Modulation of hypertrophic scar formation using amniotic membrane

Subscriber access provided by UNIV OF BARCELONA

Tissue Engineering and Regenerative Medicine

Modulation of hypertrophic scar formation using amniotic membrane/ electrospun silk fibroin bilayer membrane in a rabbit ear model Mazaher Gholipourmalekabadi, Sadjad Khosravimelal, Zeinab Nokhbedehghan, Marzieh Sameni, Vahid Jajarmi, Aleksandra M. Urbanska, Hadi Mirzaei, Maryam Salimi, Narendra Pal Singh Chauhan, Mohammadmahi Mobaraki, Rui L. Reis, Ali Samadikuchaksaraei, and Subhas C Kundu ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.8b01521 • Publication Date (Web): 30 Jan 2019 Downloaded from http://pubs.acs.org on January 31, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Modulation of hypertrophic scar formation using amniotic membrane/electrospun silk fibroin bilayer membrane in a rabbit ear model Mazaher Gholipourmalekabadi1,2,*, Sadjad Khosravimelal1,3, Zeinab Nokhbedehghan1,3, Marzieh Sameni4,5, Vahid Jajarmi4,5, Aleksandra M. Urbanska6, Hadi Mirzaei7, Maryam Salimi8, Narendra Pal Singh Chauhan9, Mohammadmahdi Mobaraki10, Rui L Reis11, Ali Samadikuchaksaraei1,2, Subhas C Kundu11

1Cellular

and Molecular Research Centre, Iran University of Medical Sciences, Tehran, Iran.

2Department

of Tissue Engineering & Regenerative Medicine, Faculty of Advanced Technologies in Medicine, Iran University of Medical Sciences, Tehran, Iran. 3Department

of Medical Biotechnology, Faculty of Allied Medicine, Iran University of Medical Sciences, Tehran, Iran. 4Cellular

and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 5Biotechnology

Department, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 6Molecular

Pharmacology Department, Memorial Sloan Kettering Cancer Center, New York, NY 10065 USA. 7School

of Medicine, Zabol University of Medical Sciences, Zabol, Iran.

8Department

of Biology and Anatomical Sciences, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. 9Department

of Chemistry, Bhupal Nobles' University, Udaipur-313002, Rajasthan, India.

10Biomaterials

Group, Department of Biomedical Engineering, Amirkabir University of Technology, Tehran, Iran. 113Bs

Research Group, I3Bs – Institute on Biomaterials, biodegradables and Biomimetics. Headquarters of the European Institute of Excellence on Tissue Engineering and Regenerative Medicine, University of Minho, AvePark - 4805-017 Barco, Guimaraes, Portugal. *Corresponding author: Dr. Mazaher Gholipourmalekabadi, ORCID ID: 0000-0001-6287-6831 Department of Tissue Engineering & Regenerative Medicine, Iran University of Medical Sciences, Hemmat Highway, Tehran 144961-4535, Iran. Tel: (+98 21) 8860 4835; Fax: (+98 21) 8862 2533; E-mail: [email protected]; [email protected]

1 ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Abstract Hypertrophic scar is a dermal disorder resulting from collagen and other extra cellular matrix protein depositions following the deep trauma, severe burn injury and surgery incisions. A variety of therapeutic procedures are currently available, however, achieving an ideal treatment method remains a challenge. In our recently published report, a 3D bi-layered decellularized human amniotic membrane/electrospun silk fibroin membrane was fabricated and characterized for regenerative medical applications. To obtain a solid bound between two layers, the samples were immersed in 70% ethanol. In this study, the effects of amniotic membrane/electrospun silk fibroin on minimizing the post-injury hypertrophic scar formation were determined in the rabbit ear model. In vivo experiments were carried out to assess the bilayer membrane characteristics on full thickness hypertrophic scar at days 28 and 50 post-implantations. The significant decrease in the collagen deposition and expression, and the increased expression and deposition of MMP1 in wound-bed were observed on the wounds dressed with bi-layered membrane when compared to the amniotic membrane alone and controls (wound with no implant). Current study shows that our fabricated construct has a potential as an efficient anti-scarring wound dressing material and may also serve for the subsequent soft tissue engineering needs. Keywords: Human amniotic membrane; Silk fibroin; Bilayer membrane; Hypertrophic scar; Skin substitute


Page 2 of 36

Page 3 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Introduction Hypertrophic scar (HS) is an undesirable skin abnormality characterized by excessive proliferation and accumulation of the collagen and other extracellular matrix (ECM) proteins. They cause some physical and psychological damages to the injured persons 1-2. The wound tension, deep trauma, intensive burn injury and incisions following the surgery are among the common risk factors leading to the HS. A variety of therapeutic modalities are linked to the hypertrophic scarring such as corticosteroid injection, surgical excision, laser therapy, radiotherapy, silicon materials and compression damaged by a physical injury 3. Despite all the current treatment procedures, a favorable nursing is yet to be achieved due to the reports of recurrence and complications regarding the HS 1-2, 4. Many efforts are made to develop a flawless skin scaffold that may mimic the natural skin function and accelerate wound healing processes. At the same time such scaffolds should be inexpensive, easily accessible and reproducible 5. A variety of tissue engineering scaffolds are developed and some of them are commercially available. However, none meets the medical stringent requirements 6-7. Recently, we fabricated and fully characterized a 3D bi-layered dermal substitute made of human amniotic membrane (AM) and electrospun silk fibroin (ESF) to offer an artificial skin substitute for burn wound treatment 5. Amniotic membrane (AM) is a promising wound dressing with multiple advantageous properties such as promoting re-epithelialization, antimicrobial activity and anti-inflammatory characteristics 8-12.

Anti-scarring effects of the AM, such as reduction of protein loss, decrease in pain and

presence of some growth factors and immunomodulators to the injured area are well-documented 13.

However, the rapid degradation and low mechanical strength of the AM still remain as a

concern. We previously revealed that the coating the AM with a natural substance like silk protein fibroin (SF) overcomes such shortcomings 10, 14. SF obtained from Bombyx mori silkworm cocoons 3 ACS Paragon Plus Environment


is widely used in clinical investigations and approved by FDA

14-16.

Page 4 of 36

The beneficial mechanical

properties (toughness and elasticity), biocompatibility, easy manipulation and wound healing potentials make SF an excellent biomaterial for biomedical applications, and wound healing 16. The main aim of this study was to determine whether 3D bilayer AM/ESF membrane can modulate post-wound hypertrophic scar formation in a rabbit ear model and find out the related mechanisms. This hypothesis is based on the robust results obtained from our recent studies on fabrication and application of AM/ESF in burn wound management in vitro and in vivo mouse model5, 14. In line with our observations, we have demonstrated a fast recovery with minimal hypertrophic scar can be achieved with the use of our AM/ESF AM/ESF bilayer constructs.

Materials and Methods Preparation of acellular amniotic membrane (AM)/electrospun silk fibroin (ESF) bilayer membranes Human acellular amniotic membrane (AM) The AM/ESF bilayer membranes were fabricated based on the protocol described in our previous study

14.

Briefly, under sterile condition, the human amniotic membrane was separated from

chorion layer taken from the placenta of caesarian section mothers. All samples were collected according to the World Medical Association Declaration of Helsinki

17.

The candidates were

screened for infection transmission. The separated AM was decellularized using 0.2% EDTA and 0.5 M NaOH, then gently scraped to remove the remained cells. Immunohistochemistry IHC and


Page 5 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


hematoxylin & eosin (H&E) staining were used to confirm the decellularization of human amniotic membrane. The samples were dried and sterilized using irradiation of gamma rays.

Extraction of silk protein fibroin (SF) The SF was extracted and purified from the cocoons of Bombyx mori silkworm as previously described 18. Briefly, the cocoons were degummed by boiling via an aqueous medium containing 0.02M Na2CO3 and the fibers were rinsed entirely to remove silk protein sericin. The degummed SF fibers were dissolved in Lithium Bromide (LiBr) and then dialyzed (MWCOs of 12 KDa) against ultrapure water for two days by changing the water for several times in between. The final solution was freeze-dried and left in room temperature for subsequent steps.

Fabrication of decellularization of human amniotic membrane/electrospun silk fibroin (AM/ESF) membrane The freeze-dried SF was dissolved in formic acid to form a 10 % solution as described previously 18.

The solution was electrospun on dried AM, which was placed on the collector. For this, a 3-ml

syringe containing 10 % silk solution was used for 3 hours to fabricate AM/ESF bilayer membrane under following electrospinning conditions: 18 kV/cm of voltage, a 150 mm distance, and 0.3 ml/h a flow rate. The final product was dried under the vacuum followed by treating with 70% ethanol for 1 hour. Using the same procedure, 70% ethanol treatment was also carried out for AM alone 14.

The fabricated membrane was stored at 4 ºC until further use.



Characterization of bilayer membranes Morphology The AM and AM/ESF were sputter coated with gold and then viewed under scanning electron microscope (SEM) at acceleration voltage of 15kV. The samples were also rotated 90◦ (degree) in SEM chamber to take tilt view micrographs.

Human adipose tissue-derived mesenchymal stem cells (ADSCs) isolation and culture Human adipose tissue-derived mesenchymal stem cells (ADSCs) were used for cell viability and adhesion evaluations. The ADSCs were isolated from human adipose tissue by a procedure described in our earlier study

14.

Briefly, under sterile condition, the tissues were treated with

collagenase II (Sigma, MO, USA) for 30 minutes at 37 °C. Subsequently, the samples were washed with PBS, and at a density of 1 ×105 cells/ml, the cells suspended in DMEM-containing 75 cm2 flasks, supplemented with 10 % FBS, nystatin, 1% pen/strep, amphotericin B, 2 mM Glutamax, 1% non-essential amino acids and 1 mM L-glutamine (all from Gibco, Carlsbad, CA, USA). Then, they were incubated to achieve 90% confluence. Trypan blue assay was used to estimate the number of viable cells.

Cell viability and cytotoxicity For testing cell viability, 2 × 104 cells/cm2 were seeded on the membrane and incubated for 1, 2 and 3 days in cell culture plates. The cells were washed with PBS and treated with tetrazolium salt (MTT, 3-(4, 5-Dimethyl-2-thiazolyl)-2, 5 diphenyl-2H tetrazolium bromide) at 37 °C. Afterwards, 6 ACS Paragon Plus Environment

Page 6 of 36

Page 7 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the cells were again washed with PBS and the tetrazolium crystals were dissolved in DMSO for 15 minutes in the dark. All results were compared against control samples using a plate reader at 590nm. This method was repeated in triplicate 19. Lactate dehydrogenase (LDH) assay was performed to examine the cytotoxicity of the membrane. 1 × 104 cells/well were seeded on the membrane and incubated after 1, 2 and 3 days. Subsequently, samples were subjected to LDH assay kit (Zist Shimi kits, Tehran, Iran) 20. The cells cultured in cell culture plate served as a control.

Cell adhesion The cells were cultured on the membranes (1 × 1 cm) and incubated for 72 hours to investigate the cell adhesion and distribution. The morphology of the spread cells on the membrane were viewed under SEM.

In vivo study Rabbit ear model The rabbit ear model of the hypertrophic scar was described and used previously 4. Briefly, NZW rabbits were purchased from Pasteur Institute of Iran. They were kept in the medical sciences animal house of Iran University under standard condition required by the Ethical Committee. The animals were randomly divided into three experimental groups. Group AM: the wounds dressed with amniotic membrane; Group AM/ESF: the wounds dressed with AM/ESF; and a control group: the wounds with no dressing and no treatment. The animals were anesthetized by intraperitoneal 7 ACS Paragon Plus Environment


injection of ketamine (22.5 mg/kg) and xylazine (2.5 mg/kg) by weight. To achieve full-thickness, 8 mm wounds were created beneath the cartilage on ventral side of each ear using a puncher. Then, the perichondrial part of the cartilage was dissected. Bleeding was controlled by compression (Fig. 1).

Grafting The wounds were dressed by AM and AM/ESF without suturing (Fig. 1). The animals were kept in animal house under standard conditions of ventilation and humidity. After 28 and 50 days, the dressed tissues were collected and subjected for histological (H&E, MT and IHC staining) and molecular (RT-PCR) analyses. [Fig. 1]


Page 8 of 36

Page 9 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. The schematic representation of a human amniotic membrane/electrospun silk fibroin (AM/ESF) engrafting study model. AM was decellularized and freeze-dried. The SF was extracted from mulberry silk Bombyx mori cocoons, characterized and electrospun over the decellularized AM. The cyto-biocompatibility of AM/ESF bilayer membrane for ADSCs was determined in vitro by MTT, LDH and cell adhesion (SEM). The effects of the AM/ESF membrane on prevention of post injury hypertrophic scar formation were examined by grafting the membrane in full-thickness excisional injury in the rabbit ear with a puncher. After 28 and 50 days, the



Page 10 of 36

wounds were analyzed using light microscope, and by histological and molecular evaluations. ADSCs: human adipose tissue-derived mesenchymal stem cells; AM: amniotic membrane; ESF: electrospun silk fibroin; H&E: hematoxylin and eosin; IHC: immunohistochemistry; MT: Masson’s trichrome; SF: silk fibroin; SEM: scanning electron microscope.

Evaluations Macroscopic observations The photographs were utilized to record the size of wounds at days 1, 14, 28 and 50 postimplantations. The following equation (Equation 1) was used to quantify the wound healing/closure for each predetermined period 5. 𝑊𝑜𝑢𝑛𝑑 𝑑𝑖𝑎𝑚𝑒𝑡𝑒𝑟 𝑜𝑛 𝑑𝑎𝑦 0 ― 𝑊𝑜𝑢𝑛𝑑 𝑑𝑖𝑎𝑚𝑒𝑡𝑒𝑟 𝑜𝑛 𝑑𝑎𝑦 𝑛

Wound Closure % = [

𝑊𝑜𝑢𝑛𝑑 𝑑𝑖𝑎𝑚𝑒𝑡𝑒𝑟 𝑜𝑛 𝑑𝑎𝑦 0

] × 100

Equation 1

H&E On days 28 and 50 post-implantation, the animals were sacrificed as described before 5. The samples including the injured and the uninjured skin around it were collected. The samples were fixed in 10% formalin for 48 hours at room temperature. Fixed tissue was paraffin-embedded and cut into 4-μm sections. The sections were then stained with H&E. To assess the wound healing, scar elevation index (SEI), and epidermal thickness index (ETI), 5 areas at the margins and 5 at the core of the wounds were selected as non-overlapping field-of-views. All the scores and numerations were performed separately by 3 blind observers (Fig. 4a).


Page 11 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scar elevation index (SEI) SEI was used for histomorphometry analysis in H&E stained samples as described previously 4, 21. The samples were observed at ×10 magnification. SEI was determined by the following equation (Equation 2): SEI = [

𝑇𝑊𝐷 𝑁𝐷

]

Equation 2

Where TWD = the height of total wound dermis and ND = normal dermis. The height of the adjacent unwounded skin was considered as ND. A SEI of 1 denotes as no scar formation, while, the ratio > 1 indicates a hypertrophic scar.

Epidermal thickness index (ETI) The epidermal hypertrophy degree was determined by ETI based on analysis of H&E samples at ×40 magnification 5. According to the following formula (Equation 3) the ETI was quantified: 𝐻𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑒𝑝𝑖𝑑𝑒𝑟𝑚𝑖𝑠 𝑖𝑛 𝑠𝑐𝑎𝑟 𝑡𝑖𝑠𝑠𝑢𝑒

ETI = [ 𝐻𝑒𝑖𝑔ℎ𝑡 𝑜𝑓 𝑒𝑝𝑖𝑑𝑒𝑟𝑚𝑖𝑠 𝑖𝑛 𝑛𝑜𝑟𝑚𝑎𝑙 𝑢𝑛𝑤𝑜𝑢𝑛𝑑𝑒𝑑 𝑠𝑘𝑖𝑛 ]

Equation 3

The average thickness of scar tissue and epidermal thickness of normal uninjured skin both from five fields were measured for ETI. A ratio of 1 and > 1 represent healing with no scar formation and hypertrophic epidermis, respectively 4.

Masson's trichrome staining 11 ACS Paragon Plus Environment


Page 12 of 36

To evaluate the collagen deposition and its maturation inside the skin, the tissues were harvested on days 28 and 50. The samples were stained with Masson's trichrome and observed under light microscope (Olympus, Japan).

Real time PCR About 50 mg of tissue was collected at days 28 and 50 post-implantations. Using an RNeasy Mini Kit (Cinagen, Iran), the total RNA was extracted according to provider's instruction. The healthy and untreated tissue around the implantation site was considered as control and referred to as "Normal skin" (NS). The waste particles were removed from the samples, dissected to smaller slices and digested using lysis buffer. The RNA was then reverse transcribed to cDNA by a HighCapacity cDNA Archive kit using random hexamer primers (Applied Biosystems, Foster City, CA, USA). A PCR Master Mix (TaKaRa, Dalian, China) was used to determine the relative transcript levels of collagen I, III, active MMP1 and active MMP2 by rotor-gene 6000 tool (Corbett Life Science, Sydney, Australia). According to 2-ΔΔCt, the expression level was assigned. B-actin was used as a housekeeping gene to normalize the relative expression levels of our genes of interest.. The primers used in this study are listed in the Table 1. [Table 1] Table 1. The primers used in RT-PCR analysis Gene name 1

b-actin

2

Collagen I

3

Collagen III

Sequence F: 5΄CTGGAACGGTGAAGGTGACA R:5΄TCAAAGTCCTCGGCCACATT F: 5΄TCGATCCCAACCAAGGATGC R: 5΄CAAACTGGGTGCCACCATTG F: 5΄CACGTTTGGTTTGGAGAGTCC R: 5΄TGCACATCAAGGACATCTTCAG


Product size (bp) 83 177 88

Page 13 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4 5

Matrix metalloproteinase 1 (MMP-1) Matrix metalloproteinase 2 (MMP-2)

F: 5΄ CCTGATGTGGCTCAGTTCGT R:5΄ GTCCACATCTGCCCTTGACA

200

F: 5΄ GCGGTTTTCTCGAATCCACG R: 5΄ GGAATCTCCCCCAACACCAG

145

Immunohistochemistry (IHC) At days 28 and 50 post-implantations, immunohistochemistry (IHC) assay was performed to examine the aggregations and expressions of active MMP1. Through different dilutions of ethanol, slices were rehydrated and by 3 % H2O2, the peroxidase neutralized. The sections were treated by 5 % Bovine Serum Albumin (BSA) for 1 hour to inactivate the nonspecific binding sites and incubated at 4 °C with primary antibodies against MMP1 (Abcam, Cambridge, MA, USA). Polyclonal rabbit/anti-mouse Envision (Dako, Denmark) was utilized for 30 minutes as the secondary antibody. The samples were incubated with a 3,3΄-diaminobenzidine (DAB) solution to be visualized and observed at ×100 magnification under light microscope (Olympus BX51, Olympus, Tokyo, Japan).

Statistical analysis The Tukey test and student's t-test were used to analyze the results. Using SPSS software (Version 16, SPSS Inc., Chicago, IL, USA) the analysis was performed where P0.05). The cells cultured on tissue culture plate served as controls. ADSCs: human adipose tissue-derived mesenchymal stem cells: AM: amniotic membrane; ESF: electrospun silk fibroin; SF: silk fibroin. A p-value 0.05). LDH assay exhibited that the membranes had no cytotoxic behavior when compared to controls (p>0.05).

Cell adhesion The morphology of the ADSCs attached to the surface of the AM/ESF (ESF side) is shown in Figure 2b). As observed, the cells were attached, grown, and spread well on the SF nanofibers.

In vivo evaluations


Page 16 of 36

Page 17 of 36 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The AM/ESF bilayer membranes were implanted to the excisional wound created on the ear of the rabbits. After various treatment intervals, the effects of grafting on wound healing and hypertrophic scar (HS) formation were evaluated by histological and molecular examinations.

Macroscopic observations The Figure 3a shows macroscopic images of the wounds on days 1, 5, 14, 28 and 50 postwounding. Both AM- and AM/ESF-implanted wounds showed a significant decrease in wound size compared to the control (p

Modulation of hypertrophic scar formation using amniotic membrane

Recommend Documents