Multiscale Simulations on Spectral Tuning and the Photoisomerization

Subscriber access provided by CORNELL UNIVERSITY LIBRARY

Article

Multiscale Simulations on Spectral Tuning and Photoisomerization Mechanism in Fluorescent RNA Spinach Xin Li, Lung Wa Chung, and Guohui Li J. Chem. Theory Comput., Just Accepted Manuscript • DOI: 10.1021/acs.jctc.6b00578 • Publication Date (Web): 29 Sep 2016 Downloaded from http://pubs.acs.org on October 12, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Chemical Theory and Computation is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Chemical Theory and Computation

Multiscale Simulations on Spectral Tuning and Photoisomerization Mechanism in Fluorescent RNA Spinach Xin Li,*,† Lung Wa Chung,*,‡ and Guohui Li*,† †

State Key Laboratory of Molecular Reaction Dynamics, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian 116023, China ‡ Department of Chemistry, South University of Science and Technology of China, Shenzhen 518055, China Emails: [email protected], [email protected], [email protected]

Abstract: Fluorescent RNA aptamer Spinach can bind and activate a green fluorescent protein (GFP)-like chromophore (an anionic DFHBDI chromophore) displaying green fluorescence. Spectroscopic properties, spectral tuning and photoisomerization mechanism in Spinach-DFHBDI complex have been investigated by high-level QM and hybrid ONIOM(QM:AMBER) methods (QM method: (TD)DFT, SF-BHHLYP, SAC-CI, LT-DF-LCC2, CASSCF, or MS-CASPT2), as well as classical molecular dynamics (MD) simulations. First, our benchmark calculations have shown that TD-DFT and spin-flip (SF) TD-DFT (SF-BHHLYP) failed to give a satisfactory description of absorption and emission of the anionic DFHBDI chromophore. Comparatively, SAC-CI, LT-DF-LCC2, and MS-CASPT2 can give more reliable transition energies, and are mainly used to further study the spectra of the anionic DFHBDI chromophore in Spinach. The RNA environmental effects on the spectral tuning and the photoisomerization mechanism have been elucidated. Our simulations show that interactions of the anionic cis-DFHBDI chromophore with two G-quadruplexes as well as a UAU base triple suppress photoisomerization of DFHBDI. In addition, strong hydrogen bonds between the anionic cis-DFHBDI chromophore and nearby nucleotides facilitate its binding to Spinach, and further inhibit the cis-trans photoisomerization of DFHBDI. Solvent molecules, ions, and loss of key hydrogen bonds with nearby nucleotides could induce dissociation of the anionic trans-DFHBDI chromophore from the binding site. These results provide new 1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

insights into fluorescent RNA Spinach and may help rational design of other fluorescent RNAs.

1. Introduction. Green fluorescent protein (GFP) and its derivatives have widespread applications in various biological systems.1-4 Recently, Spinach, Spinach2 and Broccoli, powerful and novel RNA mimics of GFP, have been developed and designed to selectively bind GFP-like chromophores/ligands (such as 3′,5′-difluoro-4′-hydroxybenzylidene-2,3dimethyl-imidazolinone (DFHBDI) anion in Scheme 1a and Chart 1) and induce green fluorescence.5-14 Moreover, the designed DFHBDI is in an anionic form, because two fluorine substituents increase the acidity and reduce the pKa of DFHBDI (pKa=5.5). Spinach binding to the phenolate form of DFHBDI was found to have an enhanced fluorescence quantum yield (0.72) and brightness.5-9 As a widely-used GFP and derivatives, this engineered green fluorescent RNA is very useful in for example, labeling and imaging of RNAs, where its use makes GFP fusion proteins unnecessary. These studies have attracted the attention of many researchers.1-22a,23-26 Fluorescence of the anionic cis-DFHBDI chromophore in Spinach, light-induced photoconversion and dissociation of the chromophore from Spinach have been reported recently.5-11 For example, the fluorescence decay and fluorescence recovery were found to be dependent on concentration of DFHBDI. The cis-trans photoisomerized product was proposed to quickly dissociate from Spinach. Then, a new cis-DFHBDI chromophore in solution binds to Spinach to recover fluorescence.11 Crystal structures of Spinach in the presence and in the absence of a DFHBDI chromophore have been obtained recently, and have provided important structural information concerning Spinach-DFHBDI complexes (Scheme 1).12,13 In these crystal structures, the DFHBDI chromophore was found to be planar and to interact with surrounding nucleotides via π-π stacking and hydrogen bonding. G-quadruplexes and a few adjacent nucleotides were proposed as essential in the binding site of the chromophore in Spinach, and it was proposed that a miniaturized baby Spinach still retains the level of fluorescence as is present in wild-type Spinach.12,13 2


Page 2 of 28

Page 3 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


By comparing the crystal structures of Spinach in the presence and in the absence of the DFHBDI chromophore, one can find that several nucleotides around the binding site change their positions significantly.12 Especially, a coplanar guanine nucleotide re-orientates its base to form hydrogen bonding with the chromophore. In addition, the AAU base triple of Spinach in the absence of DFHBDI is changed to a new UAU base triple in the Spinach-DFHBDI complex. The new base triple and G-quadruplexes give more space for the DFHBDI chromophore. Some nearby nucleotides also change positions of their bases after the chromophore binds to Spinach. Although these interesting and important investigations on Spinach have been reported, there remain some unresolved issues. In this work, multi-scale simulations including high-level QM and ONIOM(QM:MM) calculations27-33 and classical molecular dynamics (MD) simulations have been carried out for the first time to examine spectral-tuning and photoisomerization mechanism in the Spinach-DFHBDI complex. With these highly accurate theoretical methods, this study should help understand and predict the photophysical as well as photochemical properties of this novel fluorescent RNA Spinach.

Scheme 1. Models of: (a) cis-DFHBDI anion, (b) trans-DFHBDI anion, (c) a Spinach-DFHBDI complex (R), (d) a small model (Rs) Spinach-DFHBDI complex, and (e) the DFHBDI binding site in Spinach. 3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Chart 1. Structural formula of the anionic form of HBDI and DFHBDI.

2. Computational Details. 2.1. Setup of Systems and Classical Simulations. The initial structure of the Spinach-DFHBDI complex was taken from the PDB databank (code: 4KZD, RNA sequence:5′GDP-GACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAA ACACGCACUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC3′).12 Two models (Scheme 1) were constructed for our simulations: the sequence 2-84 was chosen for the first model (R); the sequence 16-69 (a truncated Spinach, which was suggested to retain the fluorescence of Spinach12) was adopted in the second small model (Rs). The RNA systems with crystallographic water molecules and ions (Mg2+ and K+) were neutralized by adding K+ ions and were then fully solvated in a cuboid box (127 Å × 99.7 Å × 138 Å and 92.6 Å × 91 Å × 122 Å for the first and second models, respectively) of TIP3P water molecules by the AMBER Leap module.34-36 The AMBER ff99bsc0χOL3 force field was used for Spinach.37-41 RESP charges calculated at HF/6-31G(d) level and the similar AMBER atom types were applied for DFHBDI.34,42 Molecular mechanics (MM) energy minimizations followed by molecular dynamics (MD) simulations (details given in Supporting Information) were performed in the AMBER 14 package.34 Water molecules and ions within about 12 Å and 16 Å of the Spinach-DFHBDI complex and its small model complex, respectively, were extracted for the following ONIOM calculations. Moreover, for the case of a few additional snapshots from MD simulations, water molecules and ions within about 11 Å of the Spinach-DFHBDI complex were kept in the ONIOM calculations.

4


Page 4 of 28

Page 5 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.2. QM and ONIOM Calculations. Ground-state (S0) geometries of anionic cis- and trans-DFHBDI in gas phase were first optimized by density functional theory (DFT: B3LYP or CAM-B3LYP, with 6-31+G(d,p) and 6-311++G(d,p) basis sets), and two-state-average (SA2) and three-state-average (SA3) CASSCF(16e,14o)/6-31G(d) (with all valence π-electrons and orbitals included in the active space, Figures S1 and S2) methods.43-49 The first excited-state (S1) geometry optimizations of the anionic cis- and trans-DFHBDI in the gas phase were carried out by time-dependent density functional theory (TD-DFT: TD-B3LYP or TD-CAM-B3LYP, with 6-31+G(d,p) and 6-311++G(d,p)

sets),50,51

basis

SAC-CI/D95(d),52-54

and

SA2-CASSCF(16e,14o)/6-31G(d)46,47 methods. Then, the vertical absorption and emission energies were evaluated by different QM methods, such as TD-DFT,50,51 spin-flip

(SF)

TD-DFT

LT-DF-LCC2/cc-pVDZ,57,58

(SF-BHHLYP/6-311+G(d,p)),55,56 and

SAC-CI/D95(d),52-54

MS-CASPT2//SA3-CASSCF(16e,14o)/6-31G(d)

(with an imaginary level shift of 0.3 au).48,49,59-61 The Gaussian 09,42 Q-Chem,62 Molpro,63,64 and Molcas65 programs were used for these calculations. From classical MM minimization and MD simulations, geometries of Spinach-DFHBDI

complexes

in

S0

and

S1,

were

further

optimized

by

ONIOM(DFT:AMBER) and ONIOM(TD-DFT:AMBER), respectively.19-21,27-33 In the ONIOM optimization for the small model (Scheme 1d), one K+ ion close to the phenolate oxygen of DFHBDI was included in the QM region. Electronic embedding (EE) scheme was applied for all these geometry optimizations, except for one unsuccessful case from the MM minimized structure of the Spinach-DFHBDI complex (Scheme 1c). Moreover, the ONIOM(CASSCF:AMBER) method was also employed to optimize geometries of the Spinach-DFHBDI complexes in S0 and S1, where QM energies and gradients were externally computed by the Molpro program.63,64 For these ONIOM(CASSCF:AMBER) optimizations, mechanical embedding (ME) scheme was used, and the S0 and S1 charges of DFHBDI were updated in each optimization until energy was converged. The ONIOM-EE scheme was utilized to calculate all vertical absorption and emission energies of DFHBDI in Spinach. In addition, the cis-trans photo-isomerization of DFHBDI in Spinach was 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

studied by the ONIOM(CASSCF:AMBER) method. Potential energy curve (PEC) for the cis-trans photo-isomerization was obtained from relaxed scan optimization of a key dihedral angle, which has been widely and successfully in many photobiological systems (e.g. GFP or retinal-type chromophore involving motion of more than one dihedral angle).22 PEC for the photo-isomerization of DFHBDI in Spinach was then refined by using MS-CASPT2 as the QM method. Water molecules within about 6 Å (~8 Å for the small model) of the Spinach-DFHBDI complex were optimized, and the rest of the water molecules were frozen in the ONIOM optimization.19,21,31,32

3. Results and Discussion. Geometrical features, absorption and emission of DFHBDI in the gas phase are first discussed in section 3.1. Key results and discussion for geometry, absorption and emission of cis-DFHBDI in Spinach are then presented in section 3.2. Furthermore, photoisomerization mechanism of DFHBDI in Spinach is discussed in section 3.3. The trans-DFHBDI in Spinach is then addressed in section 3.4. Finally, a comparison of fluorescence activation in Spinach and GFP is simply summarized in section 3.5.

3.1. Absorption and Emission of DFHBDI in the Gas Phase. The key geometric and spectroscopic properties of DFHBDI anion in the gas phase were given in Figure 1 and Tables 1-2 as well as S1-S2, respectively. 3.1.1. Key Ground- and Excited-State Geometrical Features. Generally, the optimized key bond lengths of the cis- and trans-DFHBDI in S0 are similar. This structural feature is the same as was found in a GFP-type chromophore, 4′-hydroxybenzylidene-imidazolinone (HBI), in our previous study.19 Also, the ground-state geometries of DFHBDI calculated by the B3LYP and CAM-B3LYP methods are similar to those by the CASSCF method, with the maximum deviation of about 0.02 Å for the C=N (R1) and C=O (R3 and R10) bonds (see Figure 1a). For DFHBDI anion in S1, the high-level CASSCF and SAC-CI methods give similar geometry (Figure 1b). Compared to the geometry optimized by the CASSCF or SAC-CI method, TD-CAM-B3LYP can give slightly better result than TD-B3LYP. 6


Page 6 of 28

Page 7 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


As shown in Figure 1, it is clear that the bridge bonds (R5 and R6) are elongated in S1, relative to those in S0. Comparing cis- and trans-DFHBDI in S1, the difference of bridge bonds are the most obvious (more elongated R5 and shortened R6 bonds in trans-DFHBDI than in cis-DFHBDI). In addition, geometrical features of DFHBDI are comparable to those of HBI19 and 4′-hydroxybenzylidene-2,3-dimethylimidazolinone (HBDI, Chart 1) in Figure S3. These results suggest that the difluoro substituent effect on the chromophore geometry is minor.

Figure 1. In gas phase, key bond lengths of DFHBDI anion in (a) S0 and (b) S1 calculated by different methods. The bond labels are given in Scheme 1a. 7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 28

3.1.2. Vertical Absorption and Emission. In experiment, the measured absorption energy of the cis anionic GFP chromophore (cis-HBDI) in vacuo is 2.59 eV,66 while there are no measured values of anionic DFHBDI in vacuo. Herein, the vertical absorption energies of the anionic cis- and trans-DFHBDI chromophores in the gas-phase were computed (Table 1). SAC-CI/D95(d) and LT-DF-LCC2/cc-pVDZ methods give the comparable absorption (~2.4-2.5 eV), which are slightly lower than the absorption (~2.5-2.6 eV) calculated by the MS-CASPT2(16e,14o)/6-31G(d) method.

Compared

to

the

above

high-level

calculations,

TD-B3LYP,

TD-CAM-B3LYP and SF-BHHLYP methods overestimate the absorption energy (>3.0 eV). Overall, the MS-CASPT2 method should be the most reliable method with which to evaluate the spectroscopic properties of anionic DFHBDI in the gas phase, because the MS-CASPT2 computed absorption energy of the anionic cis-HBDI chromophore in the gas phase (~2.6 eV in Table S3) agrees well with the measured value (2.59 eV) in vacuo.66 In addition, the vertical emission energies for the cis- and trans-DFHBDI chromophores (optimized by TD-DFT, SAC-CI and CASSCF methods) were also evaluated (Table 2). Again, the SAC-CI and LT-DF-LCC2 methods give similar emission values (~2.1-2.3 eV), which are lower than the emission (~2.4-2.5 eV) calculated by the MS-CASPT2 method. Nevertheless, TD-B3LYP, TD-CAM-B3LYP and SF-BHHLYP methods give a larger error for the vertical emission energy (>2.8 eV), compared to the high-level methods. In general, different conformations (cis/trans) and geometries optimized by different methods have a minor effect on the calculated absorption and emission energies of anionic DFHBDI in the gas phase. Compared with our MS-CASPT2 computed absorption (~2.6 eV) and emission (~2.5 eV) of anionic HBDI in gas phase, our calculations show that the difluoro substituent effect in DFHBDI leads to a small red shift of ~0.04 eV in the absorption and emission energies (Tables 1, 2 and S1-S3).

8


Page 9 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 1. The calculated absorption energies of anionic DFHBDI in the gas phase.a,b cis-DFHBDI

Absorption

trans-DFHBDI

eV

f

eV

f

TD-B3LYP/BS0//B3LYP/BS0

3.01

0.96

3.05

0.91

TD-CAM-B3LYP/BS0//CAM-B3LYP/BS0

3.11

1.06

3.15

0.98

SF-BHHLYP/BS1//B3LYP/BS0

3.07

NA

3.09

NA

SF-BHHLYP/BS1//CAM-B3LYP/BS0

3.11

NA

3.13

NA

SAC-CI/BS2//B3LYP/BS0

2.40

0.90

2.36

0.80

SAC-CI/BS2//CAM-B3LYP/BS0

2.46

0.91

2.40

0.80

SAC-CI/BS2//CASSCF/BS4

2.44

0.90

2.43

0.82

LT-DF-LCC2/BS3//B3LYP/BS0

2.39

0.81

2.41

0.73

LT-DF-LCC2/BS3//CAM-B3LYP/BS0

2.43

0.81

2.45

0.74

LT-DF-LCC2/BS3//CASSCF/BS4

2.44

0.81

2.47

0.75

MS-CASPT2/BS4//B3LYP/BS0

2.54

1.38

2.53

1.23

2.58

1.38

2.57

1.24

2.60

1.39

2.60

1.26

MS-CASPT2/BS4//CAM-B3LYP/BS0 MS-CASPT2/BS4//CASSCF/BS4

c

a. BS0: 6-31+G(d,p); BS1: 6-311+G(d,p); BS2: D95(d); BS3: cc-pVDZ; BS4: 6-31G(d). b. The calculated absorption values on the basis of geometries optimized by DFT/6-311++G(d,p) (DFT/BSL) are given in Table S1. The effects of small and large basis sets (BS0 and BSL) on the S0 geometry and absorption of anionic DFHBDI are minor. c. The MS-CASPT2 calculated absorption is very similar for the geometry optimized by SA2-CASSCF/BS2 (using Molpro program) or SA3-CASSCF/BS2 (using Molcas program).

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 28

Table 2. The calculated emission energies of anionic DFHBDI in the gas phase.a,b cis-DFHBDI

Emission

trans-DFHBDI

eV

f

eV

f

TD-B3LYP/BS0

2.82

0.74

2.90

0.82

TD-CAM-B3LYP/BS0

2.96

1.00

2.99

0.92

SF-BHHLYP/BS1//TD-B3LYP/BS0

2.88

NA

2.90

NA

SF-BHHLYP/BS1//TD-CAM-B3LYP/BS0

2.95

NA

2.96

NA

SAC-CI/BS2

2.22

0.83

2.27

0.77

SAC-CI/BS2//TD-B3LYP/BS0

2.10

0.76

2.16

0.74

SAC-CI/BS2//TD-CAM-B3LYP/BS0

2.24

0.83

2.22

0.74

SAC-CI/BS2//CASSCF/BS4

2.22

0.81

2.11

0.71

LT-DF-LCC2/BS3//TD-B3LYP/BS0

2.19

0.70

2.24

0.68

LT-DF-LCC2/BS3//TD-CAM-B3LYP/BS0

2.28

0.76

2.29

0.69

LT-DF-LCC2/BS3//SAC-CI/BS2

2.27

0.76

2.33

0.71

LT-DF-LCC2/BS3//CASSCF/BS4

2.24

0.74

2.24

0.67

MS-CASPT2/BS4//TD-B3LYP/BS0

2.39

1.24

2.37

1.17

MS-CASPT2/BS4//TD-CAM-B3LYP/BS0

2.43

1.31

2.42

1.18

MS-CASPT2/BS4//SAC-CI/BS2

2.44

1.32

2.46

1.20

MS-CASPT2/BS4//CASSCF/BS4

2.40

1.28

2.37

1.15

a. BS0: 6-31+G(d,p); BS1: 6-311+G(d,p); BS2: D95(d); BS3: cc-pVDZ; BS4: 6-31G(d). b. The calculated emission values on the basis of geometries optimized by TD-DFT/6-311++G(d,p) (TD-DFT/BSL) are given in Table S2. The effects of small and large basis sets (BS0 and BSL) on the S1 geometry and emission of anionic DFHBDI are not significant.

3.2. Absorption and Emission of DFHBDI in Spinach. 3.2.1. Key Ground-State and Excited-State Geometries. For cis-DFHBDI in Spinach12 (Figure 2 and Scheme 1c-d), one of the K+ ions which were added to neutralize the system moves into the vicinity of the phenolate oxygen of the chromophore in Rs, but not in R, during the MM minimization. Inspection of the ONIOM-optimized Spinach-DFHBDI complex (Figures 2 and S4-S5) revealed several factors that can contribute to the fluorescence of the cis-DFHBDI chromophore in Spinach. The first is the extensive stacking of DFHBDI with its upper G-quadruplex and its lower UAU base pairs, which keep the chromophore planar. The second is a hydrogen bond between the phenolate oxygen of DFHBDI and the 2´-OH

10


Page 11 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of G23, which also forms a hydrogen bond with the 2´-OH of U50. In addition, there are strong hydrogen bonds between DFHBDI and the base of G28 and the 2´-OH of A53. These interactions should constrain the cis-DFHBDI chromophore to the limited cavity in Spinach. Moreover, a single positively charged K+ ion was found to coordinate with the negatively charged phenolate oxygen of DFHBDI in the small model, and this could further stabilize the anionic form of the chromophore.

Figure 2. The computed binding site of the Spinach-DFHBDI complex for (a) R and (b) Rs models. Key distances in Å were obtained from the geometry optimization by ONIOM(B3LYP/6-31+G(d,p):AMBER) (left) and ONIOM(CASSCF/6-31G(d): AMBER) (right).

3.2.2. Vertical Absorption and Emission of the Spinach-DFHBDI Complex. The vertical absorption energy of the anionic cis-DFHBDI chromophore in Spinach was calculated by SAC-CI, LT-DF-LCC2 and MS-CASPT2 methods as the QM method, with ONIOM(QM:MM)-EE scheme. The computed vertical absorption energy of the anionic DFHBDI chromophore in Spinach is slightly underestimated by the SAC-CI 11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 28

method (~2.3 eV), while the LT-DF-LCC2 method gives a slightly better result (~2.4-2.5 eV in Table 3). Comparatively, the MS-CASPT2-calculated absorption of ~2.6 eV (Table 3) agrees well with the measured excitation maximum of DFHBDI in Spinach (2.64-2.66 eV)5,13 and Spinach2 (2.77 eV).7 Moreover, the computed absorption energy of DFHBDI in Spinach is about 2.65 eV (Table S5), based on the ONIOM optimized geometry with a large QM region including DFHBDI and G23, G54, U50 as well as A53 bases. In addition, the calculated vertical absorption energy of the anionic DFHBDI chromophore in the small model Rs is generally higher than that in the model R (Table 3). The vertical emission energy was also calculated by using SAC-CI, LT-DF-LCC2 or MS-CASPT2 as the QM method in ONIOM-EE calculations. As listed in Table 3, the SAC-CI method gives a lower value for the emission energy (~2.1

eV)

of

the

anionic

cis-DFHBDI

chromophore

in

Spinach.

The

LT-DF-LCC2-calculated vertical emission energy (~2.3 eV) shows a smaller error. Whereas the MS-CASPT2-calculated value (2.45 eV) is in a good agreement with the experimental values (2.47-2.48 eV).5,7,13 Again, the calculated vertical emission energy of the anionic DFHBDI chromophore in the small model Rs is ~0.2 eV higher than the model R.

Table 3. The ONIOM(QM1:AMBER)-EE calculated vertical absorption and emission energies of the anionic cis-DFHBDI chromophore in Spinach, based on the optimized S0 and S1 geometries by ONIOM(QM2/6-31+G(d,p):AMBER).a,b QM1 methods (Energy)

Models

QM2 methods (Geometry) B3LYP

CAM-B3LYP

Absorption

Absorption

TD-CAM-B3LYP Emission

eV

f

eV

f

eV

f

SAC-CI/D95(d) LT-DF-LCC2/cc-pVDZ MS-CASPT2/6-31G(d)

R R R

2.26 2.41 2.57

0.81 0.76 1.35

2.30 2.45 2.61

0.80 0.76 1.35

2.08 2.27 2.45

0.73 0.70 1.27

SAC-CI/D95(d) LT-DF-LCC2/cc-pVDZ MS-CASPT2/6-31G(d)

Rs Rs Rs

2.47 2.48 2.78

0.78 0.66 1.20

2.56 2.54 2.88

0.77 0.65 1.14

2.20 2.38 2.65

0.74 0.70 1.21

Exptl.

R

2.64,5 2.66,13 2.777

2.47,13 2.485,7

a. ONIOM-ME optimized geometry for the model R. ONIOM-EE optimized geometry with one nearby K+ ion in the QM region for the small model Rs. b. TD-DFT cannot give reliable absorption and emission data (Table S4). 12


Page 13 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


In addition, the vertical absorption and emission energies of the anionic cis-DFHBDI chromophore in Spinach have also been computed by using MS-CASPT2/6-31G(d) as the QM method in the ONIOM-EE calculations, based on the S0 and S1 geometries optimized by the ONIOM(CASSCF/6-31G(d):AMBER) method. As shown in Table 4, the calculated vertical absorption (2.63 eV) and emission (2.41 eV) of the anionic DFHBDI chromophore in Spinach agree well with the experiments.5,7,13 The K+ ion near the phenolate oxygen of DFHBDI in the small model Rs may play a key effect on the blue-shifted absorption (2.74 eV) and emission (2.53 eV) shown in Table 4, which will be discussed in the next section.

3.2.3. The Environmental Effect on Absorption and Emission of DFHBDI in Spinach. 3.2.3.1 The Static Environment. Very similar absorption and emission data were found in the bare DFHBDI chromophore (cis-DFHBDIQM) which was taken from the two models of Spinach (Tables 4 and S6). However, a blue shift in the absorption and emission of the anionic DFHBDI chromophore in Spinach was observed, especially in Rs, and therefore, the key roles in absorption and emission of the K+ ions, hydrogen bonds, and bases around the binding site were further investigated (Scheme 2 and Tables 4 and S6).

Scheme 2. Schematic presentation of the DFHBDI binding site in Spinach.

As shown in Figure S2 and Scheme 2, intramolecular charge transfer occurs from the phenolate ring to the imidazolinone ring and bridge CH part of the anionic DFHBDI chromophore in the S0→S1 transition: the phenolate ring becomes less 13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 28

negatively-charged, while the imidazolinone ring and bridge CH part become more negatively-charged. Upon the excitation, therefore, any moieties which can gain larger electrostatic interaction from the more negatively-charged imidazolinone ring and bridge CH part should stabilize S1 more than S0 (a smaller S1-S0 energy gap) and contribute to the red-shifted spectra of DFHBDI in Spinach. Whereas, any moieties which have weaker electrostatic interaction with the less negatively-charged phenolate ring should relatively destabilize S1 (a larger S1-S0 energy gap) and lead to the blue-shifted spectra in Spinach.

Table 4. The MS-CASPT2/6-31G(d) as the QM method in the ONIOM-EE calculations of vertical absorption and emission of the Spinach-DFHDBI complex, based on the ONIOM(CASSCF/6-31G(d):AMBER) optimized S0 and S1 geometries. Absorption

Emission

eV

f

eV

f

R cis-DFHBDIQM(R)a K+ b Without Charges: A53OH G28b

2.63 2.59

1.37 1.38

2.41 2.37

1.25 1.25

2.73 2.66 2.73

1.32 1.35 1.33

2.52 2.43 2.51

1.19 1.23 1.19

Rs

2.74 2.60

1.35 1.38

2.53 2.39

1.23 1.27

2.88 2.65

1.29 1.41

2.68 2.47

1.17 1.29

QM

cis-DFHBDI Without Charges:b

(Rs)

a

K+ K+(sol)

a. The bare chromophore taken from the optimized Spinach-DFHBDI complex was used to evaluate the absorption and emission energies. b. Atomic charges of these parts were excluded in the ONIOM-EE calculations.

Firstly, one K+ ion located between two G-quadruplexes was proposed to stabilize G-quadruplex base pairs in experiments.12,13 This K+ is above the bridge CH and imidazolinone oxygen and can stabilize S1 more than S0 of DFHBDI, leading to the red shifted absorption and emission of DFHBDI by ~0.1 eV (Scheme 2 and Table 4). Secondly, additional K+ ions close to DFHBDI observed in a crystal structure were suggested to stabilize the anionic chromophore.13 In Rs, one K+ ion (called K+(sol), near the phenolate ring) can destabilize S1 of DFHBDI, and thus it induces blue shifted absorption and emission of DFHBDI by at least ~0.1 eV (Scheme 2 and Table 4). The soluble cations could therefore modulate the spectra of Spinach.9 Thirdly, 14


Page 15 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


hydrogen bonds and bases of nucleotides also affect the spectra of DFHBDI in Spinach. For examples, the 2´-OH of A53 (A53OH) and the base of G28 (G28b) which form hydrogen bonds with the imidazolinone ring, contribute to the red shifted absorption and emission of DFHBDI in Spinach (~0.02-0.1 eV, Scheme 2 and Table 4), as a result of the increased stabilization in S1 as opposed to S0 of DFHBDI. The effect of G28 base is larger than that of the 2´-OH of A53, due to the stronger hydrogen bonding of DFHBDI with G28 than with A53 (Figure 2). 3.2.3.2 The Dynamic Environment. By inspection of snapshots from the classical MD simulations, several water molecules and K+ ions were seen to approach the phenolate ring and interact with DFHBDI. Hydrogen bonds of G23 and A53 with DFHBDI can sometimes be broken (blue and cyan lines in Figure 3), but hydrogen bonds between G28 and DFHBDI remain intact (orange and pink lines in Figure 3) during the simulation time. This is consistent with the experimental observation that the guanine (G28) plays a key role in the fluorescence activation of DFHBDI in Spinach.12,13

Figure 3. The key hydrogen-bonding distances in the classical MD simulation.

Furthermore, additional ONIOM(QM:MM) optimizations for nine snapshots taken from MD simulations of the Spinach-DFHBDI complex were performed, and then the absorption and emission were calculated (Tables S7-S8). The ground state of

15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

the Spinach-DFHBDI complex can be strongly stabilized by water molecules and K+ ions, which come close to the phenolate ring in different conformations. Hence, the calculated absorption/emission of DFHBDI in Spinach obtained from these ONIOM optimized snapshots are largely blue-shifted, compared to that obtained from the energy minimized X-ray crystal structure (Tables 3 and S7-S8). As listed in Table S9, the dynamic environment contributes to the blue-shifted absorption of DFHBDI in Spinach by ~0.4-0.5 eV. One water molecule and one K+ ion close to the phenolate ring of DFHBDI can contribute to the blue-shifted absorption by ~0.1 and 0.1-0.2 eV, respectively. Therefore, solvent molecules and soluble cations could modulate the spectra of Spinach.9

3.3. Photoisomerization Mechanism of DFHBDI in Spinach. 3.3.1. Potential Energy Curves. To study the cis-trans photoisomerization mechanism, the isomerization around one bridge dihedral τ (see Chart 1) of DFHBDI in S1 was investigated in gas phase and in Spinach (Figures 4 and S6-S7). For the photoisomerization of anionic DFHBDI in gas phase (Figure S6), there is a very small barrier (~1-2 kcal/mol), which is similar to the GFP-type chromophore.25,26 However, one previous CASPT2//CASSCF study suggested that the fluorescent state (FS) of HBI may

not exist in gas phase.26 Comparatively, by using the ONIOM(MS-CASPT2//CASSCF:AMBER)-EE method, the calculated potential energy profile for the photoisomerization of the anionic DFHBDI chromophore in Spinach was found to be unfavorable (with a barrier of ~13-17 kcal/mol, see Figure 4), due mainly to the large environmental effect. When excluding the energetic contribution from the RNA environment, a barrier from the QM term was found to be ~2-3 kcal/mol. The difference in the barrier (~1 kcal/mol) between the QM contribution of DFHBDI in Spinach and gas phase should attribute to the RNA geometrical effect on the chromophore. The RNA environment further raises the barrier by ~10-15 kcal/mol. Moreover, the barrier for the clockwise rotation of the chromophore is higher than that for the counterclockwise rotation by ~4 kcal/mol. Thus, the Spinach RNA environment (e.g. key hydrogen bonds and steric 16


Page 16 of 28

Page 17 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


effects from G-quadruplexes and UAU base triple) disfavors the cis-trans photoisomerization of DFHBDI, and maintains the planar chromophore, which is the key to the fluorescence. In this respect, some mutations of any layer of G-quadruplexes, G28, or A53 in the base triple were reported to reduce or abolish the fluorescence of DFHBDI in Spinach.12,13 The above-discussed effect of RNA environment is similar to that observed in the GFP-like proteins.19,20,25,26,67 By inspection of the S0 and S1 energy curves of the clockwise or counterclockwise photo-isomerization of DFHBDI in Spinach (Figure 4), the energy gap becomes smaller when the dihedral τ is highly rotated. The mixing of the states (closed-shell and 1(π,π*) states) was found for DFHBDI in Spinach, when the dihedral τ is around 90º or 260º. Moreover, a sloped conical interaction may exist for the photoisomerization of the anionic DFHBDI chromophore in Spinach.26

17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 4. Potential energy curves for (a) clockwise (180 º → 90 º ) and (b) counterclockwise (180 º → 260 º ) photoisomerization around the dihedral τ of DFHBDI in Spinach. FC: Franck-Condon. FS: fluorescent state. 3.3.2. Geometry and Charge of DFHBDI. Now let’s pay attention to changes of the geometry and charge of the DFHBDI chromophore during the photoisomerization in Spinach. When the dihedral τ of DFHBDI is rotated by ~50-60º, the R5 bond length increases and that of R6 decreases, both to extremes, and the bond orders of these bonds are reversed (Figure 5a). The photoisomerization of DFHBDI proceeds through a hula-twist-like (not one-bond-flip) mechanism in the limited Spinach cavity, since the adjacent dihedral angle φ (see Chart 1) also rotates together with rotation of the dihedral τ of DFHBDI (Figure 5b). However, one-bond-flip photoisomerization was found for the anionic DFHBDI chromophore in gas phase, because the adjacent dihedral angle only rotates slightly (Figure S6). When the anionic cis-DFHBDI chromophore in Spinach rotates in a clockwise or counterclockwise direction, the charges in the phenolate ring (C-ring) and the imidazolinone ring (N-ring) become more and less negative respectively (Figure 5c). The charge of the bridge CH increases slightly at the beginning of the rotation but then decreases after the variation of dihedral τ exceeds ~40º. These results suggest intramolecular electron transfers mainly from the imidazolinone ring to the phenolate ring and bridge CH in the photoisomerization. As a consequence, the hydrogen bonds 18


Page 18 of 28

Page 19 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


between the phenolate oxygen of DFHBDI and 2´-OH of G23 as well as water molecules become stronger. In addition, electrostatic interactions between the highly twisted DFHBDI and its nearby cations should be enhanced. The imidazolinone ring with lower negative charge in S1 leads to a weakening of the hydrogen bonds between DFHBDI and G28/A53. The above-discussed features found for the anionic DFHBDI chromophore are qualitatively similar to those found for the wild-type GFP chromophore (HBDI or HBI), which have been reported by several research groups.19,20,25,26,67-69

Figure 5. (a) Bridge bond lengths, (b) key dihedrals, and (c) charges of DFHBDI during the photoisomerization. 19



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3.4. The trans-DFHBDI in Spinach. 3.4.1. The formation of trans-DFHBDI in Spinach. The highly twisted DFHBDI in S1 can regenerate the original cis conformer or further isomerize to form the trans conformer after decaying to S0. Here, the trans´- and trans´´-DFHBDI were obtained from the clockwise and counterclockwise rotation around the dihedral τ of cis-DFHBDI in Spinach, respectively (Figures 6 and S8 and Table S10), on the assumption that the photoisomerization of DFHBDI occurs only rarely. For trans´-DFHBDI in Spinach, the key hydrogen bonds of DFHBDI with G28 and G23 were found to be broken, A53 forms a hydrogen bond with the imidazolinone oxygen of DFHBDI, and G28 shifts toward the phenolate side. Comparatively, hydrogen bonds of DFHBDI with G23 and A53 remain intact for trans´´-DFHBDI in Spinach, but G28 shifts slightly. In this connection, it was proposed that the trans isomer of DFHBDI has steric clashes and fewer hydrogen bonds than cis-DFHBDI in Spinach.13

Figure 6. Superimposition of cis-DFHBDI (in green) and (a) trans´-DFHBDI (in cyan) as well as (b) trans´´-DFHBDI (in pink) from the cis-trans photoisomerization of the DFHBDI chromophore in Spinach.

3.4.2. Dissociation of the trans-DFHBDI chromophore in Spinach. Classical MD simulations were performed starting from the ONIOM-optimized trans´- and trans´´-DFHBDI in Spinach (Figures 6 and S8). The trans´´-DFHBDI was found to 20


Page 20 of 28

Page 21 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


move out of the binding site of Spinach in the MD simulation (Figure S9). Possibly, this is driven by interactions with water molecules and cations close to DFHBDI anion, and weakened or broken hydrogen bonds with nearby nucleotides in Spinach.13 In addition, the gate and cavity formed within the G-quadruplex and the UAU base triple was found to be open during the dissociation of trans´´-DFHBDI in Spinach. The base of A58 changes its position, and may reconstruct a base triple after trans-DFHBDI moves out of Spinach. Another cis-DFHBDI in solution may bind to Spinach by forming favorable interactions. This is consistent with the observed photoconversion and fast dissociation of trans-DFHBDI resulting in the fluorescence decay and the DFHBDI concentration dependent recovery in Spinach.11

3.5. Fluorescence Activation in Spinach and GFP. DFHBDI as a new GFP-like chromophore is in the anionic form, since two fluorine substituents increase its acidity and reduce its pKa. The Spinach-DFHBDI complex has an enhanced fluorescence quantum yield and brightness.5-9 The anionic cis-DFHBDI chromophore can bind to Spinach in a specific binding site within the rigid two-layer G-quadruplexes and the relatively flexible base triple (Schemes 1e and 2). This binding in Spinach involves formation of hydrogen bonds with its nearby nucleotides as well as stacking interactions with G-quadruplex and the base triple. These structural features in Spinach enforce a planar conformation of the anionic DFHBDI chromophore to minimize radiationless decay, and suppress cis-trans photoisomerization of DFHBDI (with a higher barrier, Figure 4), that thus enhances the green fluorescence of the DFHBDI chromophore. Both Spinach and GFP or GFP-like proteins bind favorably with the cis conformer of the chromophore through hydrogen bonds and stacking interactions to retain the planarity of the chromophore and to enhance fluorescence. However, the anionic DFHBDI chromophore in Spinach may interact with water molecules and cations in solution. In addition, the fluorescence decay and recovery of the Spinach-DFHBDI complex are related to the DFHBDI concentration and its dissociation or association with Spinach. These features are different from GFP and 21



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

its derivatives. The chromophore in GFP or GFP-like proteins is buried in the β-barrel of the protein and is covalently linked with the protein. Therefore, it is hard for the GFP or GFP-like chromophore to interact directly with water molecules and cations in solution, and dissociation of the GFP or GFP-like chromophore is impossible. Moreover, excited-state proton transfer (ESPT) through hydrogen-bond network is responsible for photoactivation of the neutral GFP or GFP-like chromophore to generate the anionic chromophore. ESPT does not operate in Spinach.

4. Conclusion. For the first time, our multi-scale simulations have elucidated spectral tuning and photoisomerization mechanism in the Spinach-DFHBDI complex at the atomic scale. Moieties (e.g. K+, the 2´-OH of A53, and the base of G28) can stabilize S1 more than S0 of DFHBDI and thus induce the red-shifted spectra in Spinach-DFHBDI complex. Moreover, the steric repulsion from the two layers (G-quadruplex and UAU base triple) and the formation of strong hydrogen bonds with nearby nucleotides suppress the cis-trans photoisomerization of DFHBDI in Spinach. These structural factors result in green fluorescence of the anionic DFHBDI chromophore in Spinach. Furthermore, trans-DFHBDI could dissociate from the binding site in Spinach, since the RNA environment binds to trans-DFHBDI unfavorably. Obviously, the fluorescence decay and recovery of the Spinach-DFHBDI complex are distinct from GFP or GFP-like proteins.

Acknowledgment. X.L. thanks DICP for the 100 Talents Support Grant. This work is supported by the NSFC (Grant No. 21373203 and 21473086) and the Shenzhen Science and Technology Innovation Committee (KQTD20150717103157174).

Supporting Information Available: Simulation details, Figures S1-S9, Tables S1-S10, Cartesian coordinates of DFHBDI in gas phase, and supplementary citations. This information is available free of charge via the Internet at http://pubs.acs.org/.

22


Page 22 of 28

Page 23 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


References (1) Tsien, R. Y. The Green Fluorescent Protein. Annu. Rev. Biochem. 1998, 67, 509-544. (2) Zimmer, M. Green Fluorescent Protein (GFP): Applications, Structure, and Related Photophysical Behavior. Chem. Rev. 2002, 102, 759-782. (3) Subach, F. V.; Verkhusha, V. V. Chromophore Transformations in Red Fluorescent Proteins. Chem. Rev. 2012, 112, 4308-4327. (4) Dedecker P.; De Schryver, F. C.; Hofkens. J. Fluorescent Proteins: Shine on, You Crazy Diamond. J. Am. Chem. Soc. 2013, 135, 2387-2402. (5) Paige, J. S.; Wu, K. Y.; Jaffrey, S. R. RNA Mimics of Green Fluorescent Protein. Science 2011, 333, 642-646. (6) Strack, R. L.; Disney, M. D.; Jaffrey, S. R. A Superfolding Spinach2 Reveals the Dynamic Nature of Trinucleotide Repeat–Containing RNA. Nat. Methods 2013, 10, 1219-1224. (7) Song, W.; Strack, R. L.; Svensen, N.; Jaffrey, S. R. Plug-and-Play Fluorophores Extend the Spectral Properties of Spinach. J. Am. Chem. Soc. 2014, 136, 1198-1201. (8) Filonov, G. S.; Moon, J. D.; Svensen, N.; Jaffrey, S. R. Broccoli: Rapid Selection of an RNA Mimic of Green Fluorescent Protein by Fluorescence-Based Selection and Directed Evolution. J. Am. Chem. Soc. 2014, 136, 16299-16308. (9) You, M.; Jaffrey, S. R. Structure and Mechanism of RNA Mimics of Green Fluorescent Protein. Annu. Rev. Biophys. 2015, 44, 187-206. (10) Wang, P.; Querard, J.; Maurin, S.; Nath, S. S.; Saux, T. L.; Gautier, A.; Jullien, L. Photochemical Properties of Spinach and Its Use in Selective Imaging. Chem. Sci. 2013, 4, 2865-2873. (11) Han, K. Y.; Leslie, B. J.; Fei, J.; Zhang, J.; Ha, T. Understanding the Photophysics of the Spinach−DFHBI RNA Aptamer−Fluorogen Complex To Improve Live-Cell RNA Imaging. J. Am. Chem. Soc. 2013, 135, 19033-19038. (12) Huang, H.; Suslov, N. B.; Li, N.-S.; Shelke, S. A.; Evans, M. E.; Koldobskaya, Y.; Rice, P. A.; Piccirilli, J. A. A G-Quadruplex–Containing RNA Activates Fluorescence in a GFP-like Fluorophore. Nat. Chem. Biol. 2014, 10, 686-691. (13) Warner, K. D.; Chen, M. C.; Song, W.; Strack, R. L.; Thorn, A.; Jaffrey, S. R.; Ferré-D’Amaré, A. R. Structural Basis for Activity of Highly Efficient RNA Mimics of Green Fluorescent Protein. Nat. Struct. Mol. Biol. 2014, 10, 658-663. (14) Ketterer, S.; Fuchs, D.; Weber, W.; Meier, M. Systematic Reconstruction of Binding and Stability Landscapes of the Fluorogenic Aptamer Spinach. Nucleic Acids Res. 2015, 43, 9564-9572. (15) Daday, C.; Curutchet C.; Sinicropi, A.; Mennucci, B.; Filippi, C. Chromophore–Protein Coupling beyond Nonpolarizable Models: Understanding Absorption in Green Fluorescent Protein. J. Chem. Theory Comput. 2015, 11, 4825-4839. (16) Bravaya, K. B.; Grigorenko, B. L.; Nemukhin, A. V.; Krylov, A. I. Quantum Chemistry Behind Bioimaging: Insights from Ab Initio Studies of Fluorescent Proteins and Their Chromophores. Acc. Chem. Res. 2012, 45, 265-275. (17) Cui, G.; Lan, Z.; Thiel, W. Intramolecular Hydrogen Bonding Plays a Crucial Role in the Photophysics and Photochemistry of the GFP Chromophore. J. Am. Chem. Soc. 2012, 134, 1662-1672. (18) Hasegawa, J, Y.; Fujimoto, K. J.; Nakatsuji, H. Color Tuning in Photofunctional Proteins. Chem. Phys. Chem. 2011, 12, 3106-3115. (19) Li, X.; Chung, L. W.; Mizuno, H.; Miyawaki, A.; Morokuma, K. A Theoretical Study on the 23



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Nature of On- and Off-States of Reversibly Photoswitching Fluorescent Protein Dronpa: Absorption, Emission, Protonation, and Raman. J. Phys. Chem. B 2010, 114, 1114-1126. (20) Li, X.; Chung, L. W.; Mizuno, H.; Miyawaki, A.; Morokuma, K. Primary Events of Photodynamics in Reversible Photoswitching Fluorescent Protein Dronpa. J. Phys. Chem. Lett. 2010, 1, 3328–3333. (21) Li, X.; Chung, L. W.; Mizuno, H.; Miyawaki, A.; Morokuma, K. Competitive Mechanistic Pathways for Green-to-Red Photoconversion in the Fluorescent Protein Kaede: A Computational Study. J. Phys. Chem. B 2010, 114, 16666-16675. (22) (a) Virshup, A. M.; Punwong, C.; Pogorelov, T. V.; Lindquist, B. A.; Ko, C.; Martínez, T. J. Photodynamics in Complex Environments: Ab Initio Multiple Spawning Quantum Mechanical/Molecular Mechanical Dynamics. J. Phys. Chem. B 2009, 113, 3280-3291. (b) Tomasello, G.; Olaso-González, G.; Altoè, P.; Stenta, M.; Serrano-Andrés, L.; Merchán, M.; Orlandi, G.; Bottoni, A.; Garavelli, M. Electrostatic Control of the Photoisomerization Efficiency and Optical Properties in Visual Pigments: On the Role of Counterion Quenching. J. Am. Chem. Soc. 2009, 131, 5172-5186. (c) Strambi, A.; Durbeej, B.; Ferré, N.; Olivucci, M. Anabaena Sensory Rhodopsin is A Light-Driven Unidirectional Rotor. Proc. Natl. Acad. Sci. USA 2010, 107, 21322-21326. (d) Altoè, P.; Cembran, A.; Olivucci, M.; Garavelli, M. Aborted Double Bicycle-Pedal Isomerization with Hydrogen Bond Breaking is the Primary Event of Bacteriorhodopsin Proton Pumping. Proc. Natl. Acad. Sci. USA 2010, 107, 20172-20177. (23) Hasegawa, J. Y.; Fujimoto, K.; Swerts, B.; Miyahara, T.; Nakatsuji, H. Excited States of GFP Chromophore and Active Site Studied by the SAC-CI Method: Effect of Protein-Environment and Mutations. J. Comput. Chem. 2007, 28, 2443-2452. (24) Vendrell, O.; Gelabert, R.; Moreno, M.; Lluch, J. M. Potential Energy Landscape of the Photoinduced Multiple Proton-Transfer Process in the Green Fluorescent Protein: Classical Molecular Dynamics and Multiconfigurational Electronic Structure Calculations. J. Am. Chem. Soc. 2006, 128, 3564-3574. (25) Altoe, P.; Bernardi, F.; Garavelli, M.; Orlandi, G.; Negri, F. Solvent Effects on the Vibrational Activity and Photodynamics of the Green Fluorescent Protein Chromophore: A Quantum-Chemical Study. J. Am. Chem. Soc. 2005, 127, 3952-3963. (26) Martin, M. E.; Negri, F.; Olivucci, M. Origin, Nature, and Fate of the Fluorescent State of the Green Fluorescent Protein Chromophore at the CASPT2//CASSCF Resolution. J. Am. Chem. Soc. 2004, 126, 5452-5464. (27) Maseras, F.; Morokuma, K. IMOMM: A New Integrated Ab Initio + Molecular Mechanics Geometry Optimization Scheme of Equilibrium Structures and Transition States. J. Comput. Chem. 1995, 16, 1170-1179. (28) Dapprich, S.; Komáromi, I.; Byun, S.; Morokuma, K.; Frisch, M. J. A New ONIOM Implementation in Gaussian98. Part I. The Calculation of Energies, Gradients, Vibrational Frequencies and Electric Field Derivatives. THEOCHEM 1999, 461, 1-21. (29) Vreven, T.; Byun, K. S.; Komáromi, I.; Dapprich, S.; Montgomery, J. A., Jr.; Morokuma, K.; Frisch, M. J. Combining Quantum Mechanics Methods with Molecular Mechanics Methods in ONIOM. J. Chem. Theory Comput. 2006, 2, 815-826. (30) Li, X.; Chung, L. W.; Morokuma, K. Photodynamics of All-trans Retinal Protonated Schiff Base in Bacteriorhodopsin and Methanol Solution. J. Chem. Theory Comput. 2011, 7, 2694-2698. (31) Chung, L. W.; Hirao, H.; Li, X.; Morokuma, K. The ONIOM Method: Its Foundation and

24


Page 24 of 28

Page 25 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Applications to Metalloenzymes and Photobiology. WIREs: Comput. Mol. Sci. 2012, 2, 327-350. (32) Li, X.; Chung, L. W.; Morokuma, K.; Li, G. Theoretical Study on the UVR8 Photoreceptor: Sensing Ultraviolet-B by Tryptophan and Dissociation of Homodimer. J. Chem. Theory Comput. 2014, 10, 3319-3330. (33) Chung, L. W.; Sameera, W. M. C.; Ramozzi, R.; Page, A. J.; Hatanaka, M.; Petrova, G. P.; Harris, T. V.; Li, X.; Ke, Z.; Liu, F.; Li, H.-B.; Ding, L.; Morokuma, K. The ONIOM Method and Its Applications. Chem. Rev. 2015, 115, 5678-5796. (34) Case, D. A.; Babin, V.; Berryman, J. T.; Betz, R. M.; Cai, Q.; Cerutti, D. S.; Cheatham, III, T. E.; Darden, T. A.; Duke, R. E.; Gohlke, H.; Goetz, A. W.; Gusarov, S.; Homeyer, N.; Janowski, P.; Kaus, J.; Kolossváry, I.; Kovalenko, A.; Lee, T. S.; LeGrand, S.; Luchko, T.; Luo, R.; Madej, B.; Merz, K. M.; Paesani, F.; Roe, D. R.; Roitberg, A.; Sagui, C.; Salomon-Ferrer, R.; Seabra, G.; Simmerling, C. L.; Smith, W.; Swails, J.; Walker, R. C.; Wang, J.; Wolf, R. M.; Wu, X.; Kollman, P. A. AMBER 14, University of California, San Francisco, 2014. (35) Salomon-Ferrer, R.; Case, D. A.; Walker. R. C. An Overview of the Amber Biomolecular Simulation Package. WIREs Comput. Mol. Sci. 2013, 3, 198-210. (36) Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R. W.; Klein, M. L. Comparison of Simple Potential Functions for Simulating Liquid Water. J. Chem. Phys. 1983, 79, 926-935. (37) Cornell, W. D.; Cieplak, P.; Bayly, C. I.; Gould, I. R.; Merz, K. M.; Ferguson, D. M.; Spellmeyer, D. C.; Fox, T.; Caldwell, J. W.; Kollman, P. A. A Second Generation Force Field for the Simulation of Proteins, Nucleic Acids, and Organic Molecules. J. Am. Chem. Soc. 1995, 117, 5179-5197. (38) Wang, J.; Cieplak, P.; Kollman, P. A. How Well Does a Restrained Electrostatic Potential (RESP) Model Perform in Calculating Conformational Energies of Organic and Biological Molecules? J. Comput. Chem. 2000, 21, 1049-1074. (39) Pérez, A.; Marchán, I.; Svozil, D.; Sponer, J.; Cheatham, T. E.; Laughton, C. A.; Orozco, M. Refinement of the AMBER Force Field for Nucleic Acids: Improving the Description of α/γ Conformers. Biophys. J. 2007, 92, 3817-3829. (40) Banáš, P.; Hollas, D.; Zgarbová, M.; Jurečka, P.; Orozco, M.; Cheatham, T. E; Šponer, J.; Otyepka, M. Performance of Molecular Mechanics Force Fields for RNA Simulations: Stability of UUCG and GNRA Hairpins. J. Chem. Theory. Comput. 2010, 6, 3836-3849. (41) Zgarbová, M.; Otyepka, M.; Šponer, J.; Mládek, A.; Banáš, P.; Cheatham, T. E.; Jurečka, P. Refinement of the Cornell et al. Nucleic Acids Force Field Based on Reference Quantum Chemical Calculations of Glycosidic Torsion Profiles. J. Chem. Theory Comput. 2011, 7, 2886-2902. (42) Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.; Cheeseman, J. R.; Scalmani, G.; Barone, V.; Mennucci, B.; Petersson, G. A.; Nakatsuji, H.; Caricato, M.; Li, X.; Hratchian, H. P.; Izmaylov, A. F.; Bloino, J.; Zheng, G.; Sonnenberg, J. L.; Hada, M.; Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima, T.; Honda, Y.; Kitao, O.; Nakai, H.; Vreven, T.; Montgomery, Jr., J. A.; Peralta, J. E.; Ogliaro, F.; Bearpark, M.; Heyd, J. J.; Brothers, E.; Kudin, K. N.; Staroverov, V. N.; Kobayashi, R.; Normand, J.; Raghavachari, K.; Rendell, A.; Burant, J. C.; Iyengar, S. S.; Tomasi, J.; Cossi, M.; Rega, N.; Millam, J. M.; Klene, M.; Knox, J. E.; Cross, J. B.; Bakken, V.; Adamo, C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin, A. J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Martin, R. L.; Morokuma, K.; Zakrzewski, V. G.; Voth, G. A.; Salvador, P.; Dannenberg, J. J.; Dapprich, S.; Daniels, A. D.; Farkas, Ö.;

25



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Foresman, J. B.; Ortiz, J. V.; Cioslowski, J.; Fox, D. J. Gaussian 09, Revision C.01; Gaussian, Inc.; Wallingford CT, 2009. (43) Becke, A. D. Density-Functional Thermochemistry. III. The Role of Exact Exchange. J. Chem. Phys. 1993, 98, 5648-5652. (44) Lee, C.; Yang, W.; Parr, R. G. Development of the Colle-Salvetti Correlation-Energy Formula into a Functional of the Electron Density. Phys. ReV. B 1988, 37, 785-789. (45) Yanai, T.; Tew, D. P.; Handy, N. C. A New Hybrid Exchange–Correlation Functional Using the Coulomb-Attenuating Method (CAM-B3LYP). Chem. Phys. Lett. 2004, 393, 51-57. (46) Werner, H.-J.; Knowles, P. J. A Second Order Multiconfiguration SCF Procedure with Optimum Convergence. J. Chem. Phys. 1985, 82, 5053-5063. (47) Knowles, P. J.; Werner, H.-J. An Efficient Second-Order MC SCF Method for Long Configuration Expansions. Chem. Phys. Lett. 1985, 115, 259-267. (48) Roos, B. O.; Taylor, P. R.; Siegbahn, P. E. M. A Complete Active Space SCF Method (CASSCF) Using a Density Matrix Formulated Super-CI Approach. Chem. Phys. 1980, 48, 157-173. (49) Roos, B. O. Ab Initio Methods in Quantum Chemistry − II. In Advances in Chemical Physics, Lawley, K. P., Eds.; John Wiley and Sons, Ltd.: Chichester, England, 1987; Chapter 69, pp 399. (50) Stratmann, R. E.; Scuseria, G. E.; Frisch, M. J. An Efficient Implementation of Time-Dependent Density-Functional Theory for the Calculation of Excitation Energies of Large Molecules. J. Chem. Phys. 1998, 109, 8218-8224. (51) Bauernschmitt, R.; Ahlrichs, R. Treatment of Electronic Excitations within the Adiabatic Approximation of Time Dependent Density Functional Theory. Chem. Phys. Lett. 1996, 256, 454-464. (52) Nakatsuji, H. Cluster Expansion of the Wavefunction. Excited states. Chem. Phys. Lett. 1978, 59, 362-364. (53) Nakatsuji, H. Cluster Expansion of the Wavefunction. Electron Correlations in Ground and Excited States by SAC (Symmetry-Adapted-Cluster) and SAC CI Theories. Chem. Phys. Lett. 1989, 67, 329-333. (54) Nakatsuji, H. Cluster Expansion of the Wavefunction. Calculation of Electron Correlations in Ground and Excited States by SAC and SAC CI Theories. Chem. Phys. Lett. 1989, 67, 334-342. (55) Shao, Y.; Head-Gordon, M.; Krylov, A. I. The Spin-Flip Approach Within Time-Dependent Density Functional Theory: Theory and Applications to Diradicals. J. Chem. Phys. 2003, 118, 4807-4818. (56) Bernard, Y. A.; Shao, Y.; Krylov, A. I. General Formulation of Spin-Flip Time-Dependent Density Functional Theory Using Non-Collinear Kernels: Theory, Implementation, and Benchmarks. J. Chem. Phys. 2012, 136, 204103. (57) Kats, D.; Korona, T.; Schütz, M. Local CC2 Electronic Excitation Energies for Large Molecules with Density Fitting. J. Chem. Phys. 2006, 125, 104106. (58) Kats, D.; Schütz, M. A Multistate Local Coupled Cluster CC2 Response Method Based on the Laplace Transform. J. Chem. Phys. 2009, 131, 124117. (59) Andersson, K.; Malmqvist, P.-Å.; Roos, B. O.; Sadlej, A. J.; Wolinski, K. Second-Order Perturbation Theory with a CASSCF Reference Function. J. Phys. Chem. 1990, 94, 5483-5488. (60) Andersson, K.; Malmqvist, P.-Å.; Roos, B. O. Second-Order Perturbation Theory with a Complete Active Space Self-Consistent Field Reference Function. J. Chem. Phys. 1992, 96,

26


Page 26 of 28

Page 27 of 28

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


1218-1226. (61) Finley, J.; Malmqvist, P.-Å.; Roos, B. O.; Serrano-Andrés, L. The Multi-State CASPT2 Method. Chem. Phys. Lett. 1998, 288, 299-306. (62) Shao, Y.; Gan, Z.; Epifanovsky, E.; Gilbert, A. T. B.; Wormit, M.; Kussmann, J.; Lange, A. W.; Behn, A.; Deng, J.; Feng, X.; Ghosh, D.; Goldey, M.; Horn, P. R.; Jacobson, L. D.; Kaliman, I.; Khaliullin, R. Z.; Kus, T.; Landau, A.; Liu, J.; Proynov, E. I.; Rhee, Y. M.; Richard, R. M.; Rohrdanz, M. A.; Steele, R. P.; Sundstrom, E. J.; Woodcock, H. L., III; Zimmerman, P. M.; Zuev, D.; Albrecht, B.; Alguire, E.; Austin, B.; Beran, G. J. O.; Bernard, Y. A.; Berquist, E.; Brandhorst, K.; Bravaya, K. B.; Brown, S. T.; Casanova, D.; Chang, C.-M.; Chen, Y.; Chien, S. H.; Closser, K. D.; Crittenden, D. L.; Diedenhofen, M.; DiStasio, R. J., Jr.; Do, H.; Dutoi, A. D.; Edgar, R. G.; Fatehi, S.; Fusti-Molnar, L.; Ghysels, A.; Golubeva-Zadorozhnaya, A.; Gomes, J.; Hanson-Heine, M. W. D.; Harbach, P. H. P.; Hauser, A. W.; Hohenstein, E. G.; Holden, Z. C.; Jagau, T.-C.; Ji, H.; Kaduk, B.; Khistyaev, K.; Kim, J.; Kim, J.; King, R. A.; Klunzinger, P.; Kosenkov, D.; Kowalczyk, T.; Krauter, C. M.; Lao, K. U.; Laurent, A.; Lawler, K. V.; Levchenko, S. V.; Lin, C. Y.; Liu, F.; Livshits, E.; Lochan, R. C.; Luenser, A.; Manohar, P.; Manzer, S. F.; Mao, S.-P.; Mardirossian, N.; Marenich, A. V.; Maurer, S. A.; Mayhall, N. J.; Neuscamman, E.; Oana, C. M.; Olivares-Amaya, R.; O’Neill, D. P.; Parkhill, J. A.; Perrine, T. M.; Peverati, R.; Prociuk, A.; Rehn, D. R.; Rosta, E.; Russ, N. J.; Sharada, S. M.; Sharma, S.; Small, D. W.; Sodt, A.; Stein, T.; Stuck, D.; Su, Y.-C.; Thom, A. J. W.; Tsuchimochi, T.; Vanovschi, V.; Vogt, L.; Vydrov, O.; Wang, T.; Watson, M. A.; Wenzel, J.; White, A.; Williams, C. F.; Yang, J.; Yeganeh, S.; Yost, S. R.; You, Z.-Q.; Zhang, I. Y.; Zhang, X.; Zhao, Y.; Brooks, B. R.; Chan, G. K. L.; Chipman, D. M.; Cramer, C. J.; Goddard, W. A., III; Gordon, M. S.; Hehre, W. J.; Klamt, A.; Schaefer, H. F., III; Schmidt, M. W.; Sherrill, C. D.; Truhlar, D. G.; Warshel, A.; Xu, X.; Aspuru-Guzik, A.; Baer, R.; Bell, A. T.; Besley, N. A.; Chai, J.-D.; Dreuw, A.; Dunietz, B. D.; Furlani, T. R.; Gwaltney, S. R.; Hsu, C.P.; Jung, Y.; Kong, J.; Lambrecht, D. S.; Liang, W.; Ochsenfeld, C.; Rassolov, V. A.; Slipchenko, L. V.; Subotnik, J. E.; Van Voorhis, T.; Herbert, J. M.; Krylov, A. I.; Gill, P. M. W.; Head-Gordon, M. Advances in Molecular Quantum Chemistry Contained in the Q-Chem 4 Program Package. Mol. Phys. 2015, 113, 184-215. (63) Werner, H.-J.; Knowles, P. J.; Knizia, G.; Manby, F. R.; Schüz, M.; Celani, P.; Korona, T.; Lindh, R.; Mitrushenkov, A.; Rauhut, G.; Shamasundar, K. R.; Adler, T. B.; Amos, R. D.; Bernhardsson, A.; Berning, A.; Cooper, D. L.; Deegan, M. J. O.; Dobbyn, A. J.; Eckert, F.; Goll, E.; Hampel, C.; Hesselmann, A.; Hetzer, G.; Hrenar, T.; Jansen, G.; Köppl, C.; Liu, Y.; Lloyd, A. W.; Mata, R. A.; May, A. J.; McNicholas, S. J.; Meyer, W.; Mura, M. E.; Nicklass, A.; O’Neill, D. P.; Palmieri, P.; Pflüger, K.; Pitzer, R.; Reiher, M.; Shiozaki, T.; Stoll, H.; Stone, A. J.; Tarroni, R.; Thorsteinsson, T.; Wang, M.; Wolf, A. MOLPRO, version 2010 and 2012, a package of ab initio programs, see http://www.molpro.net. (64) Werner, H.-J.; Knowles, P. J.; Knizia, G.; Manby, F. R.; Schütz, M. Molpro: A General‐Purpose Quantum Chemistry Program Package. WIREs Comput. Mol. Sci. 2012, 2, 242-253. (65) Aquilante, F.; Autschbach, J.; Carlson, R. K.; Chibotaru, L. F.; Delcey, M. G.; De Vico, L.; Fdez. Galván, I.; Ferré, N.; Frutos, L. M.; Gagliardi, L.; Garavelli, M.; Giussani, A.; Hoyer, C. E.; Li Manni, G.; Lischka, H.; Ma, D.; Malmqvist, P. Å.; Müller, T.; Nenov, A.; Olivucci, M.; Pedersen, T. B.; Peng, D.; Plasser, F.; Pritchard, B.; Reiher, M.; Rivalta, I.; Schapiro, I.; Segarra-Mart J.; Stenrup, M.; Truhlar, D. G.; Ungur, L.; Valentini, A.; Vancoillie, S.; Veryazov, V.;

27



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Vysotskiy, V. P.; Weingart, O.; Zapata, F.; Lindh, R. MOLCAS 8: New Capabilities for Multiconfigurational Quantum Chemical Calculations across the Periodic Table. J. Comput. Chem. 2016, 37, 506-541. (66) Nielsen, S. B.; Lapierre, A.; Andersen, J. U.; Pedersen, U. V.; Tomita, S.; Andersen., L. H. Absorption Spectrum of the Green Fluorescent Protein Chromophore Anion In Vacuo. Phys. Rev. Lett. 2001, 87, 228102. (67) Olsen, S.; Lamothe, K.; Martínez, T. J. Protonic Gating of Excited-State Twisting and Charge Localization in GFP Chromophores: A Mechanistic Hypothesis for Reversible Photoswitching. J. Am. Chem. Soc. 2010, 132, 1192-1193. (68) Polyakov, I.; Epifanovsky, E.; Grigorenko, B.; Krylov, A. I.; Nemukhin, A. Quantum Chemical Benchmark Studies of the Electronic Properties of the Green Fluorescent Protein Chromophore: 2. Cis-Trans Isomerization in Water. J. Chem. Theory Comput. 2009, 5, 1907-1914. (69) Polyakov, I. V.; Grigorenko, B. L.; Epifanovsky, E. M.; Krylov, A. I.; Nemukhin, A. V. Potential Energy Landscape of the Electronic States of the GFP Chromophore in Different Protonation Forms: Electronic Transition Energies and Conical Intersections. J. Chem. Theory Comput. 2010, 6, 2377-2387.

Graphical TOC Entry

28


Page 28 of 28

Multiscale Simulations on Spectral Tuning and the Photoisomerization

Recommend Documents