Article pubs.acs.org/JAFC
Mutant Potential Ubiquitination Sites in Dur3p Enhance the Urea and Ethyl Carbamate Reduction in a Model Rice Wine System Peng Zhang,† Guocheng Du,† Huijun Zou,‡ Guangfa Xie,‡ Jian Chen,† Zhongping Shi,*,† and Jingwen Zhou*,† †
Key Laboratory of Industrial Biotechnology, Ministry of Education and School of Biotechnology, Jiangnan University, 1800 Lihu Road, Wuxi, Jiangsu 214122, China ‡ Zhejiang Guyuelongshan Shaoxing Wine Company, 13 Yangjiang Road, Shaoxing, Zhejiang 312099, China ABSTRACT: Ubiquitination can significantly affect the endocytosis and degradation of plasma membrane proteins. Here, the ubiquitination of a Saccharomyces cerevisiae urea plasma membrane transporter (Dur3p) was altered. Two potential ubiquitination sites, lysine residues K556 and K571, of Dur3p were predicted and replaced by arginine, and the effects of these mutations on urea utilization and formation under different nitrogen conditions were investigated. Compared with Dur3p, the Dur3pK556R mutant showed a 20.1% decrease in ubiquitination level in yeast nitrogen base medium containing urea and glutamine. It also exhibited a >75.8% decrease in urea formation in yeast extract−peptone−dextrose medium and 41.3 and 55.4% decreases in urea and ethyl carbamate formation (a known carcinogen), respectively, in a model rice wine system. The results presented here show that the mutation of Dur3p ubiquitination sites could significantly affect urea utilization and formation. Modifying the ubiquitination of specific transporters might have promising applications in rationally engineering S. cerevisiae strains to efficiently use specific nitrogen sources. KEYWORDS: nitrogen catabolite repression, nitrogen sources, post-translational modifications, site-directed mutagenesis, urea transporter
■
INTRODUCTION Urea plays an important role in the metabolism of nitrogencontaining compounds in animals.1 It is mainly generated by the urea cycle, which involves a set of biochemical reactions that produce urea ((NH2)2CO) from ammonia (NH3).2 In most Saccharomyces cerevisiae strains, urea is considered to be a nonpreferred nitrogen source. Excessive urea accumulation is harmful for the food safety of fermentation products, because it can react with ethanol to form ethyl carbamate (EC), which is a known carcinogen.3 During the production of a majority of fermented foods, as shown in Figure 1, urea is directly formed via the degradation of arginine by arginase (Car1p).4 Cellular urea can be further degraded into carbon dioxide (CO2) and ammonia (NH3) by urea amidolyase (Dur1,2p) or secreted by the urea membrane transporter Dur4p.5 Another important urea transporter, Dur3p, is also involved in the uptake of extracellular urea when cells require additional nitrogen.5 S. cerevisiae prefers to use “good” nitrogen sources (such as glutamine and asparagine) rather than “poor” nitrogen sources (such as proline, γ-aminobutyric acid, and urea).6,7 This phenomenon is regulated by a mechanism that is referred to as nitrogen catabolite repression,8 and the accumulation of urea during wine fermentation is considered to be directly regulated by this process. The addition of extra glutamine, which is the preferred nitrogen source, influences extracellular urea utilization and inhibits the expression of the DUR1,2 and DUR3 genes.7 In addition to the regulation of upstream factors, other metabolic engineering studies have mainly focused on the rational modification of the transport, degradation, and regulation processes that are related to arginine and urea metabolism.3 Many metabolic engineering strategies, such as © 2017 American Chemical Society
Figure 1. Urea metabolic pathway. Intracellular arginine is degraded to urea and ornithine through the urea cycle, and then urea is degraded to CO2 and NH4 by urea amidolyase (Dur1,2p) or secreted by urea permease Dur4p. Extracellular urea can be imported into cells by Dur3p; it also can react with ethanol to form ethyl carbamate.
gene disruption, gene overexpression, and antisense RNA inhibition, have been used to regulate these processes.9−11 Received: Revised: Accepted: Published: 1641
November 29, 2016 February 9, 2017 February 10, 2017 February 10, 2017 DOI: 10.1021/acs.jafc.6b05348 J. Agric. Food Chem. 2017, 65, 1641−1648
Article
Journal of Agricultural and Food Chemistry Ubiquitination is a well-characterized post-translational modification that is involved in many cellular processes, such as substrate degradation, stabilization, and relocalization.12 It alters nutrient uptake by regulating the trafficking and endocytosis of plasma membrane (PM) transporters.13 In response to environmental cues, certain PM transporters can be ubiquitinated, which triggers their endocytosis and degradation.14,15 Previous work showed that the ubiquitination of the K9 and K16 lysine residues of Gap1p affects its sorting from the PM to the vacuole.16 Mutations of the ubiquitination sites of hexose transporters lead to pentose accumulation in S. cerevisiae.17 Although Dur3p is known to be a PM transporter for both urea and polyamines, Dur3p overexpression had a lower than expected influence on urea degradation.18 Thus, whether altering the ubiquitination of Dur3p could enhance urea transport and extracellular urea reduction needs to be confirmed. To investigate the effect of Dur3p ubiquitination on urea formation in S. cerevisiae, the ubiquitination of Dur3p was altered using a ubiquitination site prediction and mutagenesis strategy.19 Two lysine residues as potential ubiquitination sites, K556 and K571, of Dur3p were replaced by arginine (R), and the influence of these Dur3p mutations on ubiquitination was analyzed. The effect of the Dur3p ubiquitination level on urea utilization and formation was also determined under various culture conditions. Finally, the effect of Dur3p ubiquitination on urea formation was further verified in a model rice wine production system. Base on the results of this study, we postulated that mutating the ubiquitination sites of Dur3p altered its ubiquitination level and enhanced the urea and EC reduction. Moreover, modification of ubiquitination sites might be employed as an effective metabolic engineering strategy to regulate the use of urea and other common nitrogen sources.
■
Table 1. Strains Used in This Study name
parent
WT Δdur3 B1 B2
BY4741 BY4741 BY4741 BY4741
B3
BY4741
B4
BY4741
B5
BY4741
D1
Δdur3
D2
Δdur3
D3
Δdur3
D4
Δdur3
D5
Δdur3
D6
Δdur3
D7
Δdur3
D8
Δdur3
D9
Δdur3
D10
Δdur3
genotype MATa Δhis3-1 Δleu2 Δmet15 Δura3 MATa Δhis3-1 Δleu2 Δmet15 Δura3 MATa Δhis3-1 Δleu2 Δmet15 Δura3 MATa Δhis3-1 Δleu2 Δmet15 Δura3 Dur3p MATa Δhis3-1 Δleu2 Δmet15 Δura3 Dur3pK556R MATa Δhis3-1 Δleu2 Δmet15 Δura3 Dur3pK571R MATa Δhis3-1 Δleu2 Δmet15 Δura3 Dur3pK556,571R MATa Δhis3-1 Δleu2 Δmet15 Δura3 pY26-TEF1-GPD1 MATa Δhis3-1 Δleu2 Δmet15 Δura3 pY26-TEF1-GPD1-Dur3p MATa Δhis3-1 Δleu2 Δmet15 Δura3 pY26-TEF1-GPD1-Dur3pK556R MATa Δhis3-1 Δleu2 Δmet15 Δura3 pY26-TEF1-GPD1-Dur3pK571R MATa Δhis3-1 Δleu2 Δmet15 Δura3 pY26-TEF1-GPD1-Dur3pK556,571R MATa Δhis3-1 Δleu2 Δmet15 Δura3 pUbDetec16 MATa Δhis3-1 Δleu2 Δmet15 Δura3 pUbDetec16-Dur3p MATa Δhis3-1 Δleu2 Δmet15 Δura3 pUbDetec16-Dur3pK556R MATa Δhis3-1 Δleu2 Δmet15 Δura3 pUbDetec16-Dur3pK571R MATa Δhis3-1 Δleu2 Δmet15 Δura3 pUbDetec16-Dur3pK556,571R
dur3:: kanMX pRS306-TEF1 pRS306-TEF1pRS306-TEF1pRS306-TEF1pRS306-TEF1dur3:: kanMX dur3:: kanMX dur3:: kanMX dur3:: kanMX dur3::kanMX dur3:: kanMX dur3:: kanMX dur3:: kanMX dur3:: kanMX dur3:: kanMX
g/L peptone, and 20 g/L glucose). A final concentration of 200 mg/L G418 sulfate was added to select for G418-resistant transformants. Prediction of Potential Ubiquitination Sites. The ubiquitination sites of Dur3p were predicted using UbPred software.19 The residues of Dur3p were submitted, and the ubiquitination confidence scores of the lysine residues were calculated. Scores from 0.84 to 1.00, from 0.69 to 0.83, and from 0.62 to 0.68 were defined as high-, medium-, and low-confidence scores, respectively. Site-Directed Mutagenesis and Gene Disruption of DUR3. The DUR3 gene was polymerase chain reaction (PCR)-amplified, cloned into the pMD19-T Simple vector using the primer pair M1/ M2, and confirmed by Sanger sequencing. The K566 and K571 residues were mutated to arginine using primer pairs M5/M6 and M7/ M8, respectively, by using a one-step PCR method.24 The mutations of the DUR3 gene were confirmed by Sanger sequencing. The mutated DUR3 genes were digested and inserted into the NotI/SmaI sites of pUbDetec16, which resulted in pUbDetec16-DUR3 plasmids. The mutated DUR3 genes were also PCR-amplified using the M3/M4 primer pairs, digested by NotI and SacII, and cloned into pY26-TEF1GPD1 and pRS306-TEF1, which resulted in pY26-TEF-GDP1-DUR3 plasmids and pRS306-TEF1-DUR3 plasmids. The disruption of the DUR3 gene was performed using the long flanking homology method.25 The upstream and downstream homologous regions of the DUR3 gene were PCR-amplified using primer pairs DUR3-P1/DUR3-P2,\ and DUR3-P3/DUR3-P4. Then, these PCR products and a loxP marker cassette plasmid, pUG6 (kanr), were used to construct the disruption cassette using a fusion PCR method.26 The disruption cassette was transformed into cells using the lithium acetate method.27 Disruption strains were confirmed by amplification using the flanking primer pairs DUR3-VF/DUR3-VR. All of the primers are listed in Table 2. Fluorescence Spectroscopy Analysis. Yeast cells that were transformed with pUbDetec16 ubiquitination detection plasmids were first cultured in YNB + ammonium sulfate medium at 30 °C until OD600 = 0.6−1.0; cells were then harvested and washed twice with YNB medium without ammonium and amino acids, and the solutions
MATERIALS AND METHODS
Strains and Plasmids. Escherichia coli strain JM109 was purchased from Takara (Dalian, China) and used for plasmid constructions. The TA cloning plasmid pMD19-T Simple (Takara) was used for DUR3 mutagenesis. The S. cerevisiae strains that were used in this study are listed in Table 1. S. cerevisiae BY4741 was used as the initial strain.20 Plasmid pY26-TEF1-GPD1 with 2 μ origin, a URA3 gene as selectable marker, and Ampr were used for Dur3p overexpression.21 A protein ubiquitination detection plasmid, pUbDetec16 derived from pY26TEF1-GPD1, was used to monitor the ubiquitination changes of Dur3p and its mutants. The pUbDetec16 plasmid allowed expression of N-terminal EGFP and C-terminal EGFP fusion proteins.22 Integrative plasmid pRS306-TEF1 with a URA3 gene as selectable marker and Ampr was used for the rice wine system. Culture Conditions. E. coli cells were cultured in Luria−Bertani medium (10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl) at 37 °C, and 100 μg/mL ampicillin was added when necessary. Yeast cells were first grown in yeast nitrogen base (YNB) + ammonium sulfate medium (1.6 g/L YNB without amino acids or ammonium, 20 g/L glucose, and 5 g/L ammonium sulfate), and 25 mg/L leucine, 25 mg/L histidine, and 25 mg/L methionine were added. For ubiquitination site detection, 2 mmol/L urea (YNB + 2 mmol/L urea medium) or 2 mmol/L urea and 2 mmol/L glutamine (YNB + 2 mmol/L urea and 2 mmol/L glutamine medium) were added to replace 5 g/L ammonium sulfate;23 for long-term urea utilization analysis, 1 g/L urea (YNB + 1 g/L urea medium) or 1 g/L urea and 1 g/L glutamine (YNB + 1 g/L urea and 1 g/L glutamine medium) were added to replace 5 g/L ammonium sulfate. For the urea formation analysis, strains were cultured on yeast extract−peptone−dextrose (YPD) medium (10 g/L yeast extract, 20 1642
DOI: 10.1021/acs.jafc.6b05348 J. Agric. Food Chem. 2017, 65, 1641−1648
Article
Journal of Agricultural and Food Chemistry Table 2. Oligonucleotides Used for Mutagenesis and Gene Disruption of DUR3 gene DUR3 DUR3 DUR3556R DUR3571R DUR3
DUR3
name
sequence (5′−3′)
M1 M2 M3 M4 M5 M6 M7 M8 DUR3-P1 DUR3-P2 DUR3-P3 DUR3-P4 DUR3-VF DUR3-VR
GGGGGCGGCCGCATGGGAGAATTTAAACCTCCGa TCCCCCGGGAATTATTTCATCAACTTGTCCGA GGGGGCGGCCGCATGGGAGAATTTAAACCTCCG TCCCCGCGGCTAAATTATTTCATCAACTTGTCCGA GCTAACGATAGGGAACAAGAAGAAGb GTTTCTTCTTCTTGTCCCTTATCGTT GATAGTGAAAGAAACGATGTTAGAGT CTAACATCGTTTCTTTCACTATCTGAG ATTTTGAGATTAGCCAAGACCA GCGTACGAAGCTTCAGCTGGGATGAACCCAATTTAAGAAc CAGATCCACTAGTGGCCTATGCCTATCCACTCATCAACCTCA GTTTCGTTTACTTCTTGGTCTTC TGTGAACAAAATGCACAAGG CGTTGTTTATACTCTTCTTAGGCTT
a Italicized and underlined letters indicate restriction sites. bBold letters indicate mutation sites. cUnderlined letters indicate the overlap of the loxP plasmids and primers.
■
were adjusted to OD600 = 1.0 and transferred to YNB + 2 mmol/L urea or YNB + 2 mmol/L urea and 2 mmol/L glutamine medium for 2 h.28 Two hundred microliters of cells was transferred to a 96-well plate for fluorescence spectroscopy analysis (excitation, 485 nm; emission, 524 nm) using a Cytation 3 imaging reader (BioTek, Winooski, VT, USA).29 The relative fluorescence of the Dur3p mutants was calculated using the formula
RESULTS
Identification of Potential Ubiquitination Sites in Dur3p. The online UbPred software (http://www.ubpred. org/) was used to analyze potential ubiquitination sites of Dur3p.19 After submission of all of the Dur3p residues, all of the potentially ubiquitinated lysine residues were predicted, and their ubiquitination confidence scores were calculated. According to the prediction results, two high-confidence residues, K556 and K571, were identified (Figure 2A). To further verify these possible ubiquitination sites, a set of Dur3p mutants with
RF = (Fs − Fn)/(Fp − Fn)/(FsOD600 /FpOD600)
where RF is the relative fluorescence, Fs is the fluorescence of the samples, Fn is the fluorescence of the negative control, Fp is the fluorescence of the positive control, and OD600 is the optical density at 600 nm. Rice Wine Brewing in a Model System and a Component Analysis. A standard rice wine brewing process was performed according to a previous study.11 Yeast cells were cultured in YNB + ammonium sulfate medium for 24 h at 30 °C, with shaking at 200 rpm. Then, the cells were mixed with steamed rice, wheat Qu (prepared by natural inoculation of molds, bacteria, and yeasts on wheat), and water in a fermentation flask. The fermentation was conducted at 30 °C for 5 days and then at 15 °C for 20 days. The concentrations of urea, EC, and the main components of the samples were measured when fermentation was complete. All experiments were performed in biological replicates with an independent measurement of each sample, and mean values were used for further calculations. Plasma Membrane Localization Analysis. To determine the membrane localization of the ubiquitination sites in Dur3p and Gap1p, its topology was predicted using the TMHMM server (http://www. cbs.dtu.dk/services/TMHMM/).30 The predicted result was visualized using the TMRPres2D tool.31 Analytical Methods. Urea, amino acids, and the main components of the samples were determined by high-performance liquid chromatography using an Agilent 1260 HPLC system (Agilent Technologies, Santa Clara, CA, USA) according to a previous method.11,32 The analysis of EC was performed on a GC-2010 gas chromatograph (Shimadzu, Kyoto, Japan) equipped with a GCMSQP2010 plus mass spectrometer. A polar-phase chromatography capillary column (Rtx-Wax; Restek, Bellefonte, PA, USA) was used as described previously.11 Statistical Analysis. At least three independent experiments were performed for each experiment, and the results are expressed as average values with standard errors. Data were analyzed using Student’s t tests. P values of
