Molecular Beacon-Based Fluorescent Assay for Specific Detection of

Apr 30, 2015 - Oversulfated chondroitin sulfate (OSCS) is a harmful contaminant in the pharmaceutical heparin. The development of a rapid, convenient,...
0 downloads 5 Views 870KB Size
Download PDF
Letter pubs.acs.org/ac

Molecular Beacon-Based Fluorescent Assay for Specific Detection of Oversulfated Chondroitin Sulfate Contaminants in Heparin without Enzyme Treatment Chih-Yi Lee† and Wei-Lung Tseng*,†,‡ †

Department of Chemistry, National Sun Yat-sen University, 70, Lien-hai Road, Kaohsiung 80424, Taiwan School of Pharmacy, College of Pharmacy, Kaohsiung Medical University, 100, Shih-Chuan 1st Road, Kaohsiung 80708, Taiwan

‡

S Supporting Information *

ABSTRACT: Oversulfated chondroitin sulfate (OSCS) is a harmful contaminant in the pharmaceutical heparin. The development of a rapid, convenient, sensitive, and selective method is required for routine analysis of OSCS in pharmaceutical heparin. Here we report a simple, rapid, sensitive, and enzyme-free method for detecting OSCS in heparin based on the competitive binding between OSCS and the adenosine-repeated molecular beacon (MB) stem to coralyne in the presence of Ca2+ ions. The MB (A8−MB− A8) contains a 22-mer loop, a stem of a pair of 8-mer adenosine (A) bases, a fluorophore unit at the 5′-end, and a quencher at the 3′-end. The presence of coralyne promotes these A−A mismatches to form a hairpin-shaped MB. However, this kind of MB is incapable of differentiating between heparin and OSCS because they both exhibit strong electrostatic attraction with coralyne. This study found that while Ca2+ ions can efficiently suppress the negative charges of heparin, they do not neutralize the negative charge of OSCS. Thus, in the presence of Ca2+ ions, OSCS can remove coralyne from the MB stem, initiating fluorescence of the MB. Under optimal conditions (10 nM A8−MB−A8, 800 nM coralyne, and 0.5 mM Ca2+ ions), the proposed system can detect 0.01% w/w OSCS in heparin in under 5 min without enzyme treatment. This study also validates the practicality of the proposed system to determine 0.01% w/w OSCS in the pharmaceutical heparin.

H

because of its simplicity, fast detection speed, high sensitivity, and high selectivity. Sommers et al. reported that the combination of water-soluble cationic polythiophene polymer and heparinase digestion of heparin enabled colorimetric detection of 0.003% (w/w) OSCS in the presence of heparin.10 Tami et al. developed a simple and sensitive method to detect 0.16% w/w OSCS in commercial lots of heparin based on OSCS-induced inhibition of the Taq polymerase activity in realtime polymer chain reaction.11 Recently, Kalita et al. modified citrate-capped gold nanoparticles with fluorescent dye-conjugated heparin and observed a remarkable reduction in the fluorescence of the dye through nanometal surface energy transfer.12 The presence of heparinase restored the fluorescence of the dye, whereas the addition of OSCS to heparinase resulted in diminished fluorescence recovery; this fluorescent sensor can detect as low as 1 × 10−9 % w/w OSCS in heparin. Although these enzyme-based sensors provide sensitive and selective detection of OSCS in heparin, they exhibit certain weaknesses. First, the activity of heparinase is sensitive to

eparin, a highly sulfated glycosaminoglycan polysaccharide, is the most reliable and widely prescribed anticoagulant drug. Clinically, heparin provides an inexpensive, natural, well-tolerated, and effective treatment for several clotting disorders such as venous thromboembolism and acute coronary syndromes and for thrombosis during anticoagulant therapy and surgery.1,2 However, in 2007 and 2008, the administration of contaminated heparin lots caused severe and acute adverse events within several minutes, including allergic- or hypersensitivity-type reactions. The main contaminant in heparin caused at least 149 deaths in several countries and was later identified as oversulfated chondroitin sulfate (OSCS).3 Considering that OSCS induces several adverse effects, a rapid, convenient, and sensitive method is required for routine analysis of OSCS content in pharmaceutical heparin. Current methods for the identification of OSCS-contaminated heparin include proton nuclear magnetic resonance spectrometry,3 strong anion exchange chromatography,4 capillary zone electrophoresis,5 polyacrylamide gel electrophoresis,6 liquid chromatography−mass spectrometry,7 nearinfrared reflectance and Raman spectroscopy,8 and electrochemical methods.9 Alternatively, chromophores and fluorophores are promising tools for sensing OSCS in heparin © XXXX American Chemical Society

Received: February 16, 2015 Accepted: April 30, 2015

A

DOI: 10.1021/acs.analchem.5b00692 Anal. Chem. XXXX, XXX, XXX−XXX

Letter

Analytical Chemistry

polysaccharides (3.6 μg/mL, 200 μL) at ambient temperature. Polysaccharides include OSCS, heparin, DS, Chs, and HA. After 0−30 min, the mixed solutions were transferred separately into a 1 mL cuvette. Their fluorescence spectra were recorded by operating the fluorescence spectrophotometer at an excitation wavelength of 480 nm. For the quantification of OSCS in heparin, standard heparin solutions (9 μg/mL) were mixed with a series of OSCS standards from 0.9 ng/mL (0.01% w/w) to 1.8 μg/mL (20% w/w). The mixture (200 μL) was incubated with a solution (200 μL) containing 10 mM Tris (pH 7.5), 0.5 mM CaCl2, 20 nM MB, and 1600 nM coralyne at ambient temperature for 5 min. Analysis of OSCS in Pharmaceutical Heparin. Pharmaceutical heparin samples (5000 U/mL, 765 mg/mL) were obtained from Nang Kuang Pharmaceutical Co., Ltd. (Hepac, Tainan, Taiwan). These samples were diluted with deionized water in stock solutions. The diluted samples (180 μg/mL) were spiked with OSCS standard from 0.018 μg/mL (0.01% w/ w) to 9 μg/mL (5% w/w). We incubated the spiked samples (200 μL) with a solution (200 μL) containing 10 mM Tris (pH 7.5), 0.5 mM CaCl2, 20 nM MB, and 1600 nM coralyne at ambient temperature for 5 min and recorded their fluorescence spectra at an excitation wavelength of 480 nm.

environmental changes. Second, heparinase is expensive and requires rigorous temperature and humidity controls. Third, enzyme-based sensors require a long incubation period to allow interaction between heparinase/Taq polymerase treatment and OSCS, slowing the overall time to detection. The development of molecular beacon (MB)-related sensors for highly sensitive detection of target DNA molecules, proteins, and enzyme systems is still of great interest to many researchers due to their simplicity, rapidity, specificity, and sensitivity. 13−16 Recently, an MB consisting of stable adenosine2−coralyne−adenosine2 (A2−coralyne−A2) complexes in the stem was designed for sensitive, selective, and rapid detection of heparin in plasma.17 Because heparin exhibits stronger electrostatic attraction with coralyne than polyadenosine does, the presence of heparin was capable of removing coralyne from the MB stem and activated its fluorescence. However, an A2−coralyne−A2-based MB is incapable of discriminating between OSCS and heparin because they have similar affinity for coralyne. The aim of this study is to develop a nonenzymatic MB sensor for convenient and sensitive detection of OSCS in heparin. Figure S1 (Supporting Information) shows the chemical structures of coralyne, OSCS, heparin, dermatan sulfate (DS), chondroitin sulfate A (Chs), and hyaluronic acid (HA). Previous studies reported that Ca2+ ions were specific to interact with the 6-sulfate and N-sulfamido groups of the glucosamine ring and carboxylate group of the iduronate ring in heparin, reflecting that the binding of heparin to Ca2+ ions is primarily due to site-specific interaction, rather than electrostatic attraction.18,19 Because OSCS contains more sulfate groups than heparin, we hypothesized that the OSCS−Ca2+ complexes have more negatively charged sites than the heparin−Ca 2+ complexes. As a result, the OSCS−Ca 2+ complexes could be more effective to compete with coralyne on the stem of an A2−coralyne−A2-based MB than the heparin−Ca2+ complexes. In other words, Ca2+ ions act a masking agent for heparin when an A2−coralyne−A2-based MB is used for selective and quantitative determination of OSCS.

■

RESULTS AND DISCUSSION The sensing probe (A 8 −CATCATAGTCCAGTGTCCAGGG−A8) with a 22-mer loop and a stem of a pair of 8-mer A bases was labeled at the 5′-end with a carboxyfluorescein (FAM) reporter and at the 3′-end with a 4-([4(dimethylamino)phenoyl]azo)-benzoic acid (DABCYL) quencher. The presence of coralyne enables A8−MB−A8 to form a stable stem-loop structure through the A2−coralyne−A2 coordination, causing collisional quenching of fluorescence between FAM and DABCYL. In the absence of Ca2+ ions, heparin and OSCS both show stronger binding to coralyne than does the A8−MB−A8 probe. Thus, both heparin and OSCS remove coralyne from the stem of A8−MB−A8, switching on its fluorescence (Figure 1A). When Ca2+ ions are added to a solution containing heparin and OSCS, the Ca2+ ions function as a masking agent and only OSCS exhibits strong electrostatic attraction with coralyne. The subsequent formation of OSCS−coralyne complexes restores the fluorescence of A8−MB−A8 (Figure 1B). We initially compared the selectivity of a hairpin-shaped MB in the absence and presence of Ca2+ ions. Upon addition of 800 nM coralyne to a solution containing 10 nM A8−MB−A8 and 10 mM Tris-HCl (pH 7.5), more than 90% fluorescence quenching occurred as a result of a coralyne-induced conformation change in A8−MB−A8 (curves a and b in Figure 2A). The reaction of 1.8 μg/mL heparin with a hairpin-shaped MB resulted in an obvious increase (85% recovery) in the FAM fluorescence (curve c in Figure 2A). Under the same conditions, OSCS caused slightly better recovery (92%) in the FAM fluorescence than heparin (curve d in Figure 2A). This is primarily because OSCS has more negatively charged sites than heparin does. These results clearly indicate that a hairpin-shaped MB is incapable of sensing OSCS in the presence of heparin. In the presence of 0.5 mM Ca2+ ions, coralyne still quenched the FAM fluorescence of A8−MB−A8 (curves a and b in Figure 2B). This result reflects that coralyne can promote A−A mismatches to form stable hairpin-shaped MB even in the presence of a high concentration of Ca2+ ions.

■

EXPERIMENTAL SECTION Chemicals. Tris(hydroxymethyl)aminomethane (Tris), sodium chloride (NaCl), calcium chloride (CaCl2), coralyne sulfoacetate, heparin (sodium salt, MW 17 000−19 000, from porcine intestinal mucosa), dextran sulfate (sodium salt, from Leuconostoc spp.), Chs (sodium salt, from bovine trachea), HA (sodium salt, from bovine vitreous humor), and DS (sodium salt, from porcine intestinal mucosa) were purchased from Sigma-Aldrich (St. Louis, MO). OSCS (sodium salt, from impure heparin sodium) was obtained from SERVA Electrophoresis GmbH (Heidelberg, Germany). All DNA samples were ordered from NeogeneBiomedicals Corporation (Taipei, Taiwan). Milli-Q ultrapure water (Hamburg, Germany) was used in all of the experiments Apparatus. Fluorescence spectra were recorded using a Hitachi F-7000 fluorometer (Hitachi, Tokyo, Japan). Circular dichrosim (CD) was performed on a JASCO model J-815 CD spectropolarimeter (JASCO, Tokyo, Japan). Sample Preparation. All polysaccharides and MB were dissolved in a solution containing 10 mM Tris (pH 6.5−12.5), CaCl2 (0−5 mM), and NaCl (0−50 mM). The MB probes (40 nM, 100 μL) were incubated with a mixture of coralyne (3200 nM, 100 μL) at ambient temperature for 5 min. The resulting solutions (200 μL) were mixed with different concentrations of B

DOI: 10.1021/acs.analchem.5b00692 Anal. Chem. XXXX, XXX, XXX−XXX

Letter

Analytical Chemistry

Upon addition of 1.8 μg/mL heparin to a solution containing 0.5 mM Ca2+ and 10 nM hairpin-shaped MB, we observed a slight recovery (17%) in the FAM fluorescence (curve c in Figure 2B). By contrast, 1.8 μg/mL OSCS activated 92% recovery in the fluorescence of the A8−MB−A8·coralyne·Ca2+ probe (curve d in Figure 2B), signifying that this MB can differentiate between OSCS and heparin. Figure 2C reveals the time-dependent fluorescence changes upon treatment of the A8−MB−A8·coralyne·Ca2+ probe with a fixed concentration of heparin and OSCS. The value of (IF − IF0)/IF0 progressively increased with time and leveled off after 15 min. IF0 and IF correspond to the fluorescence intensity of the A8−MB−A8· coralyne·Ca2+ probe at 520 nm in the absence and presence of anionic polysaccharide. When heparin was used in place of OSCS, we observed a slight change in the (IF − IF0)/IF0 value with time. To reduce the analysis time, the incubation time of anionic polysaccharide and the proposed system was optimized to 5 min. Figure 2D shows that the presence of heparin produced a small negative band around 320 nm in the CD spectrum of the A8−MB−A8·coralyne·Ca2+ probe, implying that heparin only induces a small change in the conformation of the MB probe. In contrast, the addition of OSCS to a solution of the A8−MB− A8·coralyne·Ca2+ probe resulted in the formation of a negative band around 248 nm and a positive band around 303 nm, suggesting that the conformation of the proposed system undergoes a dramatic change in the presence of OSCS. In the presence of Ca2+ ions, the fluorescence intensity at 520 nm obtained from the analysis of 0.72 μg/mL OSCS was higher than that obtained from the analysis of 9.0 μg/mL heparin,

Figure 1. Cartoon of coralyne-induced formation of hairpin-shaped MB for turn-on fluorescence detection of heparin and OSCS in the (A) absence and (B) presence of Ca2+ ions.

Figure 2. (A) Fluorescence spectra of solutions of (a) MB, (b) coralyne-bound MB, (c) coralyne-bound MB and heparin, and (d) coralyne-bound MB and OSCS. (B) Fluorescence spectra of solutions of (a) MB, (b) coralyne-bound MB, (c) coralyne-bound MB and heparin, and (d) coralynebound MB and OSCS in the presence of Ca2+ ions. (C) Time course measurement of fluorescence intensity (520 nm) of the A8−MB−A8·coralyne· Ca2+ probe upon the addition of heparin and OSCS. (D) CD spectra of the A8−MB−A8·coralyne·Ca2+ probe (a) before and (b, c) after the addition of (b) heparin and (c) OSCS. A mixture of 10 nMA8−MB−A8 and 0.8 μM coralyne was incubated in (A) 10 mM Tris-HCl (pH 7.5) and (B, C) 10 mM Tris-HCl and 0.5 mM Ca2+ ions for 5 min. The incubation time between the A8−MB−A8·coralyne·Ca2+ probe and 1.8 μg mL−1 anionic polysaccharide was (A, B, D) 15 min and (C) 5 min. The concentrations of MB, coralyne, OSCS, heparin, and Ca2+ ions in (D) are 20 μM, 1.5 mM, 3600 μg mL−1, 3600 μg mL−1, and 200 mM, respectively. C

DOI: 10.1021/acs.analchem.5b00692 Anal. Chem. XXXX, XXX, XXX−XXX

Letter

Analytical Chemistry suggesting that the selectivity of the A8−MB−A8·coralyne·Ca2+ probe is more than 10-fold for OSCS over heparin (Figure S2, Supporting Information). When the same concentrations of OSCS and heparin were separately added to the A8−MB−A8· coralyne probe in the absence of Ca2+ ions, they caused a similar increase in the fluorescence intensity at 520 nm (Figure S3, Supporting Information). Compared to OSCS, Ca2+ ions efficiently suppress electrostatic attraction between the A8− MB−A8·coralyne complex and heparin. These results provided another line of evidence for Ca2+-induced improvement in the selectivity of the A8−MB−A8·coralyne complex for OSCS. This study subsequently investigated the effects of the stem length, various metal ions, and the Ca2+ concentration on the selectivity of the proposed system, as measured by monitoring the (IF − IF0)/IF0 value. The A8−MB−A8·coralyne·Ca2+ probe provided more sensitivity for OSCS than other MB probes, while all MB probes have similar response to heparin, DS, Chs, and HA (Figure 3A). Because the binding affinity of the MB

ions for sensing OSCS was found to be 0.5 mM. To exclude the effect of chloride anions on the selectivity of the proposed system, CaCl2 was replaced by other calcium salts. Figure 3D shows that the proposed system still offered high selectivity for OSCS in the presence of either CaCO3 or Ca(NO3)2. To confirm that the A8−MB−A8·coralyne·Ca2+ probe is selective to highly sulfated polysaccharides, dextran sulfate was also tested in this study. We note that dextran sulfate has more negative charges sites than OSCS. Figure S4 (Supporting Information) shows that dextran sulfate was more efficient to switch on the fluorescence of the MB probe than OSCS, signifying that the sensing mechanism of the proposed system for OSCS is indeed based on strong electrostatic attraction between coralyne and OSCS in the presence of Ca2+. Previous studies have reported that the main constituents of OSCS-contaminated heparin samples are heparin, OSCS, and DS.5,20,21 Thus, we suggest that OSCS has the highest charge density of all of the polysaccharides found in OSCS-contaminated heparin samples. In other words, the proposed system is well-suited to detect OSCS in pharmaceutical heparin. Under optimal conditions (10 nM A8−MB−A8, 800 nM coralyne, and 0.5 mM Ca2+ ions), quantification of OSCS in heparin was performed using the proposed system. Standard heparin solutions (9 μg/mL) were mixed with a series of concentrations of OSCS ranging from 0.9 ng/mL (0.01% w/w) to 1.8 μg/mL (20% w/w), producing 10 separate tests. As the concentration of OSCS increased at a fixed concentration of heparin, the fluorescence of the proposed probe and the (IF2 −IF1)/IF1 values were progressively enhanced (Figure 4). IF1 and IF2 represent the fluorescence intensity of the A8−MB−A8· coralyne·Ca2+ probe at 520 nm in the absence and presence of OSCS at a fixed concentration of heparin. The proposed probe was capable of detecting as low as 0.01% w/w OSCS in heparin within 5 min. The relative standard deviations (RSDs) of the (IF2 − IF1)/IF1 values at three concentration levels (0.01, 0.1, and 1% w/w OSCS in heparin) were less than 3%, signifying that the proposed system is highly reproducible for detecting OSCS in heparin. The sensitivity and analysis time of the proposed system is superior to that of other reported methods, including electrophoresis- and chromatography-based techniques,22 proton nuclear magnetic resonance spectrometry,6 nearinfrared reflectance and Raman spectroscopy,8 mass spectrometry-based methods,23 and sensors9−12,24−27 (Table S1, Supporting Information). Although the sensitivity of the proposed method is not comparable to that of the gold nanoparticle-based fluorescent sensor,18 this method can discriminate between OSCS and heparin without enzymatic treatment. The feasibility of the proposed system for sensing trace levels of OSCS contaminants in pharmaceutical heparin was, therefore, validated. OSCS-contaminated heparin samples were obtained by mixing OSCS standards with pharmaceutical heparin samples. Note that there are not commercially available OSCS-contaminated heparin samples. Progressive decreases in the fluorescence of the proposed probe and the (IF2 − IF1)/IF1 values were observed after commercial heparin samples were spiked with various concentrations of OSCS from 0.9 ng/mL (0.01% w/w) to 0.45 μg/mL (5% w/w) (Figure S5, Supporting Information). The lowest detectable concentration of OSCS in commercial heparin was found to be 0.01% w/w. The RSDs of the (IF2 − IF1)/IF1 values at 0.01, 0.1, and 1% w/w OSCS in commercial heparin were smaller than 3%. These results suggest that the proposed system is robust and reliable for

Figure 3. (A) The (IF − IF0)/IF0 value of the An−MB−An·coralyne· Ca2+ probe after the addition of 1.8 μg mL−1 anionic polysaccharide. (B−D). Effect of (B) metal ions, (C) the concentration of Ca2+ ions, and (D) calcium salts on the (IF − IF0)/IF0 value of the A8−MB−A8· coralyne·Ca2+ probe in the presence of 1.8 μg mL−1 anionic polysaccharide. (A−D) A mixture of 10 nM A8−MB−A8 and 0.8 μM coralyne was incubated in 10 mM Tris-HCl and 0.5 mM Ca2+ ions for 5 min. The incubation time between the A8−MB−A8·coralyne· Ca2+ probe and anionic polysaccharide was 5 min. The error bars represent standard deviations based on three independent measurements.

stem to coralyne increased upon increasing the stem length, OSCS-induced removal of coralyne from the short stem is easier than that from the long stem. As indicated in Figure 3B, compared to other metal ions, the MB probe containing Ca2+ ions was only capable of differentiating between OSCS and heparin. Evidently, Ca2+ ions are more effective to reduce the negative charge of heparin than to reduce those of OSCS, enabling the MB probe to selectively detect OSCS. This result is consistent with the finding of Rabenstein and co-workers that heparin had higher affinity for Ca2+ ions than Mg2+ ions.18 This is mainly because Ca2+ ions bind site-specifically to heparin, and Mg2+ ions exhibit electrostatic attraction with heparin. Figure 3C reveals that the (IF − IF0)/IF0 values for heparin, DS, Chs, and HA remarkably decreased as the concentration of Ca2+ increased, except for OSCS. The optimal concentration of Ca2+ D

DOI: 10.1021/acs.analchem.5b00692 Anal. Chem. XXXX, XXX, XXX−XXX

Letter

Analytical Chemistry

Figure 4. (A) Fluorescence spectra of solutions of 10 nM A8−MB−A8, 0.8 μM coralyne, and 0.5 mM Ca2+ ions upon the addition of a mixture of 0.9−1800 ng mL−1 OSCS and 9 μg mL−1 heparin. (B) The (IF2 − IF1)/IF1 value of the A8−MB−A8·coralyne·Ca2+ probe after the addition of a mixture of 0.9−1800 ng mL−1 OSCS and 9 μg mL−1 heparin. The error bars represent standard deviations based on three independent measurements. (5) Volpi, N.; Maccari, F.; Suwan, J.; Linhardt, R. J. Electrophoresis 2012, 33, 1531−1537. (6) Zhang, Z.; Li, B.; Suwan, J.; Zhang, F.; Wang, Z.; Liu, H.; Mulloy, B.; Linhardt, R. J. J. Pharm. Sci. 2009, 98, 4017−4026. (7) Li, G.; Cai, C.; Li, L.; Fu, L.; Chang, Y.; Zhang, F.; Toida, T.; Xue, C.; Linhardt, R. J. Anal. Chem. 2013, 86, 326−330. (8) Spencer, J. A.; Kauffman, J. F.; Reepmeyer, J. C.; Gryniewicz, C. M.; Ye, W.; Toler, D. Y.; Buhse, L. F.; Westenberger, B. J. J. Pharm. Sci. 2009, 98, 3540−3547. (9) Wang, L.; Buchanan, S.; Meyerhoff, M. E. Anal. Chem. 2008, 80, 9845−9847. (10) Sommers, C. D.; Mans, D. J.; Mecker, L. C.; Keire, D. A. Anal. Chem. 2011, 83, 3422−3430. (11) Tami, C.; Puig, M.; Reepmeyer, J. C.; Ye, H.; D’Avignon, D. A.; Buhse, L.; Verthelyi, D. Biomaterials 2008, 29, 4808−4814. (12) Kalita, M.; Balivada, S.; Swarup, V. P.; Mencio, C.; Raman, K.; Desai, U. R.; Troyer, D.; Kuberan, B. J. Am. Chem. Soc. 2013, 136, 554−557. (13) Wang, K.; Tang, Z.; Yang, C. J.; Kim, Y.; Fang, X.; Li, W.; Wu, Y.; Medley, C. D.; Cao, Z.; Li, J.; Colon, P.; Lin, H.; Tan, W. Angew. Chem., Int. Ed. 2009, 48, 856−870. (14) Li, J. J.; Geyer, R.; Tan, W. Nucleic Acids Res. 2000, 28, e52. (15) Li, J.; Yan, H.; Wang, K.; Tan, W.; Zhou, X. Anal. Chem. 2007, 79, 1050−1056. (16) Dai, N.; Kool, E. T. Chem. Soc. Rev. 2011, 40, 5756−5770. (17) Kuo, C.-Y.; Tseng, W.-L. Chem. Commun. 2013, 49, 4607−4609. (18) Rabenstein, D. L.; Robert, J. M.; Peng, J. Carbohyd. Res. 1995, 278, 239−256. (19) Chevalier, F.; Lucas, R.; Angulo, J.; Martin-Lomas, M.; Nieto, P. M. Carbohydr. Res. 2004, 339, 975−983. (20) Beyer, T.; Matz, M.; Brinz, D.; Radler, O.; Wolf, B.; Norwig, J.; Baumann, K.; Alban, S.; Holzgrabe, U. Eur. J. Pharm. Sci. 2010, 40, 297−304. (21) Zang, Q.; Keire, D. A.; Wood, R. D.; Buhse, L. F.; Moore, C. M.; Nasr, M.; Al-Hakim, A.; Trehy, M. L.; Welsh, W. J. Anal. Chem. 2011, 83, 1030−1039. (22) Aich, U.; Shriver, Z.; Tharakaraman, K.; Raman, R.; Sasisekharan, R. Anal. Chem. 2011, 83, 7815−7822. (23) Brustkern, A. M.; Buhse, L. F.; Nasr, M.; Al-Hakim, A.; Keire, D. A. Anal. Chem. 2010, 82, 9865−9870. (24) Alban, S.; Lühn, S.; Schiemann, S. Anal. Bioanal. Chem. 2011, 399, 681−690. (25) Lühn, S.; Schiemann, S.; Alban, S. Anal. Bioanal. Chem. 2011, 399, 673−680. (26) Bairstow, S.; McKee, J.; Nordhaus, M.; Johnson, R. Anal. Biochem. 2009, 388, 317−321. (27) Kang, Y.; Gwon, K.; Shin, J. H.; Nam, H.; Meyerhoff, M. E.; Cha, G. S. Anal. Chem. 2011, 83, 3957−3962.

routine screening of trace levels of OSCS impurities in commercial heparin lots.

■

CONCLUSION We have developed an adenosine-based MB for sensing OSCS in heparin based on the ability of OSCS to remove coralyne from the MB stem in the presence of Ca2+ ions. The proposed system can detect 0.01% w/w OSCS in heparin. Compared to other reported methods for the determination of OSCS in heparin, this assay provides numerous distinctive advantages, including high sensitivity, high selectivity, short analysis time, simplicity, and no need for the addition of expensive enzymes. The proposed system has been successfully applied for the determination of OSCS in commercial heparin samples, further demonstrating its value in practical applications.

■

ASSOCIATED CONTENT

S Supporting Information *

Additional detailed information as noted in the text. The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.analchem.5b00692.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Fax: 011-886-7-3684046. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We would like to thank the Ministry of Science and Technology (NSC Grant 100-2628-M-110-001-MY4) for the financial support of this study.

■

REFERENCES

(1) Warkentin, T. E.; Levine, M. N.; Hirsh, J.; Horsewood, P.; Roberts, R. S.; Gent, M.; Kelton, J. G. N. Engl. J. Med. 1995, 332, 1330−1336. (2) Girolami, B.; Girolami, A. Semin. Thromb. Hemost. 2006, 32, 803−809. (3) Guerrini, M.; Beccati, D.; Shriver, Z.; Naggi, A.; Viswanathan, K.; Bisio, A.; Capila, I.; Lansing, J. C.; Guglieri, S.; Fraser, B.; Al-Hakim, A.; Gunay, N. S.; Zhang, Z.; Robinson, L.; Buhse, L.; Nasr, M.; Woodcock, J.; Langer, R.; Venkataraman, G.; Linhardt, R. J.; Casu, B.; Torri, G.; Sasisekharan, R. Nat. Biotechnol. 2008, 26, 669−675. (4) Trehy, M. L.; Reepmeyer, J. C.; Kolinski, R. E.; Westenberger, B. J.; Buhse, L. F. J. Pharm. Biomed. Anal. 2009, 49, 670−673. E

DOI: 10.1021/acs.analchem.5b00692 Anal. Chem. XXXX, XXX, XXX−XXX