 0.8 µM of Primer-17/25-mer-DNA-template and 0.04 U/µL of enzyme were mixed with all four dNTPs (0.4 mM each) and incubated for various times before terminating with EDTA. Polymerization reactions were incubated with (a) the natural DNA template and Vent, (b) T-25 and Vent, (c) the natural DNA template and Deep Vent (exo-), and (d) T-25 and Deep Vent (exo-). 1 min, and the primer almost completely converted the full-length product within 15 min. However, nucleotide incorporation into primer directed by L-T modified DNA template became slower and Vent (exo-) only incorporated truncated product after 10 min and did not synthesize full-length products even after 15 min (Figure 3b). Similar to Vent (exo-), Deep Vent (exo-) and Therminator displayed an obvious lag in incorporating dNTPs directed by L-T modified DNA template relative to natural DNA template (Figures 3c, 3d and Figure S8a). Quantitative analyses of the running start assays were performed by determining the relative modification bypass rates (L-T, bypass%) as a function of reaction time (Figures S8b and S9). The kinetic parameters (kobs) for nucleotide incorporation opposite L-T by using Deep Vent (exo), Vent (exo-) and Therminator DNA polymerases were drastically reduced compared to that


9

Page 17 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


opposite D-T in the template, and the drop are 1.73-, 1.85-, 1.90-fold, respectively (Table S1). The result may explain the observation that the primer was unable to bypass two or more consecutive L-Ts in the template. Additionally, we determined the kinetic parameters (Km and kcat) at various concentrations of the triphosphates (Figures S10-S12). The Km and kcat values for dNTP incorporation opposite normal and L-T modified template are listed in Table 1. When the kinetic parameters of normal and L-T modified templates were compared, Vent (exo-) and Deep Vent (exo-) incorporated dNTPs much more difficult with L-T modified DNA strand as template than that of the normal template (relative efficiency 5.9 vs 100, 7.9 vs 100, respectively) due to having remarkably larger Km values (1171.10 vs 138.44 µM, 865.56 vs 130.71 µM, respectively) and significantly smaller kcat values (10.64 vs 21.16 min-1, 11.25 vs 21.40 min-1, respectively). The kinetics of dNTPs incoporation by Vent (exo-) and Deep Vent (exo-) DNA polymerases

Table 1 Kinetic analysis for nucleotide extension reactions opposite normal and L-T modified template catalyzed by DNA polymerases.

Enzyme

Template

Km (µM)

kcat (min-1)

kcat / Km (µM-1 ·min-1)

Relative efficiency (%)

Normal

138.44 ± 43.28

21.16 ± 1.56

0.15

T-25

1171.10 ± 266.81

10.64 ± 0.94

0.009

Deep Vent

Normal

130.71 ± 40.12

21.40 ± 1.53

0.16

(exo-)

T-25

865.56 ± 215.03

11.248 ± 0.99

0.013

Normal

133.98 ± 26.99

21.73 ± 1.03

0.16

100

T-25

391.62 ± 96.31

18.17 ± 1.29

0.05

28.4

Vent (exo-)

100 5.9 100 7.9

Therminator


10


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 37

showed that nucleotide insertion reactions occurred much slowly with L-T modified DNA strand as template compared to the normal template although the following elongations are also achieved. Therminator also showed similar tendencies, which exhibited relatively slight differences in the Km values (391.62 vs 133.98 µM), the kcat values (18.17 vs 21.73 min-1) and about 28.4 vs 100 relative efficiency between the L-T modified DNA and the normal template. It’s also observed for all DNA polymerases used in the study that the relative efficiencies for T-25 and the normal template were totally different although the kcat values did not change drastically. These results suggested that the new phosphodiester bond to nucleoside paired with L-thymidine forms with difficulty, probably because of stereochemical hindrances due to the base pairing of the incoming nucleotide with L-thymidine or because of interference with hydrogen bonding between the polymerase and the template base. Thus, introduction of L-T into DNA strand controlled the binding affinity and changed the formation rate constant (product formation rate) as well. Fidelity for nucleotide incorporation opposite L-T in the template. It has been reported that nucleotide selection by DNA polymerases are influenced by base stacking, Watson-Crick hydrogen bonding, and steric interactions, which are strong contributors to the overall stabilization of the double helix. The stability of DNA duplex is not only important, but also it is essential to efficient and highly selective replication.5, 26 The heterochiral DNAs that contain an L-nucleoside

within natural D-sequences are found to retain the B-form duplex structure when

hybridized with complementary homochiral D-sequences27-29, and L-nucleosides can locate their bases for Watson-Crick base pairing with natural nucleic acids.30,

31

Chiral modification

decreases the duplex stability of heterochiral oligodeoxynucleotides containing an L-nucleoside within natural sequences (∆Tm = 5.5 oC, Figure S13), narrowing the gap of stability between


11

Page 19 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mismatch base pair and match base pair, so that the base pairing selectivity may be lower with Lnucleotide in heterochiral duplexes than their corresponding homochiral duplexes.32 These observations are highly suggestive of the miscoding potential of L-T in the template during DNA replication. Thus, we set out to measure the base-pairing fidelity of L-T by sequencing the primer-extension products directed by DNA templates containing L-T. To determine if L-T in oligonucleotide templates has miscoding potential, full-length primerextension products derived from a natural and L-T modified DNA template were directly

Figure 4. (a) Sequences used in polymerization chain reaction and sequence analysis of PCR products derived from (b) 87-mer natural DNA template or (c) T-87 that contains L-T at 49th position from the 5’-end of template. The figures showed DNA sequences 46–87 from 5’ to 3’ in the template (underlined), and the sequence number was designated in the sequence header. The position of L-T modified nucleoside is marked by a sign (↓). The matching sequence in the primer was also underlined.


12


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 37

sequenced, respectively. The 87-mer natural DNA template and the template containing L-T at 49th position from the 5’-end (T-87) were synthesized by DNA synthesizer for direct sequencing, and a 37-mer primer (P-37) that has 20 complementary base sequence to template was used (Figure 4a). The full-length PCR products were obtained with the reverse PCR primer paired with 87-mer natural DNA template and T-87 (Figure S14). Since the primer binds to the 3’-end of the complementary strand of the input oligonucleotide, any sequence readout must be derived from strands complementary to the input oligonucleotide and therefore should convey information on nucleotide incorporated across from L-T. The results showed that the sequence of PCR product of natural DNA template matched its expected sequence (Figure 4b). Obviously, PCR products derived from the DNA templates with L-T modification did not give rise to a mismatch or a mixture of readouts when acrossed from L-T in the template (Figure 4c), which means DNA polymerase incorporated preferentially dATP over other incorrect dNTPs opposite L-T

in PCR products. The result indicates that L-nucleoside possesses a reasonable specificity to

complementary base-pairing to natural DNA template in a Watson-crick manner. No mistaken readout for sequencing opposite

L-T

might be caused because dATP

incorporation has a better competitiveness than other dNTPs due to addition of the nucleotide pool to a primer-template complex. To exclude competitive factors of dNTP incorporation opposite L-T, a single kind of deoxynucleoside triphosphate with varying amounts, as substrate, was added to the primer-extension mixture based on report.33 The polymerization reactions were the same as the extension assays described above except for half of enzyme dosage. As shown in Figure 5, fidelity during the extension step was relatively normal for natural DNA template. With increasing concentrations, only dATP was added to the primer-template complex and incubated by polymerase producing partial N+1 product. In contrast, with only dTTP, dGTP, or dCTP, the


13

Page 21 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


absence of any N+1 product was observed, which further confirms that misincorporation opposite L-T in the template was not found for PCR products derived from L-T modified DNA templates, indicating that dATP was accurately incorporated across from the corresponding modified site of DNAs, in which the original sequence was conserved. Thus, we conclude that the specificity of DNA polymerase provides an effective defense against using the L-nucleoside as a building block during standard DNA replication and that the L-T lesion is not a potent mutagen when it is formed in genomic DNA. This result is in contrast to the previous report that DNA polymerases perturb polymerization chain reactions to different degrees and possibly cause

Figure 5. Fidelity of incorporation of dNTP opposite L-T in a 25-mer natural DNA template (on the left panel) and T-25 (on the right panel) in a polymerization reaction catalyzed by Therminator DNA polymerase, respectively. Each deoxynucleoside triphosphate added is indicated on bottom of each lane. Primer extension experiments were performed with primer-template complex (0.8 µM), Therminator DNA polymerase (0.04 U/µL) and varying amounts of each nucleotide.


14


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 37

a genetic mutation when replication is performed on the modified DNA template.34-36 Structural insights into nucleotide incorporation opposite L-T in the template. Primer extension experiments showed that Therminator, Vent (exo-) and Deep Vent (exo-) DNA polymerases could incorporate nucleotides opposite L-T and elongate the primer, whereas Taq and Phanta max DNA polymerases could not implement such a process. To elucidate the mechanism of the difference, insight from 3D structures of typical DNA polymerases was carried out. As models, crystal structures of Taq

37

, Deep Vent (exo-)

38

and Therminator

39

DNA

polymerases are been showed in the Figure 6. All polymerases share the same mechanism for nucleotidyl transfer involving two divalent metal ions. The pol domain of DNA polymerase resembles a right hand and can be further divided into palm, fingers and thumb subdomains, which form the DNA-binding crevice.40 It is acknowledged that primer extension is a complex process during which DNA polymerase undergoes substantial substrate-induced conformational changes from an ‘open’ complex to a catalytically competent ‘closed’ complex, with the cognate triphosphate forming complementary Watson-Crick hydrogen bonds with the templating nucleotide that positions it for incorporation into the growing primer strand.41 In addition, extensive studies have shown that family B DNA polymerases (Deep Vent (exo-), Vent (exo-) and Therminator) are more efficient at incorporating chemical modifications in their substrates than the DNA polymerases from family A, such as Taq DNA polymerase.42-44 Given the different molecular recognition, it is clear that remarkable differences appear to exist in the active sites of Family A and B polymerases despite global similarities. Thus, comparison of their active sites and conformation transitions may provide valuable information about the catalytic cycle in detail.


15

Page 23 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 6. Proposed mechanism of primer extension. (a) The O-helix of Taq DNA polymerase (PDB ID: 1TAU), (b) The O-helix of Deep Vent (exo-) DNA polymerase (PDB ID: 5H12), (c) The O-helix of Therminator DNA polymerase (PDB ID: 4K8X). (d) The incorporation of dATP against D-T by DNA polymerase is indicated. (e) The aborted incorporation of dATP against L-T by Taq DNA polymerase is indicated. (f) The incorporation of dATP against L-T by Deep Vent and Therminator is indicated. Phosphates were indicated with solid circles, natural nucleotides were indicated with black line and the L-T nucleotides are indicated with light blue line. Bases were shown in pink for A, blue for T, orange for G, green for C, and light blue for L-T. The O-helixes are shown in red for all DNA polymerases used in the study, green for Taq DNA polymerase, blue for Deep Vent (exo-) and Therminator DNA polymerases.


16


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 37

The finger domain of Taq DNA polymerase is 641-674 (PDB ID: 1TAU) (Figure 6a).37 Several important amino acid residues are Arg 659, Lys 663 and Tyr 671, which are critical for the orientation and binding of the incoming nucleotide. Deep veep vent deficient in 3’-5’ exonuclease activity, designated Deep Vent (exo-), and its finger domain is 484-499 (PDB ID: 5H12) (critical residues: Arg 485, Lys 488 and Tyr 497) (Figure 6b).38, 45, 46 Therminator DNA polymerase is a variant of the 9oN DNA polymerase (PDB ID: 1QHT)

47, 48

, and it is typical

domain includes N-terminal (N-term, 1-130 and 338-372), exonuclease (exo, 131-338), finger (448-499) (critical residues: Lys 487 and Tyr 499), thumb (591-774) and palm (374-447 and 500-590) (PDB ID: 4K8X) (Figure 6c).39, 49 Compared to Taq, the different orientation of Arg residue in finger domain of Deep Vent (exo-) is observed, whereas Arg residue in finger domain is missing for Therminator, which could weaken or lose its contacts to the primer. For general enzymes, the majority of direct protein side- and main-chain contact to dsDNA are at the phosphate backbone, whereas the number of direct contacts to the nucleobases and sugar moiety is more strikingly different. In Taq, six nucleobases are contacted by five protein side chains, whereas only three nucleobases are contacted by just two residues in the Therminator structure.39 Furthermore, remarkably fewer interactions with the ribose moiety were found in Therminator (two interactions) compared to Taq (six interactions). Another major difference is the tip of the thumb domain. The tip of the thumb domain makes contacts with the primer strand, whereas the architectures of the contacting loops differ greatly: the loop in Therminator structure hoves above the minor groove without extending deeply into it, while the corresponding loop in Taq extends over the phosphate backbone towards the major groove.39 Furthermore, crystallographic studies have shown a higher ordered interaction in the minor groove of the double helix DNA with family A polymerases compared to family B polymerases.50 As contacts


17

Page 25 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of all sugars and nucleobases are through the minor groove, L-T nucleotide might clash with the tip of the domain when processed by Taq. Thus, Taq shows no tolerance for L-T in the template. Whereas better performance of B-family polymerases in processing L-T may be the result of a sterically less-hindered minor groove. Based on previously reported structural data, we propose the following ‘open to close’ transformation for primer extension (Figures 6d, 6e and 6f). In the normal case, DNA polymerases are able to bind and operate dNTP by forming Watson-Crick hydrogen bonds and πstacking interactions with the primer, accompanied by conformational changes from an ‘open’ complex to a catalytically competent ‘closed’ complex (Figure 6d). Each structure of DNA polymerase bound to a dNTP and the primer/template duplex forms a closed ternary complex. The residue Arg, acting as a clamp between the finger domain and the DNA duplex, interact with the phosphate backbone of 3’-primer terminus, Lys may stabilize the complex, and the residue Tyr of O-helix packs against the nascent natural base pair, thereby closing the crevice (Figure S15). When L-T is introduced into the template, the O-helix need to pack against the distorted base pair (L-T:A) in the closed conformation, those critical catalytic residues (Arg, Lys and Tyr) may be rearranged, sterical clash with the side chain of amino acid residue in Taq DNA polymerase might occur.51 The crystal structures of the replication complex of Taq DNA polymerase predict that this residue Arg will face away from the active site, with little likelihood of directly contacting with the nucleotide substrate (Figure 6e).52 As a result, the closed conformation is not stabilized by these interactions, which may be responsible for the loss in incorporation efficiency for L-T modified DNA compared with the natural template. In contrast to Taq, the less interactions exist between the phosphate backbone (sugar and nucleobase) and Therminator DNA polymerase, making the enzyme flexible and plastic. The


18


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 37

striking difference derives from Arg of O-helix, which intervenes the interaction with the primer 3’-end.53, 54 The loss of Arg implys the plasticity of Therminator DNA polymerases to adapt to the structure of the incoming nucleotide. The L-T base in the templating position exhibits less clashes with the surrounding amino acid residues when the O-helix changed from an ‘open’ to a ‘closed’ conformation. The active site of Therminator can mediate to accommodate the base pair L-T:A,

making the nucleophilic attack to 3’-OH of primer available (Figure 6f). Thus, of all the

DNA polymerases studied, Therminator shows best efficiency in incorporating dATP opposite to L-T

in the templating position. As a result, the L-T insertion in the template reduced the

nucleotide incorporation rate of Therminator, Deep Vent (exo-) and Vent (exo-) by 3.5-, 12.7and 16.9-fold, respectively (Table 1). Since the similarity in amino acid sequence of Family B archaeon DNA polymerases suggests that these enzymes might share dNTP incorporation in a similar manner, Deep Vent (exo-) DNA polymerase is also capable of incorporating dATP opposite to L-T, although the magnitude of the effect is varied. CONCLUSION In this work, different from the recent report that chemically synthesized

D-amino

acid

polymerase enzymatically catalyzed polymerization reactions on an L-DNA template 55, we used several conventional DNA polymerases as model polymerases to handle the DNA templates containing one L-thymidine. Taq and Phanta Max DNA polymerases entirely refuse to surpass LT at single site, while Deep Vent (exo-), Vent (exo-) and Therminator DNA polymerases tolerate the L-T to different degrees to make primer-extension prolong to the end of template. We could not exclude that other factors or other exonucleases might play an important role in nucleotide incorporation opposite L-nucleoside of DNA template in vivo DNA replication. Our results in the experimental conditions confirm the hypothesis that the templating L-nucleoside in the enzyme


19

Page 27 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


active site was responsible for partially polymerase stalling on DNA templates and decreasing of activity. Kinetic analysis of replication across L-T by Deep Vent (exo-), Vent (exo-) and Therminator DNA polymerases in vitro demonstrated that they incorporated nucleotide across Lthymidine a much lower incorporation rates, respectively, relative to natural nucleoside, which is consistent with that DNA polymerase may be entirely blocked by consecutive L-Ts. Most interestingly, further investigations found that adenosine triphosphates could be incorporated into oligonucleotides opposite L-T in our extension conditions, which is physiologically significant since that provide a theoretical basis on the involvement of DNA polymerase in the effective repair of L-T that may lead to cytotoxicity. Structural insights reveal that the enzyme is able to adapt to the L-T modification in the template depending on amino acid side-chain conformations at the active site. The study provides the first experimental example of whether L-stereochemistry affects base mutation by natural polymerase-mediated primer extension. This would offer ample trial grounds to explain why the L-nucleoside might be disfavored as a component of a coding system, and enhance our understanding of why L-nucleosides are not found in the nature as the molecular basis of life’s genetic material. Our data on looking-glass biochemical processes are still an important effort to investigate why life’s chirality is the way it is. EXPERIMENTAL PROCEDURES Materials and general methods. 5’-FAM labeled primer and non-labeled primer were purchased from Shenggong Co Lt. Company (Shanghai). Taq, Vent (exo-), Deep Vent (exo-), Therminator and Phanta Max Super-fidelity DNA polymerases were purchased from Baoruyi Biotechnology Co., Ltd (NEB, Beijing). The canonical dNTPs were from Dingguochangsheng BioTechnologies (Beijing), and L-thymidine was from Hanwei BioTechnologies (AnHuiWuHu).


20


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

L-thymidine

Page 28 of 37

phosphoramidite was synthesized from L-thymidine via DMT deprotection, as

shown in Figure S16 and the structure was characterized using 1H NMR, 13C NMR and 31P NMR (Figures S17-S19). Oligonucleotides containing L-thymidine were used in the study in Figure S20. They were synthesized and puriﬁed according to methods published previously by our laboratory.25 The oligonucleotide synthesis was carried out by using a 3400 DNA synthesizer (ABI) with standard reagents and program, followed by purification on a Waters HPLC system using Waters reverse phase C18 column (5 µm, 9.6 mm × 150 mm). Oligonucleotide concentrations were determined on a Beckman Coulter DU800 UV−Visible spectrophotometer. The identity of the oligonucleotides was conﬁrmed by ESI-MS with Xevo G2 Q-TOF model under negative mode (Figure S21 and Table S2). Primer extension assays. The 5’-end FAM labeled primer (0.8 µM) was annealed to the template by mixing primer and template in a molar ratio of 1:1 and heated to 95 °C for 5 min, followed by slow cooling to room temperature. The reaction mixtures were prepared in a total volume of 25 µL with 2 µL of 5’-labeled primer-template complex (10 µM), 2.5 µL of 10×ThermoPol® reaction buffer, 1 µL of dNTP (10 mM in each dNTP) and 0.5 µL of Taq, Phanta Max, Vent (exo-), Deep Vent (exo-) or Therminator DNA polymerase (2 U/µL) and 19µL of distilled water. The reaction mixtures were gently vortexed and incubated at 55 °C for 1.5 h. The polymerase reactions were terminated by the addition of 5 µL of loading buffer (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol and 20 mM EDTA). A 6 µL of aliquot of the mixtures was subjected to a 20% denaturing polyacrylamide gel containing 7 M urea. Analysis of products was performed by gel electrophoresis for 1.5 h at 150 V in presence of a 1×TBE buffer followed by visualized by ChemiDoc XRS System (BioRad).


21

Page 29 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Kinetics analysis. A 5’-FAM-labeled primer (0.8 µM) annealed to a natural template or an Lthymidine modified template (0.8 µM) and Vent (exo-), Deep Vent (exo-) or Therminator DNA polymerase (0.04 U/µL) were preincubated in a buffer (20 mM Tris-HCl (pH 8.8, 25 °C), 10 mM KCl, 10 mM (NH4)2SO4, 2 mM MgSO4, and 0.1% Triton X-100). A solution including all four dNTPs (0.4 mM each) was added to the above mixture and incubated at 55 °C. The reactions were terminated by the addition of loading buffer (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol and 20 mM EDTA) at 1, 2, 5, 10, 15, 30, 45 and 60 min. The incorporation pattern was resolved via denaturing polyacrylamide gel electrophoresis as described above. Quantitative analysis of the running start assays was performed by determining the relative lesion bypass efficiencies (L-thymidine triphosphates bypass %) as a function of reaction time. The plot of product formation versus time was fit to a single exponential equation. [S] = A(1exp(-kobst), where kobs is the observed reaction rate and A is the product amplitude. All reactions were performed in triplicate.56 The kcat and Km were determined by adding various concentrations of dNTP solution to a 25 µL of the reaction mixtures containing 2 µL of primer-template complex (20 µM), 2.5 µL of 10 × ThermoPol® reaction buffer and 0.5 µL of DNA polymerase (2 U/µL). After incubated at 55 oC for different time intervals, the reaction mixtures were quenching with the addition of 5 µL loading buffer. The percentage of primers extended by the polymerase was calculated using ChemiDoc XRS System (BioRad). The rate of product formation (v, µM·mim-1) was plotted as a function of dNTP concentration, and the data was fit by a nonlinear regression curve to the MichaelisMenten equation using Origin 9.0 software (OriginLab Corporation). Vmax (maximum observed reaction velocity) and Km (concentration of substrate dNTP at which the observed reaction


22


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 37

velocity is half-maximal) values for the insertion of nucleotides were obtained from the fitted curves. kcat was calculated by dividing the Vmax by the enzyme concentration. The efficiency (f) was calculated as kcat / Km. The nucleotide concentration range and time of reaction were adjusted for every experiment. Sequencing.

2

µL

of

5’-FAM

labelled

37-mer

TAATACGACTCACTATAGGGACTAGCTACGAGTGCTC-37-m template

or

modified

primer and

template

(5’-

FAM-

87-mer

normal (T-87:5’-

GACGGAATATAAGCTGGTGGTCTGAAGTGGCCGTGGTAGTTCGACGACTLTACGAGT AAGTATACAGGGAGCACTCGTAGCTAGTCCC-3’) (5 µM), 2 µL of 10×ThermoPol® reaction buffer, and 0.5 µL of Therminator DNA polymerase (2 U/µL) and 19.5 µL of distilled water (two times distilled) were mixed. The reaction mixtures were incubated at 55 °C for 1.5 h. Purified primer-extension products were sequenced using ABI Big Dye Terminator chemistry with TaqFS polymerase. After purification by Centri-Sep 100 spin columns (Princeton Separations, Princeton, NJ), the product was further amplified using Therminator DNA polymerse (0.05 U/µL) in Thermo Pol® reaction buffer (pH 8.8 at room temperature), 0.5 µM of non-labeled Primer, four standard dNTPs (final 0.4 mM of each). The following PCR conditions were used: one cycle of 95 °C for 1 min; followed by 25 cycles of (95 °C for 20 s, 58 °C for 25 s, 72 °C for 1.5 min); and finally 72 °C for 15 min. Upon completion of PCR, fresh PCR products were cloned into an Applied Biosystems 310 Genetic Analyzer for analysis. Purified reactions were processed using the Seq POP6 Rapid (1 mL) E module (Sequence Analysis software v3.3 (ABI)) and analyzed using the CE-1 base-calling algorithm. Computer analyzed base calls were manually edited for accuracy. Sequence comparisons were made using ABI Sequence Navigator v1.0.1 software or the SeqLab Analysis platform (Accelrys, San Diego, CA).


23

Page 31 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Mismatch analysis. The mismatch was analyzed by gel fidelity assay as previously reported.33 2 µL of 5’-FAM labelled primer-template complex (10 µM), 2.5 µL of 10 × ThermoPol® reaction buffer, and 0.5 µL of Therminator DNA polymerase (2 U/µL) and 19 µL of distilled water (two times distilled) were mixed. Primer extension was initiated by adding 1µL of various concentrations (10, 50, 100, 500, 1000 µM) of dATP, dCTP, dGTP or dTTP, respectively. The mixture was incubated at 55 °C for 1.5 h. The polymerase reactions were quenched by the addition of 5 µL of loading buffer (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol and 20 mM EDTA) and the products analysed as described above. ASSOCIATED CONTENT Supporting Information Description of methods; Figures S1-S21 and Tables S1-S2. This material is available free of charge via the Internet at http://pubs.acs.org. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected], * E-mail: [email protected] Author Contributions §

These authors contributed equally.

Notes The authors declare no competing financial interest. ACKNOWLEDGMENT


24


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 37

This work was sponsored by the National Natural Science Foundation of China (Grant Nos. 21302008 and 21272263), the State Key Laboratory of Natural and Biomimetic Drugs (Grant Nos. K20140204 and K20150204), and Foundation for University Young Teachers by the Chinese Academy of Sciences (Grant No Y55103HY00). ABBREVIATIONS PAGE, polyacrylamide gel electrophoresis; dNTP, deoxyribonucleotide triphosphate; dATP, deoxyadenosine triphosphate; dTTP, deoxythymidine triphosphate; dCTP, deoxycytidine triphosphate; dGTP, deoxyguanosine triphosphate; PCR, polymerase chain reaction REFERENCES (1)

Mason, S. F. (1984) Origins of biomolecular handedness. Nature 311, 19-23.

(2)

Bada, J. L. (1995) Origins of homochirality. Nature 374, 594-595.

(3)

Mathé, C., and Gosselin, G. (2006) L-nucleoside enantiomers as antivirals drugs: a minireview. Antiviral Res. 71, 276-281.

(4)

Brown, J. A., Pack, L. R., Fowler, J. D., and Suo, Z. (2012) Presteady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogues Catalyzed by Noncanonical Human DNA Polymerases. Chem. Res. Toxicol. 25, 225-233.

(5)

Gaur, V., Vyas, R., Fowler, J. D., Efthimiopoulos, G., Feng, J. Y., and Suo, Z. (2014 ) Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase. Nucleic Acids Res. 42, 9984-9995.

(6)

Gidalevitz, T., Kikis, E. A., and Morimoto, R. I. (2010) A cellular perspective on conformational disease: the role of genetic background and proteostasis networks. Curr. Opin. Struct. Biol. 20, 23-32.

(7)

Joyce, G. F., Vissert, G. M., van Boeckel, C. A. A., van Boom, J. H., Orgel, L. E., and van Westrenent, J. (1984) Chiral selection in poly(C)-directed synthesis of oligo(G). Nature 310, 602-604.

(8)

Schmidt, J. G., Nielsen, P. E., and Orgel, L. E. (1997) Enantiomeric Cross-Inhibition in the Synthesis of Oligonucleotides on a Nonchiral Template. J. Am. Chem. Soc. 119, 1494-


25

Page 33 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1495. (9)

Kozlov, I. A., Pitsch, S., and Orgel, L. E. (1998) Oligomerization of activated D- and Lguanosine mononucleotides on templates containing D- and L-deoxycytidylate residues. Proc. Natl. Acad. Sci. USA 95, 13448–13452.

(10)

Kozlov, I. A., Politis, P. K., Pitsch, S., Herdewijn, P., and Orgel, L. E. (1999) A Highly Enantio-Selective Hexitol Nucleic AcidTemplate for Nonenzymatic Oligoguanylate Synthesis. J. Am. Chem. Soc. 121, 1108-1109.

(11)

Shelke, S. A., and Piccirilli, J. A. (2014) RNA made in its own mirror image. Nature 515, 347-348.

(12)

Sczepanski, J. T., and Joyce, G. F. (2014) A cross-chiral RNA polymerase ribozyme. Nature 515, 440-442.

(13)

Semizarov, D. G., Arzumanov, A. A., Dyatkina, N. B., Meyer, A., Vichier-Guerre, S., Gosselin, G., Rayner, B., Imbach, J., and Krayevsky, A. A. (1997) Stereoisomers of Deoxynucleoside 5-Triphosphates as Substrates

for Template-dependent and -

independent DNA Polymerases. J. Biol. Chem. 272, 9556–9560. (14)

Yamaguchi, T., Iwanami, N., Shudo, K., and Saneyoshi, M. (1994) Chiral discrimination of enantiomeric 2'-deoxythymidine 5'-triphosphate by HIV-1 reverse transcriptase and eukaryotic DNA polymerases. Biochem. Biophys. Res. Commun. 200, 1023-1027.

(15)

Focher, F., Maga, G., Bendiscioli, A., Capobianco, M., Colonna, F., Garbesi, A., and Spadari, S. (1995) Stereospecificity of human DNA polymerases alpha, beta, gamma, delta and epsilon, HIVreverse transcriptase, HSV-1 DNA polymerase, calf thymus terminal transferase and Escherichia coli DNA polymerase I in recognizing D- and Lthymidine 5'-triphosphate as substrate. Nucleic Acids Res. 23, 2840-2847.

(16)

Verri, A., Montecucco, A., Gosselin, G., Boudou, V., Imbach, J. L., Spadari, S., and Focher, F. (1999) L-ATP is recognized by some cellular and viral enzymes: Does chance drive enzymatic enantioselectivity. Biochem. J. 337, 585-590.

(17)

Tomikawa, A., Kohgo, S., Ikezawa, H., Iwanami, N., Shudo, K., Kawaguchi, T., Saneyoshi, M., and Yamaguchi, T. (1997) Chiral discrimination of 2'-deoxy-L-cytidine and L-nucleotides by mouse deoxycytidine kinase: Low stereospecificities for substrates and effectors. Biochem. Biophys. Res. Commun. 239, 329-333.

(18)

Chaput, J. C., and Szostak, J. W. (2003) TNA Synthesis by DNA Polymerases. J. Am.


26


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 37

Chem. Soc. 125, 9274 -9275. (19)

Horhota, A., Zou, K., Ichida, J. K., Yu, B., McLaughlin, L. W., Szostak, J. W., and Chaput, J. C. (2005) Kinetic Analysis of an Efficient DNA-Dependent TNA Polymerase. J. Am. Chem. Soc. 127, 7427 - 7434.

(20)

Kempeneers, V., Vastmans, K., Rozenski, J., and Herdewijn, P. (2003) Recognition of threosyl nucleotides by DNA and RNA polymerases. Nucleic Acids Res. 31, 6221-6226.

(21)

Jiang, C., Li, B., Guan, Z., Yang, Z., Zhang, L., and Zhang, L. (2007) Synthesis and recognition of novel isonucleoside triphosphates by DNA polymerases. Bioorg. Med. Chem. 15, 3019-3025.

(22)

Brown, J. A., Newmister, S. A., Fiala, K. A., and Suo, Z. (2008) Mechanism of doublebase lesion bypass catalyzed by a Y-family DNA polymerase. Nucleic Acids Res. 36, 3867-3878.

(23)

Gaur, V., Vyas, R., Fowler, J. D., Efthimiopoulos, G., Feng, J. Y., and Suo, Z. (2014) Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase. Nucleic Acids Res. 42, 9984-95.

(24)

Ogino, T., Sato, K., and Matsuda, A. (2010) Incorporation of 2'-deoxy-2'-isonucleoside 5'-triphosphates (iNTPs) into DNA by A- and B-family DNA polymerases with different recognition mechanisms. Chembiochem 11, 2597-2605.

(25)

Wu, L., Wang, J., and Tang, X. (2015) Synthesis of Site-Specifically Phosphate-Caged siRNAs. Curr. Protoc. Nucleic Acid Chem., 6.12.1-6.12.15.

(26)

Kool, E. T. (2001) Hydrogen bonding, base stacking, and steric effects in DNA replication. Annu. Rev. Biophys. Biomol. Struct. 30, 1-22.

(27)

Kavakami, J., Tsujita, K., and Sugimoto, N. (2005) Thermodynamic Analysis of Duplex Formation of the Heterochiral DNA with L-Deoxyyadenosine. Anal. Sci. 21, 77-82.

(28)

Urata, H., Ogawa, S., and Wada, S. (2013) Thermal stability of oligodeoxynucleotide duplexes containing l-deoxynucleotide at termini. Bioorg. Med. Chem. Lett. 23, 29092911.

(29)

Urata, H., Shimizu, H., and Akagi, M. (2006) Structural studies of heterochiral DNA/DNA, RNA/RNA, and DNA/RNA duplexes. Nucleos. Nucleot. Nucl. 25, 359-367.

(30)

Blommers, M. J. J., Tondelli, L., and Garbesi, A. (1994) Effects of the Introduction of LNucleotides into DNA. Solution Structure of the Heterochiral Duplex d(G-C-G-(L)T-G-


27

Page 35 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


C-G>d(C-G-C-A-C-G-C) Studied by NMR Spectroscopy. Biochemistry 33, 7886-7896. (31)

Urata, H., Ueda, Y., Suhara, H., Nishioka, E., and Akagi, M. (1993) NMR Study of a Heterochiral DNA Stable Watson-Crick-Type Base-Pairing between the Enantiomeric Residues. J. Am. Chem. Soc. 115, 9852-9853.

(32)

Ogawa, S., Wada, S., and Urata, H. (2012) Base recognition by L-nucleotides in heterochiral DNA. RSC Adv. 2, 2274–2275.

(33)

Creighton, S., and Goodman, M. F. (1995) Gel kinectic analysis of DNA polymerase fidelity in the presence of proofreading using bacteriophage T4 DNA polymerase. J. Biol. Chem. 270, 4759-4774.

(34)

Sikorsky, J. A., Primerano, D. A., Fenger, T. W., and Denvir, J. (2007) DNA damage reduces Taq DNA polymerase fidelity and PCR amplification efficiency. Biochem. Biophys. Res. Commun. 355, 431-437.

(35)

Wang, D., Kreutzer, D., and Essigmann, J. (1998) Mutagenicity and repair of oxidative DNA damage: insights from studies using defined lesions. Mutat. Res. 400, 99-115.

(36)

Taggart, D. J., Fredrickson, S. W., Gadkari, V. V., and Suo, Z. (2014) Mutagenic potential of 8-oxo-7,8-dihydro-2'-deoxyguanosine bypass catalyzed by human Y-family DNA polymerases. Chem. Res. Toxicol. 27, 931-940.

(37)

H., E. S., J., W., and A., S. T. (1996) Structure of Taq polymerase with DNA at the polymerase active site. Nature 382, 278 - 281.

(38)

Hikida, Y., Kimoto, M., Hirao, I., and Yokoyama, S. (2017) Crystal structure of Deep Vent DNA polymerase. Biochem. Biophys. Res. Commun. 483, 52-57.

(39)

Bergen, K., Betz, K., Welte, W., Diederichs, K., and Marx, A. (2013) Structures of KOD and 9oN DNA Polymerases Complexed with Primer Template Duplex. Chembiochem 14, 1058-1062.

(40)

Rodriguez, A. C., Park, H. W., Mao, C., and Beese, L. S. (2000) Crystal structure of a pol α family DNA polymerase from the hyperthermophilic archaeon Thermococcus sp. 9°N-7. J. Mol. Biol. 299, 447-462.

(41)

Betz, K., Malyshev, D. A., Lavergne, T., Welte, W., Diederichs, K., Dwyer, T. J., Ordoukhanian, P., Romesberg, F. E., and Marx, A. (2012) KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry. Nature Chem. Biol. 8, 612614.


28


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(42)

Page 36 of 37

Veedu, R. N., Vester, B., and Wengel, J. (2009) Efficient enzymatic synthesis of LNAmodified DNA duplexes using KOD DNA polymerase. Org. Biomol. Chem. 7, 1404-1409.

(43)

Ikonen, S., Macíckovácahová, H., Pohl, R., Sanda, M., and Hocek, M. (2010) Synthesis of nucleoside and nucleotide conjugates of bile acids, and polymerase construction of bile acid-functionalized DNA. Org. Bio. Chem. 8, 1194-1201.

(44)

Baccaro, A., Steck, A., and Marx, A. (2012) Barcoded Nucleotides. Angew. Chem. Int. Ed. 51, 254-257.

(45)

H., H., and P., K. (1996) Fidelity and predominant mutations produced by Deep vent wild-type and exonuclease-deficient DNA polymerases during In vitro DNA amplication. DNA Cell Biol. 15, 589-594.

(46)

Gardner, A. F., and Jack, W. E. (1999) Determinants of nucleotide sugar recognition in an archaeon DNA polymerase. Nucleic Acids Res. 27, 2545-2553.

(47)

O., M. E., and C., C. J. (2009) Transcription of an RNA aptamer by a DNA polymerase. Chem. Commun. 20, 2938-2940.

(48)

Kasuya, T., Hori, S., Hiramatsu, H., and Yanagimoto, T. (2014 ) Highly accurate synthesis of the fully 2'-fluoro-modified oligonucleotide by Therminator DNA polymerases. Bioorg. Med. Chem. Lett. 24, 2134-2136.

(49)

Konrad, B., B., K., Wolfram, W., Kay, D., and Andreas, M. (2013) Structures of KOD and 9°N DNA polymerases complexed with primer template duplex. Chembiochem 14, 10581062.

(50)

Minakawa, N., Ogata, S., Takahashi, M., and Matsuda, A. (2009) Unnatural imidazopyridopyrimidine:naphthyridine base pairs: selective incorporation and extension reaction by DNA polymerases. Nucleic Acids Symp. Ser. 53, 125-126.

(51)

Tosaka, A., Ogawa, M., Yoshida, S., and Suzuki, M. (2001) O-helix mutant T664P of Thermus aquaticus DNA polymerase I: altered catalytic properties for incorporation of incorrect nucleotides but not correct nucleotides but correct nucleotides. J. Biol. Chem. 276, 27562-27567.

(52)

Betz, K., Malyshev, D. A., Lavergne, T., Welte, W., Diederichs, K., Dwyer, T. J., Ordoukhanian, P., Romesberg, F. E., and Marx, A. (2012) Klentaq polymerase replicates unnatural base pairs by inducing a Watson-crick geometry. Nat Chem Biol. 8, 612-614.

(53)

Li, Y., and Waksman, G. (2001) Crystal structures of a ddATP-, ddTTP-, dCTP, and


29

Page 37 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ddGTP- trapped ternary complex of Klentaq1: Insights into nucleotide incorporation and selectivity. Protein Sci. 10, 1225-1233. (54)

Li, Y., Kong, Y., Korolev, S., and Waksman, G. (1998) Crystal structures of the Klenow fragment of Thermus aquaticus DNA polymerase I complexed with deoxyribonucleoside triphosphates. Protein Sci. 7, 1116-1123.

(55)

Wang, Z., Xu, W., Liu, L., and Zhu, T. F. (2016) A synthetic molecular system capable of mirror-image genetic replication and transcription. Nature Chem. 8, 698-704.

(56)

Sherrer, S. M., Sanman, L. E., Xia, C. X., Bolin, E. R., Malik, C. K., Bolin, E. R., Malik, C. K., Efthimiopoulos, G., Basu, A. K., and Suo, Z. (2012) Kinetic Analysis of the Bypass of a Bulky DNA Lesion Catalyzed by Human Y-Family DNA Polymerases. Chem. Res. Toxicol. 25, 730-740.

SYNOPSIS Mirror-image thymidine in the template affected incorporation of dNTPs into DNA by polymerases, but the fidelity was essentially unaltered when dNTP incorporation bypassed Lthymidine, which means the L-thymidine lesion might be self-repaired in an evolved coding system.


30

Mirror-Image Thymidine Discriminates against ... - ACS Publications

Recommend Documents