Multiplexed Electrochemical Detection of MiRNAs from Sera of Glioma

Subscriber access provided by UNIVERSITY OF THE SUNSHINE COAST

Article

Multiplexed Electrochemical Detection of MiRNAs from Sera of Glioma Patients at Different Stages via the Novel Conjugates of Conducting Magnetic Microbeads and Diblock Oligonucleotide-Modified Gold Nanoparticles Jingrui Wang, Zhixuan Lu, Hailin Tang, Ling Wu, Zixiao Wang, Minghua Wu, Xinyao Yi, and Jianxiu Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.7b02342 • Publication Date (Web): 28 Sep 2017 Downloaded from http://pubs.acs.org on September 29, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Analytical Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Multiplexed Electrochemical Detection of MiRNAs from Sera of Glioma Patients at Different Stages via the Novel Conjugates of Conducting Magnetic Microbeads and Diblock Oligonucleotide-Modified Gold Nanoparticles Jingrui Wang,a§ Zhixuan Lu,a§ Hailin Tang,b§ Ling Wu,a Zixiao Wang,a Minghua Wu,c Xinyao Yi,a* and Jianxiu Wanga* a

College of Chemistry and Chemical Engineering, Central South University, Changsha, Hunan, 410083, P. R. China SunYat-Sen University Cancer Center, State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Guangzhou, Guangdong, 510060, P. R. China c Cancer Research Institute, Central South University, Changsha, Hunan, 410013, P. R. China b

ABSTRACT: MicroRNAs (miRNAs) serve as diagnostic and prognostic biomarkers for a wide variety of cancers. Via the novel conjugates of gold nanoparticle-coated magnetic microbeads (AuNP-MMBs) and the diblock oligonucleotide (ODN)-modified AuNPs, multiplexed electrochemical assay of miRNAs was performed. The hybridization to target miRNAs leads to the conformational change of the hairpin-structured ODN probes, and the attachment of the diblock ODN-modified AuNPs was achieved. By examining the oxidation peak currents of methylene blue (MB) and ferrocene (Fc) moieties residing on the diblock ODNs, simultaneous quantification of miRNA-182 and miRNA-381 was conducted. The detection signals were significantly enhanced due to the numerous MB and Fc tags on the AuNPs. The proposed assay was highly selective for discriminating miRNAs with similar sequences and detection limits of 0.20 fM and 0.12 fM for miRNA-182 and miRNA-381, respectively, were achieved. The feasibility of the method for sensitive determination of miRNA-182 and miRNA-381 from serum samples of glioma patients at different stages was demonstrated. The sensing protocol thus holds great potential for early diagnosis and treatment of cancer patients. MicroRNAs (miRNAs) are single-stranded, endogenous, and nonprotein-coding RNAs with the typical length of 17−25 nucleotides.1-3 The expression of miRNAs is closely related to the regulation and progression of numerous cancers, and their expression levels could provide useful information on the diagnosis, classification, and treatment of cancer patients.2,4-6 However, due to the short and highly homologous sequences and the low abundance of miRNAs, the development of ultrasensitive, highly selective and high-throughput methods for assay of miRNAs from biological samples still remains extremely challenging.3,7 Because various miRNA sequences are involved in the development and progression of cancer diseases, multiplexed assay of miRNAs is beneficial for disease diagnosis and drug discovery.2,8 Due to their high sensitivity, in-situ capability and fast response time, fluorescence methods have attracted much attention with respect to their applications in multiplexed miRNA assay.9-11 Through isothermal strand-displacement polymerase reaction and fluorescence resonance energy transfer (FRET), sensitive and selective quantification of miRNA-16, miRNA21 and miRNA-26a was conducted.12 By integrating duplexspecific nuclease-induced amplification with cationic conjugated polymer materials, FRET-based visual detection of multiple miRNAs has been performed by Cheng and coworkers.13 Jin et al. presented a homogeneous multiplexed miRNA FRET assay in which the fluorescence detection of miRNA-20a, miRNA-20b and miRNA-21 at concentrations between 0.05 and 0.5 nM in a single 150 µL-sample was achieved.14 Using the xMAP array coupled with the stem-loop probes via one-

step hybridization, fluorescence measurement of nonsmall cell lung cancer biomarkers of miRNA-21, miRNA-222, miRNA20a and miRNA-223 was carried out.15 Though multiplexing capability was achieved, the fluorescence methods for miRNA assay possess certain limitations, such as photobleaching and blinking of the fluorophores.16 Furthermore, the FRET assay was affected by several factors, such as the FRET efficiency, the quantum yield of the donor and the extinction coefficient of the acceptor.17 Electrochemical methods are simple, sensitive, and involve reduced power requirements.18 Sensitive electrochemical detection of miRNA-141 and miRNA-21 from prostate carcinoma and breast cancer cell lysates was conducted via duplexspecific nuclease-assisted target recycling signal amplification.19 Though the detection limits of 4.2 and 3.0 fM for miRNA-141 and miRNA-21 were achieved, respectively, the signal attenuation strategy is prone to cause false-positive signals. Using p19 viral protein as a capture receptor, enzymeamplified assay for sensing breast cancer-related miRNA-21 and miRNA-205 was proposed and the detection limits of 0.6 nM were attained.20 However, the sensing approaches are not sensitive enough and involve enzymes, which are unstable and easily denatured. Glioma is the most common primary brain tumor, characterized by the well-defined genetic alterations and chromosomal aberrations.21 MiRNA-182 and miRNA-381, serving as oncogenes and biomarkers, are involved in the pathogenesis of gliomas.22, 23 In this work, a sensing protocol for multiplexed electrochemical detection of miRNA-182 and miRNA-381 has

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

been proposed via combination of AuNP-MMBs and diblock ODN-modified AuNPs. The diblock ODN that comprises polyA anchoring block and the recognition block was used to improve and modulate the hybridization efficiency. As stated by Pei et al., the polyA block was adsorbed on the AuNPs with high affinity comparable to Au-S chemistry.24 The polyA block-modified AuNPs possessed remarkable stability toward salt-induced aggregation.24 Furthermore, the appended recognition block on the diblock ODN-modified AuNPs adopted a more extended and upright conformation than that of the thiolated ODN anchored on the AuNPs, which favors hybridization and improves the hybridization efficiency.24 The AuNPMMBs served as an immobilization matrix for the hairpin ODN probes, while the diblock ODN-modified AuNPs bearing different redox tags were used as signal transducers. By measuring the oxidation signals of MB and Fc tags, ultrasensitive and selective assay of miRNA-182 and miRNA-381 in serum samples from glioma patients at different stages was performed. EXPERIMENTAL SECTION Chemicals and Materials. KClO4, KH2PO4, K2HPO4, MgCl2, NaCl, HAuCl4·3H2O, H2O2, NaBH4, poly(vinyl alcohol), absolute ethyl alcohol, 6-mercapto-1-hexanol (MCH), bovine serum albumin (BSA), and 2-aminoethanethiol were acquired from Sigma-Aldrich (St. Louis, MO). Magnetic microbeads (Dynabeads® M-270 Carboxylic Acid) with a mean diameter of 2.6 µm were obtained from Invitrogen (CA, USA). HPLC-purified, synthetic miRNAs were purchased from GenePharma Co., Ltd. (Shanghai, China). Except that diblock ODN 1 with MB tags was obtained from Takara Biotechnology Co. Ltd. (Dalian, China), other ODNs were acquired from Sangon Biotech Co., Ltd. (Shanghai, China). The sequences of hairpin ODN probe 1, hairpin ODN probe 2, miRNAs, diblock ODN 1, and diblock ODN 2 were listed in Table 1 (mismatched bases underlined). All solutions were prepared with diethypyrocarbonate (DEPC)-treated deionized water in an RNase-free environment. The DEPC-treated deionized water was purchased from Sangon Biotech Co., Ltd. (Shanghai, China), and was prepared by treating the water with 0.1 % (v/v) DEPC for 2 h at 37 °C, followed by autoclaving to inactivate the remaining DEPC. Hairpin ODN probes and miRNAs were diluted with 10 mM phosphate buffered saline (PBS, pH 7.4) containing 100 mM NaCl and 5 mM MgCl2. Serum samples from glioma patients and healthy donors were collected at Xiangya Hospital (Hunan, China) according to our previously published papers.25, 26 Table 1. Sequences of hairpin ODN probes, miRNAs, and diblock ODNs with Fc or MB tags ODNs or miRNAs Sequence from 5' to 3' hairpin probe 1

GGGGCCGGAGTGTGAGTTCTACCAT TGCCAAACCGGCCCC-(CH2)6-SH

hairpin probe 2

CGCAGTCAACAGAGAGCTTGCCCTT GTATATGACTGCG-(CH2)6-SH

diblock ODN 1

GGCCCCAAAAA-MB

diblock ODN 2

ACTGCGAAAAA-Fc

miRNA-182

UUUGGCAAUGGUAGAACUCACACU

miRNA-381

UAUACAAGGGCAAGCUCUCUGU

Page 2 of 7

miRNA-183

UAUGGCACUGGUAGAAUUCACU (four mismatched bases relative to miRNA-182 miRNA-300 UAUACAAGGGCAGACUCUCUCU (three mismatched bases relative to miRNA-381) miRNA-96 UUUGGCACUAGCACAUUUUUGCU (eleven mismatched bases relative to miRNA-182) miRNA-382 GAAGUUGUUCGUGGUGGAUUCG (nineteen mismatched bases relative to miRNA-381) Immobilization of hairpin ODN probes on AuNPMMBs. The construction and characterization of AuNPMMBs have been documented by several papers.26-29 The hairpin ODN probes were thiolated at 3′-terminus, containing a stem part with 8 base pairs (bps) and a loop region with sequences complementary to those of target miRNA-182 or miRNA-381. Immobilization of the hairpin ODN probes on AuNP-MMBs was carried out by mixing AuNP-MMBs with 100 µL PBS containing 1.0 µM ODN probe 1 and 1.0 µM ODN probe 2 for 3 h. This was followed by thoroughly washing the functionalized AuNP-MMBs with the buffer. The hairpin ODN probe-covered AuNP-MMBs were then magnetically collected and treated with 0.1 mM MCH for 30 min and 1 % BSA for 1 h to block the unreacted sites. Preparation of diblock ODN-modified AuNPs. The AuNPs with a diameter of 13 nm were synthesized by the citrate reduction method.30 The diblock ODNs comprise a polyA5 block tagged by MB or Fc moieties and a recognition block used to hybridize with the extended stem part at the 5’terminus of the hairpin probes, which was induced by miRNA hybridization. The preparation of diblock ODN-modified AuNPs was based on the protocol by Fan and coworkers.24 Briefly, AuNPs were incubated with the mixed solution of diblock ODN 1 and ODN 2 for 16 h (the molar ratio of AuNPs to diblock ODN 1 or ODN 2 is 1: 200). The mixture was added into PBS containing 0.1 M NaCl, followed by standing for 40 h. As a result, the polyA5 block with MB and Fc tags was strongly bound to the surface of AuNPs and the recognition block adopted a more upright conformation.24 The diblock ODN-modified AuNPs were washed three times with PBS and the excess ODN was removed by centrifugation. The resultant nanoparticles were resuspended in PBS containing 0.1 M NaCl and ready for use. MiRNA hybridization followed by the attachment of diblock ODN-modified AuNPs. 100 µL diluted serum samples or the mixed solutions of miRNA-182 and miRNA-381 with varied concentrations were added into the solution of hairpin ODN probe-covered AuNP-MMBs and the mixture was stirred for 1 h. After magnetic separation to remove the unreacted miRNAs, the functionalized AuNP-MMBs were exposed to diblock ODN-modified AuNPs for 1 h. All the hybridization reactions were carried out at room temperature (25 ˚C). The final conjugates were washed with PBS and water. The conjugation of AuNP-MMBs with diblock ODN-modified AuNPs was characterized by field-emission scanning electron microscopy (SEM, JSM-7800F, Japan) at a voltage of 10 kV, energy-dispersive spectroscopy (EDS, Thermofisher NS7, USA) at an accelerating voltage of 15 kV, and X-ray diffraction (XRD, Bruker D8 Advance Da Vinci, Germany) with Cu Kα radiation at a scanning rate of 0.02 °/s.

2 ACS Paragon Plus Environment

Page 3 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1. Schematic showing the simultaneous electrochemical detection of miRNA-182 and miRNA-381 via the conjugates of AuNPMMBs and diblock ODN-modified AuNPs.

Magnetic collection and electrochemical detection. Differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) were performed on a CHI 620E electrochemical workstation (CH Instruments, Shanghai, China) and a Gamry Reference 600 potentiostat (Gamry Instruments, USA), respectively. A three-electrode setup was employed in which a magnetic gold electrode with a diameter of 4 mm (Tianjin Incole Union Technology Co., Ltd., China) served as the working electrode, a platinum wire and a Ag/AgCl electrode were used as the counter and reference electrode, respectively. The magnetic gold electrode was polished with 0.3-µm alumina slurry on a polishing cloth (Buehler, Lake Bluff, IL), followed by sonication in ethanol and water. The final conjugates were collected onto the magnetic electrodes and DPV measurements were performed from -0.5 to 0.6 V in 0.1 M KClO4 at 50 ms for the pulse width and 50 mV for the pulse amplitude. The DPV detection was conducted at room temperature (25 ˚C). Baseline fitting and subtraction of the DPV data was performed. RESULTS AND DISCUSSION The principle behind the simultaneous electrochemical detection of miRNA-182 and miRNA-381 via the conjugates of AuNP-MMBs and diblock ODN-modified AuNPs was depicted in Figure 1. Two thiolated hairpin ODN probes were selfassembled on the surface of AuNP-MMBs through Au-S bonds. The hairpin ODN probe consists of an 8-bp-long stem and a loop with sequences complementary to those of miRNA182 or miRNA-381. The nonspecific adsorption was eliminated by blocking the empty sites of the AuNP-MMBs with MCH and BSA. The diblock ODN comprises two blocks, one is a polyA5 block tagged by MB or Fc moieties and the other is an appended recognition block used to hybridize with the extend-

ed stem part of the 5’-terminus of the hairpin probes. The diblock ODN-modified AuNPs were fabricated by anchoring the polyA5 blocks on the surface of AuNPs. The binding affinity between polyA and Au is high, comparable to that of the Au−S bonds.24 After hybridization of the loop regions of the hairpin probe 1 and 2 to miRNA-182 and miRNA-381, respectively, the hairpin probes anchored onto AuNP-MMBs were opened up and underwent a conformational change, allowing the attachment of diblock ODN 1- and 2-modified AuNPs. Note that diblock ODN 1-modified AuNPs were decorated with MB tags and their linkage to the AuNP-MMBs was performed through hybridization to miRNA-182, and the attachment of diblock ODN 2-modified AuNPs, which were covered with Fc tags, was achieved through hybridization to miRNA381. The conjugates between AuNP-MMBs and diblock ODN-modified-AuNPs were collected onto a magnetic electrode for electrochemical detection. By examining the oxidation signals of MB and Fc moieties, simultaneous determination of miRNA-182 and miRNA-381 was carried out. The surface density of the assembled polyA5 block per AuNP was determined to be about 75.24 Motivated by these findings and the fact that each diblock ODN strand was labelled with a Fc or MB tag, we could speculate that each gold nanoparticle was decorated with dozens of MB or Fc tags, which significantly enhances the voltammetric signals. In the absence of target miRNAs, the attachment of the diblock ODN-modified AuNPs was hindered due to the steric hindrance, no detectable voltammetric signals were attained. The combined use of AuNPMMBs with enlarged surface area, good conductivity as the immobilization matrix and diblock ODN-modified AuNPs as signal transducers enables highly sensitive, selective and multiplexed miRNA assay.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Impedance spectra acquired at a bare magnetic gold electrode (a) and the magnetic gold electrodes covered with AuNP-MMBs (b), hairpin ODN probe-modified AuNP-MMBs (c), the hybrids between miRNAs and hairpin ODN probemodified AuNP-MMBs (d), and the sandwiched structure formed via hybridization of the hybrids to diblock ODN-modified AuNPs (e). All the measurements were carried out in an aqueous solution containing 5 mM [Fe(CN)6]3-/4- (1:1) and 0.1 M KCl at the frequency range from 100 kHz to 100 mHz. The electron transfer resistance (Ret) was interpreted by the inset Randles equivalent circuit model.

The step-wise formation of the novel conjugates between AuNP-MMBs and diblock ODN-modified AuNPs was characterized by EIS (Figure 2). Ret was estimated from the diameter of the semicircle in the Nyquist plot. A small semicircle domain was obtained at the bare magnetic gold electrode (Ret = 50.5 Ω, curve a). The magnetic collection of AuNP-MMBs on the gold electrode leads to an enhanced Ret of 227.2 Ω (curve b). The modification of AuNP-MMBs with negatively charged hairpin ODN probes, followed by MCH and BSA blocking, further increased Ret to 598.5 Ω (curve c). Interestingly, after hybridization of hairpin ODN probe-modified AuNP-MMBs with miRNA-182 and miRNA-381, the Ret was decreased to 524.0 Ω (curve d). The decrease in Ret was ascribed to the hybridization-induced opening up of the immobilized hairpinstructured ODN probes, which makes [Fe(CN)6]3-/4- molecules more accessible to the electrode surface. Covering the gold electrode with the conjugates between AuNP-MMBs and diblock ODN-modified AuNPs significantly increased Ret to 1008.4 Ω (curve e). Evidenced by the EIS data, the step-wise construction of the novel conjugates was viably achieved. The attachment of diblock ODN-modified AuNPs to the surface of AuNP-MMBs was characterized by SEM, EDS elemental mapping and XRD (Figure 3). As shown by lowmagnification SEM images, the surface roughness of AuNPMMBs increased after coating with diblock ODN-modified AuNPs (images a and b). For SEM images of a single particle, the roughness increase was more clear and an increased particle size was attained (images c and d). Such a process was also confirmed by EDS elemental mapping results (images e and f). The element of Fe in AuNP-MMBs was depicted in blue color and Au was in red (image e). After the attachment of diblock ODN-modified AuNPs, the gold content increased and the red color deepened (image f). As shown by XRD patterns (curves a and b in Figure 3B), the reflection intensity of Au remarkably increased via linkage of diblock ODN-modified AuNPs to the AuNP-MMBs (inverted triangle). The above results suggest the successful construction of the novel conjugates.

Page 4 of 7

Figure 3. (A) SEM images of AuNP-MMBs (a, c) and the conjugates between AuNP-MMBs and diblock ODN-modified AuNPs (b, d), and EDS elemental mapping results showing the attachment of diblock ODN-modified AuNPs to the surface of AuNPMMBs (e, f). (B) XRD patterns of AuNP-MMBs (a) and AuNPMMBs covered with diblock ODN-modified AuNPs (b).

Figure 4. DPV responses at the magnetic gold electrodes covered with the novel conjugates that were constructed in the absence (A) and presence of (B) 3 pM miRNA-182, (C) 3 pM miRNA-381, and (D) 3 pM miRNA-182 + 3 pM miRNA-381.

The capability of the method for multiplexed electrochemical detection of miRNAs was demonstrated (Figure 4). Negligible voltammetric peaks were obtained in the absence of miRNA-182 and miRNA-381 (Figure 4A), indicating that the nonspecific adsorption was effectively eliminated. The hybridization with 3 pM miRNA-182 (Figure 4B) or 3 pM miRNA381 (Figure 4C) leads to a conformational change of the hairpin structures, and the attachment of diblock ODN-modified AuNPs was achieved. Thus, distinct oxidation peaks of MB tags at -0.274 V (Figure 4B) and Fc tags at 0.360 V (Figure 4C) were observed. In the presence of 3 pM miRNA-182 and 3 pM miRNA-381, the oxidation signals of both MB and Fc tags were obtained (Figure 4D). It is worth to note that the diblock ODN-modified AuNPs were stable and could be stored at 4 °C for two weeks. Thus, the proposed method is capable of performing multiplexed miRNA assay, holding great promise for point-of-care applications.


Page 5 of 7

Analytical Chemistry 5.0 4.0

i / µA

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

MB Fc

3.0 2.0

1.0 0.0 82 00 83 ets -96 targ iRNA-1 iRNA-3 iRNA iRNA-3 m m m m

k blan

Figure 5. Specificity of the multiplexed miRNA assay. The oxidation peak currents of MB and Fc tags were measured in the presence of miRNAs with different sequences: targets of miRNA182 and miRNA-381, miRNA-183, miRNA-300, miRNA-96 and miRNA-382. The peak currents in the absence of miRNAs were shown as the blank. The concentrations of all the miRNA sequences were maintained at 3.0 pM. The absolute errors deduced from three replicate measurements were shown as the error bars.

The selectivity of the method for targets of miRNA-182 and miRNA-381 assay was assessed. Due to the similarity of miRNA sequences, miRNAs from the same family of miRNA182 (miRNA-183, miRNA-96) and miRNA-381 (miRNA-300, miRNA-382) were determined.31, 32 MiRNA-183 and miRNA96 possess four and eleven mismatched bases relative to miRNA-182, respectively, while miRNA-300 and miRNA-382 contain three and nineteen mismatched bases relative to miRNA-381, respectively. As depicted in Figure 5, the oxidation peak currents of MB and Fc moieties for miRNA-183 decreased by 71 % and 94 %, respectively, in comparison with those for the targets of miRNA-182 and miRNA-381, indicating the sequence similarity between miRNA-182 and miRNA183 (four-base mismatch). For miRNA-300, which is a threebase-mismatched variant of miRNA-381, the voltammetric signal of Fc moieties decreased by 71 % relative to that of the targets, while that of MB moieties decreased by 96 %. In the case of miRNA-96 or miRNA-382, tiny voltammetric signals of MB and Fc moieties were attained, being a little large or

closed to those of the blank. The sensing protocol is thus highly selective and is capable of discriminating miRNAs with similar sequences. As demonstrated in Figure 6A, the increased concentrations of miRNA-182 and miRNA-381 lead to the opening up of more hairpin ODN probes, and the attachment of more diblock ODN-modified-AuNPs was realized. The dependence of the oxidation peak currents of MB and Fc moieties on the concentrations of miRNA-182 and miRNA-381 was shown in Figure 6B and 6C, respectively. The insets show the linear portions in range of 5–600 fM for miRNA-182 and 1–800 fM for miRNA-381, and the linear regression equations were presented as i (µA) = 0.00244 [miRNA-182] (fM) + 0.128 (R2 = 0.991) and i (µA) = 0.00402 [miRNA-381] (fM) + 0.215 (R2 = 0.994). Our results were highly reproducible, and the relative standard deviation (RSD) values for the DPV measurements performed in the same manner were below 7 %. The detection limits for miRNA-182 and miRNA-381 were calculated as 0.20 fM and 0.12 fM, respectively, which are two orders of magnitude lower than those using ODN-encapsulated silver nanoclusters as electrochemical probes (67 fM),33 dual-amplification of AuNPs (45 fM),34 duplex-specific nuclease signal amplification (100 fM),35 and our previous report through competitive hybridization and signal enhancement by Fc-capped AuNP/streptavidin conjugates (10 fM)25. Such concentration levels are also comparable with those achievable by combining target recycling with cascade catalysis (0.35 fM),36 enzymeless electrochemical signal amplification (0.1 fM),37 and our recent report via combination of AuNP-MMBs with Fccapped AuNP/streptavidin conjugates (0.14 fM)26.

Figure 6. (A) DPV responses at the electrodes covered with the novel conjugates that were constructed in the presence of miRNA-182 and miRNA-381 with various concentrations: (a) 0.005 pM + 0.001 pM, (b) 0.05 pM + 0.05 pM, (c) 0.2 pM + 0.2 pM, (d) 0.4 pM + 0.4 pM, (e) 0.8 pM + 0.8 pM, (f) 2 pM + 2 pM, (g) 5 pM + 5 pM. The panels B and C depict the dependence of the oxidation peak currents on the concentrations of miRNA-182 (B) and miRNA-381 (C). The absolute errors deduced from three replicate measurements were shown as the error bars. The insets show the linear portions of the calibration curves.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. (A) DPV signals of 10-fold diluted sera from patients with grade III-IV (a) and I-II (b) gliomas and a healthy donor (c). (B) The capability of the assay for differentiating the expression levels of miRNA-182 and miRNA-381 in healthy donors (three cases), and the patients with grade I-II and III-IV gliomas (three cases each) (n=3). The asterisks represent the 99 % and 1 % percentiles, and the average levels of miRNAs from the assayed samples are indicated by the hollow squares.

The sensing protocol is amenable to the determination of the expression levels of miRNA-182 and miRNA-381 from sera of glioma patients at different stages (Figure 7A). The 10fold diluted serum samples were determined by interpolation in the calibration curves obtained for the synthetic miRNAs. The oxidation peak currents of MB and Fc moieties from serum samples of patients with grade III-IV (curve a) and I-II (curve b) gliomas were substantially higher than those from healthy donors (curve c), indicating the up-regulated levels of both miRNA-182 and miRNA-381 in glioma patients. The universal applicability of the method for clinical diagnosis of serum samples from three healthy donors and six glioma patients has been demonstrated (Figure 7B). The expression levels of both miRNAs from patients with grade III-IV gliomas were higher than those from patients with grade I-II gliomas, indicating that the proposed assay could differentiate the glioma patients at different stages. The expression levels of miRNA-182 from grade I-II and III-IV gliomas were 2-3 times and 3-4 times higher than those from healthy donors, respectively, and those of miRNA-381 from grade I-II and III-IV gliomas were 2-3 times and 4-5 times higher than those from healthy donors, respectively, being in agreement with our previous work.23,25,26 The method was largely free from the matrix effect due to the capability of the method for discriminating miRNAs with similar sequences (Figure 5). Furthermore, the magnetic separation and collection for miRNA assay removes unwanted constituents or interfering species in clinical samples. To our knowledge, this is the first electrochemical assay for differentiating the various stages of gliomas. Combining AuNP-MMBs as the immobilization matrix and diblock ODNmodified AuNPs bearing different redox tags as signal transducers thus provides an efficient and viable means for pointof-care diagnosis. CONCLUSIONS Multiplexed and sensitive electrochemical assay of miRNAs from serum samples was performed via coupling conducting magnetic microbeads with diblock ODN-modified AuNPs. The AuNP-MMBs serve as the immobilization matrix for assembling numerous hairpin-structured ODN probes and the diblock ODN-modified AuNPs bearing a large number of MB and Fc redox tags serve as the signal transducers. Concentrations of miRNA-182 from 5 to 600 fM and those of miRNA-

Page 6 of 7

381 from 1 to 800 fM could be readily determined, and the detection limits for miRNA-182 and miRNA-381 were estimated to be 0.20 fM and 0.12 fM, respectively. Such concentration levels are several orders of magnitude lower than those based on ODN-encapsulated silver nanoclusters (67 fM),33 dual-amplification of AuNPs (45 fM),34 and duplex-specific nuclease signal amplification (100 fM)35. The proposed method was capable of monitoring miRNA levels in human serum samples without sample pretreatment and enrichment in a highly selective and sensitive manner. The expression levels of miRNA-182 and miRNA-381 increased with the degree of deterioration of gliomas, being higher than those from healthy donors. The proof-of-concept experiments demonstrate that the multiplexed assay could find potential applications in biomolecular analysis and clinical diagnosis.

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] (Jianxiu Wang). *E-mail: [email protected] (Xinyao Yi). Phone: +86-731-88836356

ORCID Xinyao Yi: 0000-0002-9218-7161 Jianxiu Wang: 0000-0002-6344-6419

Author Contributions §J.W., Z.L. and H.T. contributed equally to this work.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT The authors thank the financial support of this work by the National Natural Science Foundation of China (Nos. 21375150, 21575166, 21705166 and 81772961), and the Chinese National Key Basic Research Program (No. 2014CB744502).

(1) Lee, Y.; Ahn, C.; Han, J.; Choi, H.; Kim, J.; Yim, J.; Lee, J.; Provost, P.; Rådmark, O.; Kim, S. Nature 2003, 425, 415-419. (2) Dong, H.; Lei, J.; Ding, L.; Wen, Y.; Ju, H.; Zhang, X. Chem. Rev. 2013, 113, 6207-6233. (3) Cissell, K.; Shrestha, S.; Deo, S. Anal. Chem. 2007, 79, 47544761. (4) Calin, G.; Croce, C. Cancer Res 2006, 66, 7390-7394. (5) Tricoli, J.; Jacobson, J. Cancer Res. 2007, 67, 4553-4555. (6) Kosaka, N.; Iguchi, H.; Ochiya, T. Cancer Sci. 2010, 101, 2087-2092. (7) Yang, C.; Shi, K.; Dou, B.; Xiang, Y.; Chai, Y.; Yuan, R. ACS Appl. Mater. Interfaces 2015, 7, 1188-1193. (8) Wee, E. J.; Trau, M. ACS Sens. 2016, 1, 670-675. (9) Kellenberger, C.; Wilson, S.; Sales-Lee, J.; Hammond, M. J. Am. Chem. Soc. 2013, 135, 4906-4909. (10) Ma, F.; Li, Y.; Tang, B.; Zhang, C. Acc. Chem. Res. 2016, 49, 1722-1730. (11) Paul W.; Robert S.; Michael S. Anal. Chem. 2005, 77, 75587562. (12) Dong, H.; Zhang, J.; Ju, H.; Lu, H.; Wang, S.; Jin, S.; Hao, K.; Du, H.; Zhang, X. Anal. Chem. 2012, 84, 4587-4593. (13) Zhou, Y.; Zhang, J.; Zhao, L.; Li, Y.; Chen, H.; Li, S.; Cheng, Y. ACS Appl. Mater. Interfaces 2016, 8, 1520-1526. (14) Jin, Z.; Geissler, D.; Qiu, X.; Wegner, K.; Hildebrandt, N. Angew. Chem., Int. Ed. 2015, 54, 10024-10029.


Page 7 of 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(15) Li, D.; Wang, Y.; Lau, C.; Lu, J. Anal. Chem. 2014, 86, 10148-10156. (16) Vogelsang, J.; Kasper, R.; Steinhauer, C.; Person, B.; Heilemann, M.; Sauer, M.; Tinnefeld, P. Angew, Chem., Int. Ed. 2008, 47, 5465-5469. (17) Piston, D.; Kremers, G. Trends Biochem. Sci. 2007, 32, 407414. (18) Bard, J.; Faulkner, R. Wiley: New York 2001. (19) Yang, C.; Dou, B.; Shi, K.; Chai, Y.; Xiang, Y.; Yuan, R. Anal. Chem. 2014, 86, 11913-11918. (20) Torrente-Rodríguez, R.; Campuzano, S.; López-Hernández, E.; Montiel, V.; Barderas, R.; Granados, R.; Sánchez-Puelles, J.; Pingarrón, J. Biosens. Bioelectron. 2015, 66, 385-391. (21) Hulleman, E.; Helin, K. Adv. Cancer Res. 2005, 94, 1-27. (22) Weeraratne, D.; Amani, V.; Teider, N.; Pierre-Francois, J.; Winter, D.; Kye, J.; Sengupta, S.; Archer, T.; Remke, M.; Bai, A. Acta Neuropath. 2012, 123, 539-552. (23) Tang, H.; Wang, Z.; Liu, Q.; Liu, X.; Wu, M.; Li, G. PLOS. One 2014, 9, e84146. (24) Pei, H.; Li, F.; Wan, Y.; Wei, M.; Liu, H.; Su, Y.; Chen, N.; Huang, Q.; Fan, C. J. Am. Chem. Soc. 2012, 134, 11876-11879. (25) Wang, J.; Yi, X.; Tang, H.; Han, H.; Wu, M.; Zhou, F. Anal. Chem. 2012, 84, 6400-6406.

(26) Lu, Z.; Tang, H.; Wu, D.; Xia, Y.; Wu, M.; Yi, X.; Li, H.; Wang, J. Biosens. Bioelectron. 2016, 86, 502-507. (27) Shiigi, H.; Kinoshita, T.; Shibutani, N.; Nishino, T.; Nagaoka, T. Anal. Chem. 2014, 86, 4977-4981. (28) Tokonami, S.; Yamamoto, Y.; Mizutani, Y.; Ota, I.; Shiigi, H.; Nagaoka, T. J. Electrochem. Soc. 2009, 156, D558. (29) Yamamoto, Y.; Takeda, S.; Shiigi, H.; Nagaoka, T. J. Electrochem. Soc. 2007, 154, D462. (30) Hill, H.; Mirkin, C. Nat. Protoc. 2006, 1, 324-336. (31) Wang, Y.; Guo, R.; Guo, R.; Sheng, W.; Yin, L. J. Cell. Biochem. 2013, 114, 1464-1473. (32) Guo, L.; Lu, Z. Comput. Biol. Chem. 2010, 34, 165-171. (33) Dong, H.; Jin, S.; Ju, H.; Hao, K.; Xu, L. P.; Lu, H.; Zhang, X. Anal. Chem. 2012, 84, 8670-8674. (34) Xia, N.; Zhang, L.; Wang, G.; Feng, Q.; Liu, L. Biosens. Bioelectron. 2013, 47, 461-466. (35) Yin, B.; Liu, Y.; Ye, B. J Am. Chem. Soc. 2012, 134, 50645067. (36) Wu, X.; Chai, Y.; Zhang, P.; Yuan, R. ACS Appl. Mater. Interfaces 2015, 7, 713-720. (37) Wang, T.; Viennois, E.; Merlin, D.; Wang, G. Anal. Chem. 2015, 87, 8173-8180.

For TOC only


Multiplexed Electrochemical Detection of MiRNAs from Sera of Glioma

Recommend Documents