Mutation of Phenylalanine-223 to Leucine ... - ACS Publications

Subscriber access provided by Monash University Library

Article

Mutation of phenylalanine-223 to leucine enhances transformation of benzo[a]pyrene by ring-hydroxylating dioxygenase of Sphingobium sp. FB3 by increasing accessibility of the catalytic site Bo Fu, Ting Xu, Zhongli Cui, Ho Leung Ng, Kai Wang, Ji Li, and Qing X. Li J. Agric. Food Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jafc.7b05018 • Publication Date (Web): 16 Jan 2018 Downloaded from http://pubs.acs.org on January 16, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Agricultural and Food Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29

Journal of Agricultural and Food Chemistry

Manuscript revised according to editor’s and reviewers’ comments for possible publication in Journal of Agricultural and Food Chemistry

Mutation of phenylalanine-223 to leucine enhances transformation of benzo[a]pyrene by ring-hydroxylating dioxygenase of Sphingobium sp. FB3 by increasing accessibility of the catalytic site

Bo Fu,a,b Ting Xu,a Zhongli Cui,c Ho Leung Ng,d Kai Wang,a Ji Li,a,* Qing X. Lib,**

a

College of Resources and Environmental Sciences, China Agricultural University, 2

Yuanmingyuan West Road, Beijing 100193, China b

Department of Molecular Biosciences and, University of Hawaii at Manoa, Honolulu,

Hawaii 96822, United States c

Department of Microbiology, College of Life Sciences, Key Laboratory for Microbiological

Engineering of Agricultural Environment of Ministry of Agriculture, Nanjing Agricultural University, Nanjing, Jiangsu 201195, China d

Department of Biochemistry & Molecular Biophysics, Kansas State University, Manhattan,

Kansas 66506, United States

Correspondence: *Ji Li Tel: +86 (10) 6273-2017 Fax: +86 (10) 6281-4029 Email: [email protected] **Qing X. Li Tel: (808) 956-2011 Fax: (808) 956-3542 Email: [email protected]

1

ACS Paragon Plus Environment


1

ABSTRACT

2

Burning of agricultural biomass generates polycyclic aromatic hydrocarbons (PAHs) including

3

the carcinogen benzo[a]pyrene, of which the catabolism is primarily initiated by a ring-

4

hydroxylating dioxygenase (RHD). This study explores catalytic site accessibility and its role in

5

preferential catabolism of some PAHs over others. The genes flnA1f, flnA2f, flnA3 and flnA4,

6

encoding the oxygenase α and β subunits, ferredoxin, and ferredoxin reductase, respectively, of

7

the RHD enzyme complex (FlnA) were cloned from Sphingobium sp. FB3 and co-expressed in E.

8

coli BL21. The FlnA effectively transformed fluoranthene, but not benzo[a]pyrene. Substitution

9

of the bulky phenylalanine 223 by leucine reduces the steric constraint in the substrate entrance to

10

make the catalytic site of FlnA more accessible to large substrates, as visualized by 3D modeling,

11

and allows the FlnA mutant to efficiently transform benzo[a]pyrene. Accessibility of the catalytic

12

site to PAHs is a mechanism of RHD substrate specificity. The results shed light on why some

13

PAHs are more recalcitrant than others.

14 15

KEYWORDS: Biodegradation; Biotransformation; Polycyclic aromatic hydrocarbon; Ring-

16

hydroxylating dioxygenase; Sphingobium sp. FB3; Substrate specificity

17

2 ACS Paragon Plus Environment

Page 2 of 29

Page 3 of 29

18


INTRODUCTION

19

Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous, persistent and toxic organic

20

pollutants in the environment. Some PAHs such as benzo[a]pyrene are carcinogenic, mutagenic

21

and immunosuppressive. PAHs are primarily from incomplete combustion. Field-based

22

agricultural biomass burning and wildfires can generate a large amount of PAHs.1-4 PAH-polluted

23

soil is a major source of food PAH contamination, posing a serious food safety issue.5-7

24

Bioremediation is an effective method to remove PAHs from polluted sites. Many bacterial

25

species can degrade low molecular weight (LMW) PAHs.8-10 However, only a small fraction of

26

the bacteria isolated thus far can degrade high molecular weight (HMW) PAHs such as

27

benzo[a]pyrene.1

28

Aerobic biodegradation of PAHs is initiated by introducing two atoms of oxygen to the

29

aromatic ring of the substrate.11-14 This reaction, referred to as dioxygenation, is catalyzed by a

30

ring-hydroxylating dioxygenase (RHD).15 RHD is a multicomponent bacterial enzyme complex

31

consisting of an oxygenase, comprised of an α and β subunit, and an electron transport chain,

32

comprised of a ferredoxin and ferredoxin reductase.16 The oxygenase, responsible for

33

dioxygenation, catalyzes formation of a cis-dihydrodiol moiety, which is a critical first step to

34

bacterial catabolism of various aromatic compounds.17 The electron transport proteins, ferredoxin

35

and ferredoxin reductase transfer electrons from an electron donor to the oxygenase component.18

36

To date, RHDs related to LMW PAH transformation have been found and validated.19, 20 Very few

37

reports, however, demonstrated the function of RHD to dioxygenate HWM PAHs such as

38

fluoranthene and benzo[a]pyrene.13

39 40

The α subunit of the oxygenase, which contains a Rieske binding domain and a catalytic domain, is related to substrate specificity.17 Amino acid residues in the distal region of the 3 ACS Paragon Plus Environment


41

catalytic site affect the size and shape of substrates that can enter the active site.15 The ring-

42

hydroxylating dioxygenase BPDO-ORHA1 from Sphingobium sp. B1 can oxidize benzo[a]pyrene,

43

whereas the ring-hydroxylating dioxygenase NDO-O9816-4 from Pseudomonas sp. NCIB 9816-4

44

cannot despite that NDO-O9816-4 shares a very similar volume and configuration of the catalytic

45

site as BPDO-ORHA1. Based on structural comparison between BPDO-OB1 and NDO-O9816-4,

46

Ferraro et al.21 stated “we propose that the shape and size of the active site entrance may keep

47

larger substrates out of the NDO-O9816 active site”.

48

The present study tested the hypothesis that accessibility of the RHD catalytic site is a

49

determining factor for RHD selectivity toward HMW PAHs. A library of mutants of strain

50

Sphingobium sp. FB3 was obtained by random Mariner mutagenesis to look for genes related to

51

fluoranthene degradation. The genes encoding the RHD complex in Sphingobium sp. FB3, FlnA,

52

were cloned and expressed in E. coli BL21. The heterologously expressed FlnA complex was

53

active toward fluoranthene, negligible toward benzo[a]pyrene. Computational modeling predicted

54

that spatial change of the active site by replacing the large Phe 223 with a small Leu would make

55

the site more accessible to benzo[a]pyrene. These predictions were confirmed in vitro wherein the

56

mutated complex was active toward benzo[a]pyrene. The results signify that accessibility of the

57

catalytic site is a mechanism of RHD substrate specificity.

58 59

MATERIALS AND METHODS

60

Reagents. Fluoranthene and benzo[a]pyrene were purchased from Sigma-Aldrich Co.

61

(purity>98%) (St. Louis, MO). PAH stock solutions were made in acetone (Beijing Chemical

62

Works, Beijing, China) and stored in brown bottles at 4 °C. Fluoranthene was at a concentration

63

of 1000 mg/L and benzo[a]pyrene was at 100 mg/L. Antibiotics, isopropyl-β-D4 ACS Paragon Plus Environment

Page 4 of 29

Page 5 of 29


64

thiogalactopyranoside and restriction enzymes were purchased from Takara Biotechnology Co.

65

(Dalian, Liaoning, China). Primers were obtained from Sangon Biotechnology Co. (Shanghai,

66

China).

67 68

Strains, plasmids, and growth conditions. The bacterial strains and plasmids used in this study

69

were listed in Table 1. Sphingobium sp. FB3 was previously isolated from soil.22 It was grown in

70

Lysogeny broth (LB) medium with 50 µg/mL of streptomycin or in mineral salt medium (MSM)

71

with PAHs at 30 °C. E. coli strains were grown at 37 °C in LB medium supplemented with

72

appropriate antibiotics. Solid media contained 1.5% agar. The concentrations of the antibiotics

73

were 50, 50, 50, 50, and 34 µg/mL of ampicillin (Amp), kanamycin (Km), gentamicin (Gm),

74

streptomycin (Str), chloramphenicol (Cm), respectively. The MSM contained (per liter) 1.5 g

75

K2HPO4, 0.5 g KH2PO4, 1.0 g (NH4)2SO4, 0.03 g MgSO4, and 1.0 g NaCl, pH 7.0.

76 77

Generation of transposon mutants. A mutant library of Sphingobium sp. FB3 was generated to

78

screen for genes involved in PAH degradation. Fluoranthene degradation results in formation of

79

an orange-yellow metabolite which was used as a selection marker to screen for fluoranthene

80

degradation-deficient mutants. The mutant library of strain FB3 was generated by triparental

81

conjugation. Sphingobium sp. FB3, E. coli SM10λpir harboring the plasmid pSC123 which

82

contained the Mariner transposon,23 and E. coli DH5α harboring the plasmid pRK600 were

83

incubated individually in 3 mL of LB medium supplemented with streptomycin, kanamycin,

84

chloramphenicol, respectively. Two mL of strain FB3 and 1 mL each of the other two cultures

85

were washed thrice with fresh LB medium to remove residual antibiotics, re-suspended in 120 µL

86

of LB medium, and combined. The mixture was spotted onto a nitrocellulose filter on an LB plate 5 ACS Paragon Plus Environment


87

and incubated at 30 °C for 48 h for conjugation to proceed. The conjugants were re-suspended in

88

1 mL of LB medium and spread onto LB plates (10 µL per plate) supplemented with

89

streptomycin and kanamycin.24 After incubation at 30 °C for 5 days, all colonies were transferred

90

into separate wells on a 96-well plate containing filter-sterilized MSM supplemented with

91

fluoranthene.25 Colonies that did not transform fluoranthene were selected for further study.

92 93

Cloning of the sequences flanking the Mariner transposon. The sequences flanking the

94

Mariner transposon in the FB3 mutants (5-41 and 12-45) were obtained by thermal asymmetric

95

interlaced PCR (TAIL-PCR).26 The primers ARB1, ARB2, ARB3, F-SP1, F-SP2 were used for

96

amplifying the 5ʹ flanking sequence of the transposon (Table 2). The first round of amplification

97

was performed in a 25 µL reaction volume with 2.5 µL of 10 × PCR buffer, 2.5 µL of 25 mmol/L

98

Mg2+, 2 µL of 2.5 mmol/L dNTP mixture, 0.3 µL of 25 µmol/L ARB1, 0.3 µL of 25 µmol/L

99

ARB3, 0.8 µL of 25 µmol/L F-SP1, 0.3 µL of 5 U/µL Taq (Takara, Beijing, China). The colony of

100

strain FB3 was used as template. The amplifications were performed at 94 °C for 5 min, then 6

101

cycles at 94 °C for 30 s, 30 °C for 3 min, 72 °C for 1 min, then another 30 cycles at 94 °C for 30

102

s, 55 °C for 30 s, 72 °C for 1 min and finally an extension period of 10 min at 72 °C. The second

103

round of amplification was performed in 25 µL reaction volume with 2.5 µL of 10 × PCR buffer,

104

2.5 µL of 25 mmol/L Mg2+, 2 µL of 2.5 mmol/L dNTP mixture, 0.5 µL of 25 µmol/L ARB2, 0.5

105

µL of 25 µmol/L F-SP2, 0.3 µL of 5 U/µL Taq, and 0.3 µL of the product from the first round of

106

TAIL-PCR. The amplifications were performed at 94 °C for 5 min, then 30 cycles at 94 °C for 30

107

s, 55 °C for 30 s, 72 °C for 1 min, and finally an extension period of 10 min at 72 °C.

108 109

The PCR products were purified by agarose gel electrophoresis, cloned into the pMD19-T vector (simple) (Takara), then transferred into E. coli DH5α for sequencing to identify the genes 6 ACS Paragon Plus Environment

Page 6 of 29

Page 7 of 29


110

that had been disrupted in the mutants. Comparisons of amino acid or nucleotide sequences were

111

performed with BLAST on the NCBI website.

112 113

Construction of FlnA expression vectors. Four genes, flnA1f, flnA2f, flnA3 and flnA4, were

114

independently amplified by PCR from the genomic DNA of strain FB3 using four primer sets

115

(Table 2). The PCR products were purified and separately inserted into the pMD19-T vector

116

(simple), sequenced, and then subcloned into the final expression vectors. FlnA1f and flnA2f,

117

encoding the α and β subunits of the oxygenase, respectively, were cloned into a single vector

118

(pET-A1fA2f), while flnA3 and flnA4, which encode ferredoxin and ferredoxin reductase,

119

respectively, were cloned into another vector (pACYC-A3A4). For construction of pET-A1fA2f,

120

flnA2f was cloned into the pETDuet-1 vector using restriction sites NcoI and PstI, and flnA1f was

121

subsequently cloned into the resulting plasmid using restriction sites NdeI and KpnI. The other

122

plasmid, pACYC-A3A4, was similarly constructed by placing flnA4 into the pACYCDuet-1

123

vector using restriction sites NcoI and HindIII, and flnA3 was subsequently inserted into the

124

resulting plasmid using restriction sites NdeI and KpnI. The resulting plasmids, pET-A1fA2f and

125

pACYC-A3A4, were co-transformed into E. coli BL21 (DE3) to form E. coli BL21 FlnA. To

126

investigate the function of flnA3 and flnA4, another strain, E. coli BL21 FlnA12, containing pET-

127

A1fA2f and pACYCDuet-1 was created. The control was E. coli BL21 CK containing pETDuet-1

128

and pACYCDuet-1. The sequence data of flnA1f, flnA2f, flnA3 and flnA4 were submitted to the

129

GenBank database under accession numbers MF401193, MF401194, MF401195, and MF401196,

130

respectively.

131 132

Residue 223 in the oxygenase α subunit was mutated from Phe to Leu with the overlap extension PCR method using primers A1f223-1-f, A1f223-1-R, A1f223-2-F and A1f223-2-R 7 ACS Paragon Plus Environment


133

(Table 2). To construct plasmid pET-A1f223A2f that contains the flnA2f gene (oxygenase β

134

subunit) and the mutated flnA1f gene, the amplified PCR product was purified and inserted into

135

the pMD19-T vector (simple), sequenced, and then subcloned, using the restriction sites NdeI and

136

KpnI, into the pETDuet-1 plasmid already containing the flnA2f gene. Both pET-A1f223A2f and

137

pACYC-A3A4 were then co-transformed into E. coli BL21 (DE3) to form E. coli BL21 FlnA223.

138 139

Dioxygenase expression and sodium dodecyl sulfate-polyacrylamide gel electrophoresis

140

(SDS PAGE). Clones of E. coli BL21 FlnA, E. coli BL21 FlnA12, E. coli BL21 CK, or E. coli

141

BL21 FlnA223 were incubated overnight in LB medium at 37 °C. One percent of the culture was

142

inoculated into 400 mL LB medium and grown to an OD600 of 0.5 to 0.6. The cultures were

143

induced by adding IPTG at a final concentration of 0.5 mM and further incubated for 12 h at 25

144

°C. The cells of E. coli BL21 FlnA and E. coli BL21 FlnA12 were harvested, washed, and

145

suspended in 10 mL of PBS (pH 7.45), then disrupted by ultrasonication on ice for 10 min (3 s

146

interval). The lysates were centrifuged at 15,000g for 10 min. The supernatants were harvested

147

and analyzed by SDS-PAGE which was performed on 15% polyacrylamide gels. Protein staining

148

was performed with Coomassie brilliant blue R-250.

149 150

PAH transformation by E. coli BL21 FlnA, E. coli BL21 FlnA12, and E. coli BL21 FlnA223.

151

After the genes were induced for expression, the cultures of E. coli BL21 FlnA, E. coli BL21

152

FlnA12, and E. coli BL21 CK were harvested by centrifugation, washed and resuspended to an

153

OD600 of approximately 1.6 in 10 mL MSM containing 100 mg/L fluoranthene. Catalytic

154

efficiency of E. coli BL21 FlnA and E. coli BL21 FlnA223 toward benzo[a]pyrene (final

155

concentration of 10 mg/L) was investigated in 10 mL MSM with an OD600 of approximately 1.6. 8 ACS Paragon Plus Environment

Page 8 of 29

Page 9 of 29


156

The cultures were incubated at 160 rpm for 12 h at 30 °C. All experiments were performed in

157

triplicate.

158 159

Extraction and analysis of residual fluoranthene. Residual fluoranthene in the culture was

160

extracted with ethyl acetate and analyzed with an Agilent LC1200 high performance liquid

161

chromatograph (HPLC) integrated with a diode array detector.22 A venusil MP-C18 column (5

162

µm, i.d. 4 mm) was used for separation. The flow rate was 1 mL/min. The gradient was from 60%

163

aqueous methanol (HPLC grade) to 100% methanol in the first 30 min, followed by 100%

164

methanol for 5 min. PAHs were detected at 250 nm.

165 166

Identification of the fluoranthene metabolite. The metabolite generated in the process of

167

fluoranthene degradation by E. coli BL21 FlnA was detected by an Agilent HP 6890N gas

168

chromatograph coupled to an Agilent HP 5973 mass selective detector. The samples were run on

169

an HP-5MS column (0.25 mm × 30 m × 0.25 µm) with helium as the carrier gas. The initial oven

170

temperature was 50 °C, rising 15 °C per minute to a final temperature of 280 °C and kept for 15

171

min.

172 173

FlnA1f 3D structure modeling. The 3D structure of FlnA1f was modeled with the Phyre2

174

protein fold recognition server.27 The crystal structure of the corresponding α subunit of

175

Sphingobium yanoikuyae B1 (2GBX.pdb), sharing 90% amino acid sequence identity to FlnA1f,

176

was used as a template.21 Based on the model, the active site of FlnA1f was predicted using the

177

PyMOL molecular graphics system by aligning to its template (version 1.6 Schrödinger, LLC).

178

The structure of benzo[a]pyrene was drawn and energy minimized with the program Avogadro.28 9 ACS Paragon Plus Environment


179

Benzo[a]pyrene was docked into the catalytic site of FlnA1f and FlnA1f223 using AutoDock

180

Tools29 and AutoDock Vina 1.1.2.30

181 182

RESULTS AND DISCCUSSION

183

Cloning and analysis of the mutant genes from 5-41 and 12-45. A library of mutants of strain

184

FB3 was obtained by random Mariner mutagenesis. Two mutants that could not transform

185

fluoranthene into orange-yellow color metabolites were screened from a total of 2950 mutants.

186

The two mutants that could not degrade fluoranthene (data not shown) were designated as 5-41

187

and 12-45. The 5ʹ flanking sequences of the Mariner transposon in 5-41 and 12-45 were amplified

188

by TAIL-PCR, and a 129-bp and a 104-bp fragment were obtained, respectively. The disrupted

189

genes in mutants 5-41 and 12-45 displayed high similarity to genes encoding the oxygenase α

190

subunit and ferredoxin of RHDs reported in other PAH-degrading sphingomonads strains. These

191

results indicated involvement of the two genes in the first step of degradation of fluoranthene by

192

strain FB3, and were designated as flnA1f and flnA3, respectively.

193

Based on genomic DNA information of strain FB3 and the sequence similarities among

194

conserved catabolic gene clusters in sphingomonads strains, the gene located immediately

195

downstream of flnA1f was predicted to encode the RHD oxygenase β subunit, designated flnA2f

196

(data not shown). Ferredoxin always serves as an electron transport chain along with ferredoxin

197

reductase.16 Ferredoxin reductase is encoded by a gene 18.3-kb downstream of flnA3 in strain

198

FB3, and was designated flnA4. The putative RHD, encoded by flnA1f, flnA2f, flnA3 and flnA4 in

199

strain FB3, was designated as FlnA due to its association with fluoranthene degradation.

200 201

Cloning and expression of genes encoding the FB3 RHD. In order to verify the function of 10 ACS Paragon Plus Environment

Page 10 of 29

Page 11 of 29


202

flnA1f, flnA2f, flnA3 and flnA4, these four genes were first amplified with corresponding primers.

203

They were 1365 bp, 525 bp, 327 bp and 1227 bp in length, respectively. The resulting expression

204

plasmids pET-A1fA2f and pACYC-A3A4 were then co-transformed into E. coli BL21 (DE3) to

205

produce E. coli BL21 FlnA. To confirm the function of flnA3 and flnA4, E. coli BL21 FlnA12

206

was produced to only contain genes flnA1f and flnA2f. E. coli BL21 CK harboring only the

207

plasmids without inserted genes was used as a control. As shown in Fig. 1, two polypeptides with

208

a size of 50 kDa and 23 kDa induced by IPTG in both E. coli BL21 FlnA and E. coli BL21

209

FlnA12 were approximate to the expected values of the α and β subunit, respectively. However,

210

no representative bands were seen for the ferredoxin or ferredoxin reductase components, which

211

may be attributed to the lower copy number of pACYCDuet-1 which is only a quarter of

212

pETDuet-1.19

213 214

Biotransformation of fluoranthene by E. coli BL21 FlnA. RHD has been widely investigated

215

because of its importance in PAH degradation.15, 31-33 The biotransformation of fluoranthene by E.

216

coli BL21 FlnA and E. coli BL21 FlnA12 was investigated. As shown in Fig. 2, 43% of

217

fluoranthene was transformed by E. coli BL21 FlnA within 12 h. The half-life (T1/2) and

218

degradation rate constant of fluoranthene by E. coli BL21 FlnA was 0.63 d and 1.1 d-1,

219

respectively. The degradation rate constant of fluoranthene by E. coli BL21 FlnA were 3.4-fold

220

higher than that by strain FB3.22 The concentrations of residual fluoranthene in the E. coli BL21

221

FlnA culture correspondingly decreased over time and one putative metabolite accumulated (Fig.

222

3). GC-MS analysis confirmed that the metabolite was monohydroxyfluoranthene (molecular ion

223

at m/z 218, retention time 15.408 min) (Fig. 4) which was probably produced by spontaneous

224

dehydration of dihydrodiolfluoranthene.13, 31, 34 The results indicated that FlnA catalyzes the 11 ACS Paragon Plus Environment


225

initial step of fluoranthene transformation. To date, several RHDs capable of fluoranthene

226

degradation were identified in Sphingomonas, but not in Sphingobium.35-37 To our knowledge, the

227

present study was the first report to functionally characterize RHD transformation of fluoranthene

228

in a strain of the genus Sphingobium.

229

Sphingomonads species possess a unique group of genes for aromatic compound

230

degradation, which the genes distantly differ from those in Pseudomonas and other genera, both

231

in sequence homology and gene organization.38 Although the degradation genes in

232

sphingomonads are conserved, subtle structural variations in the α subunits may cause different

233

substrate selectivity toward PAHs. The gene phnA1a, encoding the α subunit of RHD in

234

Sphingomonas paucimobilis EPA505, shares 99% identity with flnA1f in strain FB3. However,

235

when the four genes (phnA1a, phnA2a, phnA3 and phnA4) encoding the RHD PhnI in strain

236

EPA505 were expressed in E. coli BL21 (DE3), no fluoranthene transformation was observed.19

237

Strain FB3 can utilize and grow with fluoranthene as the sole carbon source, whereas

238

Sphingobium yanoikuyae B1 can only co-oxidize fluoranthene, but cannot support growth despite

239

that the α subunits of dioxygenases from the two strains sharing 90% identity.39

240

As shown in Fig. 2, no degradation of fluoranthene was observed in E. coli BL21 FlnA12

241

culture and E. coli BL21 CK. This confirmed that the genes flnA3 (encoding ferredoxin) and

242

flnA4 (encoding ferredoxin reductase) are necessary for FlnA in strain FB3 to transform

243

fluoranthene into intermediate metabolites. Ferredoxin and ferredoxin reductase are components

244

of electron transport chain (ETC) in RHDs. The ETC is required for the RHD to transfer electrons

245

from the electron donor to an aromatic hydrocarbon electron acceptor.16 In most cases, expression

246

of genes encoding ETC components along with oxygenase is required to catalyze PAHs

247

transformation. When BL21 (DE3) (pD12) cells expressing only phnA1a and phnA2a were grown 12 ACS Paragon Plus Environment

Page 12 of 29

Page 13 of 29


248

in the presence of PAHs, no dihydrodiol product was detected by GC-MS.19 Clones containing

249

the genes encoding the oxygenase alone from Sphingobium yanoikuyae B1 did not catalyze

250

transformation of biphenyl or naphthalene.39 In contrast, the nidAB dioxygenase genes of

251

Mycobacterium vanbaalenii PYR-1 were functional in an E. coli system despite the absence of

252

the ferredoxin and reductase components.40 It was speculated that the oxygenase component of

253

RHD borrowed the ferredoxin and reductase components of another electron transport system in

254

the recombinant E. coli cells.41 E. coli cells expressing only the RHD oxygenase components,

255

phnA1a and phnA2a, from strain CHY-1 could transform phenanthrene into dihydrodiol products.

256

However, the catalytic activity was enhanced by 35 times when phnA3 and phnA4 encoding

257

ferredoxin and reductase were expressed along with phnA1a and phnA2a.42 Therefore, co-

258

expression of [3Fe-4S] type ferredoxin and reductase genes are required for a fully functional

259

RHD.

260 261

Benzo[a]pyrene docking to the catalytic site of FlnA1f. RHD is one of the most important

262

enzymes in PAH degradation. The oxygenase α subunit is related to substrate selectivity. Only

263

negligible degradation of benzo[a]pyrene (6 ± 2% in 10 days) was achieved by strain FB3.22 We

264

hypothesized that degradation was constrained due to the small size of the catalytic site relative to

265

the large five-ring system, benzo[a]pyrene. The 3D structure of FlnA1f was constructed using

266

homology modeling on the basis of the crystal structure of the corresponding α subunit from

267

Sphingobium yanoikuyae B1.21 Benzo[a]pyrene was docked into the catalytic site of FlnA1f. The

268

results showed that the FlnA1f catalytic site is large enough to well accommodate benzo[a]pyrene

269

molecule. This suggested that there must be other reasons rather than steric constraint resulting in

270

negligible degradation of benzo[a]pyrene by strain FB3. 13 ACS Paragon Plus Environment


271 272

Effect of mutation on benzo[a]pyrene transformation. The loops which cover the entrance of

273

the catalytic site of RHD of strain CHY-1 possibly control the substrate’s access to the catalytic

274

site.15 Leu223 on loop 1 and Ile260 on loop 2 contributed to the selectivity of the catalytic site

275

toward HMW PAHs.15 In FlnA1f, position 223 is Phe, which is much larger than Leu (Fig. 5A

276

and B). It seems that Phe223 occupies approximately half of the entrance (Fig. 5A). This would

277

impede benzo[a]pyrene from entering into the catalytic site. Therefore, substitution of Phe223 by

278

Leu223 in FlnA1f formed FlnA223. E. coli BL21 FlnA223 was used to investigate the catalytic

279

activity toward benzo[a]pyrene. The transformation rate of benzo[a]pyrene by E. coli BL21

280

FlnA223 was greater than 5 times faster than that by E. coli BL21 FlnA within 12 h (Fig. 5C).

281

The results demonstrated that Phe223 is a critical residue preventing benzo[a]pyrene from

282

entering the catalytic site for transformation. The transformation rate could be enhanced by

283

substitution of Phe223 with a smaller amino acid residue, such as leucine.

284

Many bacteria are capable of degrading LMW PAH, such as naphthalene, phenanthrene, and

285

anthracene. However, only a few isolates were reported to degrade HMW PAHs, such as

286

benzo[a]pyrene. The effects of residue substitution on the catalytic activity to PAHs in the active

287

site have been investigated by others.17, 43, 44 However, the effect of substitutions outside of the

288

active site was less investigated.45 Our study sheds light on understanding structural determinants

289

of RHD substrate specificity toward PAHs. Furthermore, the engineered FlnA223 potentially

290

provide applications on HMW PAHs degradation.

291

Pellequer et al. 46 first reported that the π-cation interaction between a cationic amino acid

292

residue and a neutral aromatic substrate can stabilize the substrate binding. The phenyl ring of

293

polychlorinated biphenyls (PCBs) contacts the guanidinium group of ArgL46, also creating a π14 ACS Paragon Plus Environment

Page 14 of 29

Page 15 of 29


294

cation interaction by which this cationic group would stabilize the bound aromatic substrate.47

295

Similarly, π-π stacking can occur between an aromatic substrate and an aromatic amino acid

296

residue. In FlnA1f, π-π stacking between aromatic ring of Phe223 and benzo[a]pyrene may

297

inhibit the innerward movement of benzo[a]pyrene, thus impede it entering the active site. It is

298

possible that substitution of Phe223 by Leu223 prevents π-π stacking, which would allow

299

benzo[a]pyrene pass the entrance to the active site for catalysis by FlnA. Pellequer et al.47

300

indicated that high selectivity of the monoclonal antibody variable fragment S2B1 to coplanar

301

PCBs was due to the steric constraint of ortho chlorines with TrpH33 and TrpH98 in the binding

302

site.

303

The present study was the first report of an RHD (FlnA) in the genus Sphingobium catalyzing

304

transformation of fluoranthene. The mutant E. coli BL21 FlnA223 that increased transformation

305

efficiency of benzo[a]pyrene has approved that accessibility of HMW PAHs into the catalysis site

306

of RHDs is a determining factor of the RHD catalysis selectivity. It was confirmed that the less

307

bulky amino acid residue Leu223 improved the accessibility of benzo[a]pyrene to the catalytic

308

site and further improved the catalytic efficiency. The finding of this study is valuable to

309

strategize bioremediation approaches for the sites contaminated with HMW PAHs and aromatic

310

pesticides where dioxygenation is involved. It also helps to explain profiles of PAHs and aromatic

311

compounds in weathered contaminated sites.

312 313

ABBREVIATIONS

314

Amp, ampicillin; BaP, benzo[a]pyrene; Cm, chloramphenicol; ETC, electron transport chain; Gm,

315

gentamicin; HMW, high molecular weight; Km, kanamycin; LB, Lysogeny broth; LMW, low

316

molecular weight; MSM, mineral salt medium; PAHs, polycyclic aromatic hydrocarbons; PCB, 15 ACS Paragon Plus Environment


317

polychlorinated biphenyl; RHD, ring-hydroxylating dioxygenase; Str, streptomycin

318 319

ACKNOWLEDGMENT

320

We are grateful to Dr. Yanjun Xu of China Agricultural University for the analysis of metabolites

321

and Dr. Margaret R. Baker of the University of Hawaii at Manoa for helpful discussion.

322

FUNDING

323

This work was in part supported by the National Science and Technology Supporting Research

324

Program from MOST, China (2012BAD14B01); the US National Institutes of Health Research

325

Centers in Minority Institutions Program (8 G12 MD007601), and the US National Science

326

Foundation Career Award (1350555). BF was a China Agricultural University scholarship

327

recipient.

328 329

NOTES

330

The authors declare no conflict of interest.


Page 16 of 29

Page 17 of 29


331

REFERENCES

332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374

1. Seo, J. S.; Keum, Y. S.; Li, Q. X. Bacterial degradation of aromatic compounds. Int. J. Environ. Res. Public. Health. 2009, 6, 278-309. 2. Zhang, T.; Wooster, M. J.; Green, D. C.; Main, B. New field-based agricultural biomass burning trace gas, PM 2.5, and black carbon emission ratios and factors measured in situ at crop residue fires in Eastern China. Atmos. Environ. 2015, 121, 22-34. 3. Zhang, H.; Hu, D.; Chen, J.; Ye, X.; Wang, S. X.; Hao, J. M.; Wang, L.; Zhang, R.; An, Z.,. Particle size distribution and polycyclic aromatic hydrocarbons emissions from agricultural crop residue burning. Environ. Sci. Technol. 2011, 45, 5477-5482. 4. Hays, M. D.; Fine, P. M.; Geron, C. D.; Kleeman, M. J.; Gullett, B. K. Open burning of agricultural biomass: Physical and chemical properties of particle-phase emissions. Atmos. Environ. 2005, 39, 6747-6764. 5. Deng, K.; Chan, W. Development of a QuEChERS-based method for determination of carcinogenic 2-nitrofluorene and 1-nitropyrene in rice grains and vegetables: A comparative study with benzo[a]pyrene. J. Agric. Food Chem. 2017, 65, 1992-1999. 6. Lutz, S.; Feidt, C.; Monteau, F.; Rychen, G.; Le Bizec, B.; Jurjanz, S. Effect of exposure to soil-bound polycyclic aromatic hydrocarbons on milk contaminations of parent compounds and their monohydroxylated metabolites. J. Agric. Food Chem. 2006, 54, 263-268. 7. Costera, A.; Feidt, C.; Dziurla, M. A.; Monteau, F.; Le Bizec, B.; Rychen, G. Bioavailability of polycyclic aromatic hydrocarbons (PAHs) from soil and hay matrices in lactating goats. J. Agric. Food Chem. 2009, 57, 5352-5357. 8. Story, S. P.; Kline, E. L.; Hughes, T. A.; Riley, M. B.; Hayasaka, S. S. Degradation of aromatic hydrocarbons by Sphingomonas paucimobilis strain EPA505. Arch. Environ. Con. Tox. 2004, 47, 168-176. 9. Seo, J. S.; Keum, Y. S.; Harada, R. M.; Li, Q. X. Isolation and characterization of bacteria capable of degrading polycyclic aromatic hydrocarbons (PAHs) and organophosphorus pesticides from PAH-contaminated soil in Hilo, Hawaii. J. Agric. Food Chem. 2007, 55, 5383-5389. 10. Seo, J. S.; Keum, Y. S.; Li, Q. X. Mycobacterium aromativorans JS19b1(T) degrades phenanthrene through C-1,2, C-3,4 and C-9,10 dioxygenation pathways. Int. Biodeter. Biodeg. 2012, 70, 96-103. 11. Butler, C. S.; Mason, J. R. Structure-function analysis of the bacterial aromatic ringhydroxylating dioxygenases. Adv. Microb. Physiol. 1996, 38, 47-84. 12. Wackett, L. P. Mechanism and applications of Rieske non-heme iron dioxygenases. Enzyme Microb. Tech. 2002, 31, 577-587. 13. Schuler, L.; Jouanneau, Y.; Chadhain, S. M.; Meyer, C.; Pouli, M.; Zylstra, G. J.; Hols, P.; Agathos, S. N. Characterization of a ring-hydroxylating dioxygenase from phenanthrenedegrading Sphingomonas sp. strain LH128 able to oxidize benz[a]anthracene. Appl. Microbiol. Biot. 2009, 83, 465-475. 14. Seo, J. S.; Keum, Y. S.; Li, Q. X. Comparative protein and metabolite profiling revealed a metabolic network in response to multiple environmental contaminants in Mycobacterium aromativorans JS19b1(T). J. Agric. Food Chem. 2011, 59, 2876-2882. 15. Jakoncic, J.; Jouanneau, Y.; Meyer, C.; Stojanoff, V. The catalytic pocket of the ringhydroxylating dioxygenase from Sphingomonas CHY-1. Biochem. Bioph. Res. Co. 2007, 352, 17 ACS Paragon Plus Environment


375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419

861-866. 16. Kweon, O.; Kim, S. J.; Baek, S.; Chae, J. C.; Adjei, M. D.; Baek, D. H.; Kim, Y. C.; Cerniglia, C. E. A new classification system for bacterial Rieske non-heme iron aromatic ringhydroxylating oxygenases. BMC Biochem. 2008, 9, 11. 17. Ferraro, D. J.; Okerlund, A. L.; Mowers, J. C.; Ramaswamy, S. Structural basis for regioselectivity and stereoselectivity of product formation by naphthalene 1,2-dioxygenase. J. Bacteriol. 2006, 188, 6986-6994. 18. Chakraborty, J.; Ghosal, D.; Dutta, A.; Dutta, T. K. An insight into the origin and functional evolution of bacterial aromatic ring-hydroxylating oxygenases. J. Biomol. Struct. Dyn. 2012, 30, 419-436. 19. Miller, R. P. Sequencing and functional anaylsis of a multi-component dioxygenase from PAH-degrading Sphingomonas paucimobilis EPA505. Dissertation of Clemson University, 2010. 20. Kasai, Y.; Shindo, K.; Harayama, S.; Misawa, N. Molecular characterization and substrate preference of a polycyclic aromatic hydrocarbon dioxygenase from Cycloclasticus sp. Strain A5. Appl. Environ. Microb. 2003, 69, 6688-6697. 21. Ferraro, D. J.; Brown, E. N.; Yu, C. L.; Parales, R. E.; Gibson, D. T.; Ramaswamy, S. Structural investigations of the ferredoxin and terminal oxygenase components of the biphenyl 2,3-dioxygenase from Sphingobium yanoikuyae B1. BMC Struct. Biol. 2007, 7, 10. 22. Chiang, S. L.; Mekalanos, J. J. Construction of a Vibrio cholerae vaccine candidate using transposon delivery and FLP recombinase-mediated excision. Infect. Immun. 2000, 68, 63916397. 23. Qiu, J.; Ma, Y.; Chen, L.; Wu, L.; Wen, Y.; Liu, W. A sirA-like gene, sirA2, is essential for 3succinoyl-pyridine metabolism in the newly isolated nicotine-degrading Pseudomonas sp. HZN6 strain. Appl. Microbiol. Biot. 2011, 92, 1023-1032. 24. Li, J.; Huang, Y.; Hou, Y.; Li, X.; Cao, H.; Cui, Z. Novel gene clusters and metabolic pathway involved in 3,5,6-trichloro-2-pyridinol degradation by Ralstonia sp. strain T6. Appl. Environ. Microb. 2013, 79, 7445-7453. 25. Liu, Y. G.; Whittier, R. F. Thermal asymmetric interlaced PCR: automatable amplification and sequencing of insert end fragments from Pl and YAC clones for chromosome walking. Genomics 1995, 25, 674-681. 26. Fu, B.; Li, Q. X.; Xu, T.; Cui, Z. L.; Sun, Y.; Li, J. Sphingobium sp. FB3 degrades a mixture of polycyclic aromatic hydrocarbons. Int. Biodeter. Biodegr. 2014, 87, 44-51. 27. Kelley, L. A.; Mezulis, S.; Yates, C. M.; Wass, M. N.; Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protoc. 2015, 10, 845-858. 28. Hanwell, M. D.; Curtis, D. E.; Lonie, D. C.; Vandermeersch, T.; Zurek, E.; Hutchison, G. R. Avogadro: an advanced semantic chemical editor, visualization, and analysis platform. J. Cheminformatics 2012, 4, 17. 29. Sanner, M. F. Python: A programming language for software integration and development. J. Mol. Graph. Model. 1999, 17, 57-61. 30. Forli, S.; Huey, R.; Pique, M. E.; Sanner, M.; Goodsell, D. S.; Olson, A. J. Computational protein-ligand docking and virtual drug screening with the AutoDock suite. Nat. Protoc. 2016, 11, 905-919. 31. Schuler, L.; Ni Chadhain, S. M.; Jouanneau, Y.; Meyer, C.; Zylstra, G. J.; Hols, P.; Agathos, S. N. Characterization of a novel angular dioxygenase from fluorene-degrading Sphingomonas 18 ACS Paragon Plus Environment

Page 18 of 29

Page 19 of 29

420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464


sp. strain LB126. Appl. Environ. Microb. 2008, 74, 1050-1057. 32. Kweon, O.; Kim, S. J.; Freeman, J. P.; Song, J.; Baek, S.; Cerniglia, C. E. Substrate specificity and structural characteristics of the novel Rieske nonheme iron aromatic ringhydroxylating oxygenases NidAB and NidA3B3 from Mycobacterium vanbaalenii PYR-1. MBio 2010, 1. 33. Jin, J.; Yao, J.; Liu, W.; Zhang, Q.; Liu, J. Fluoranthene degradation and binding mechanism study based on the active-site structure of ring-hydroxylating dioxygenase in Microbacterium paraoxydans JPM1. Environ. Sci. Pollut. R. 2017, 24, 363-371. 34. Jouanneau, Y.; Meyer, C.; Duraffourg, N. Dihydroxylation of four- and five-ring aromatic hydrocarbons by the naphthalene dioxygenase from Sphingomonas CHY-1. Appl. Microbiol. Biot. 2015, 100, 1253-1263. 35. Jouanneau, Y.; Meyer, C.; Jakoncic, J.; Stojanoff, V.; Gaillard, J. Characterization of a naphthalene dioxygenase endowed with an exceptionally broad substrate specificity toward polycyclic aromatic hydrocarbons. Biochemistry 2006, 45, 12380-12391. 36. Baboshin, M.; Ivashina, T.; Chernykh, A.; Golovleva, L. Comparison of the substrate specificity of two ring-hydroxylating dioxygenases from Sphingomonas sp. VKM B-2434 to polycyclic aromatic hydrocarbons. Biodegradation 2014, 25, 693-703. 37. Khara, P.; Roy, M.; Chakraborty, J.; Ghosal, D.; Dutta, T. K. Functional characterization of diverse ring-hydroxylating oxygenases and induction of complex aromatic catabolic gene clusters in Sphingobium sp. PNB. FEBS Open Bio 2014, 4, 290-300. 38. Pinyakong, O.; Habe, H.; Omori, T. The unique aromatic catabolic genes in sphingomonads degrading polycyclic aromatic hydrocarbons (PAHs). J. Gen. Appl. Microbiol. 2003, 49, 1-19. 39. Chadhain, S. M.; Moritz, E. M.; Kim, E.; Zylstra, G. J. Identification, cloning, and characterization of a multicomponent biphenyl dioxygenase from Sphingobium yanoikuyae B1. J. Ind. Microbiol. Biot. 2007, 34, 605-613. 40. Khan, A. A.; Wang, R. F.; Cao, W. W.; Doerge, D. R.; Wennerstrom, D.; Cerniglia, C. E. Molecular cloning, nucleotide sequence, and expression of genes encoding a polycyclic aromatic ring dioxygenase from Mycobacterium sp. strain PYR-1. Appl. Environ. Microb. 2001, 67, 3577-3585. 41. Kim, S. J.; Kweon, O.; Freeman, J. P.; Jones, R. C.; Adjei, M. D.; Jhoo, J. W.; Edmondson, R. D.; Cerniglia, C. E. Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and high-molecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Appl. Environ. Microb. 2006, 72, 1045-1054. 42. Demaneche, S.; Meyer, C.; Micoud, J.; Louwagie, M.; Willison, J. C.; Jouanneau, Y. Identification and functional analysis of two aromatic-ring-hydroxylating dioxygenases from a sphingomonas strain that degrades various polycyclic aromatic hydrocarbons. Appl. Environ. Microb. 2004, 70, 6714-6725. 43. Parales, R. E.; Lee, K.; Resnick, S. M.; Jiang, H.; Lessner, D. J.; Gibson, D. T. Substrate specificity of naphthalene dioxygenase: Effect of specific amino acids at the active site of the enzyme. J. Bacteriol. 2000, 182, 1641-1649. 44. Parales, R. E. The role of active-site residues in naphthalene dioxygenase. J. Ind. Microbiol. Biot. 2003, 30, 271-278. 45. Zielinski, M.; Kahl, S.; Standfuss-Gabisch, C.; Camara, B.; Seeger, M.; Hofer, B. Generation of novel-substrate-accepting biphenyl dioxygenases through segmental random mutagenesis and identification of residues involved in enzyme specificity. Appl. Environ. Microb. 2006, 19 ACS Paragon Plus Environment


465 466 467 468 469 470 471 472

72, 2191-2199. 46. Pellequer, J. L.; Zhao, B.; Kao, H. I.; Bell, C. W.; Li, K.; Li, Q. X.; Karu, A. E.; Roberts, V. A. Stabilization of bound polycyclic aromatic hydrocarbons by a pi-cation interaction. J. Mol. Biol. 2000, 302, 691-699. 47. Pellequer, J. L.; Chen, S. W.; Keum, Y. S.; Karu, A. E.; Li, Q. X.; Roberts, V. A. Structural basis for preferential binding of non-ortho-substituted polychlorinated biphenyls by the monoclonal antibody S2B1. J. Mol. Recognit. 2005, 18, 282-294.


Page 20 of 29

Page 21 of 29


FIGURE CAPTIONS Fig. 1. SDS-PAGE image of crude extracts of FlnA and FlnA12. The α subunit and β subunit of RHD FlnA and FlnA12, respectively, are indicated by arrows. Fig. 2. Comparison of degradation kinetics of fluoranthene by E. coli BL21 FlnA, E. coli BL21 FlnA12, and E. coli BL21 CK. Fig. 3. HPLC chromatograms of fluoranthene (retention time: 28.9 min) and a metabolite (13.1 min) in E. coli BL21 FlnA culture extracts after 6 and 12 hours. Fig. 4. Total ion chromatogram and mass spectrum of metabolites produced by fluoranthene conversion in E. coli BL21 FlnA culture extracts. Fig. 5. (A) (B) Horizontal view of ring-hydroxylating dioxygenase α subunit facing the substrate entrance. The surfaces of substrate catalytic site are shown in grey. Benzo[a]pyrene is shown in red. Loops LI and LII that form the entrance of substrate binding site are shown in cyan and green, respectively. Amino acid residues Phe223 and Leu223 are shown in cyan. This substrate entrance view shows the importance of amino acid residue 223 on accessibility of benzo[a]pyrene to the substrate catalytic site. (C) Camparison of catalytic efficiencies of benzo[a]pyrene by E. coli BL21 FlnA (FlnA), E. coli BL21 FlnA223 (FlnA223), and no bacteria control (ck)



Fig. 1. SDS-PAGE image of crude extracts of FlnA and FlnA12. The α subunit and β subunit of RHD FlnA and FlnA12, respectively, are indicated by arrows.


Page 22 of 29

Page 23 of 29


Fig. 2. Comparison of degradation kinetics of fluoranthene by E. coli BL21 FlnA, E. coli BL21 FlnA12 and E. coli BL21 CK.


Relative peak intensity


Retention time (min) Fig. 3. HPLC chromatograms of fluoranthene (retention time: 28.9 min) and a metabolite (13.1 min) in E. coli BL21 FlnA culture extracts after incubation of 6 and 12 h.


Page 24 of 29

Page 25 of 29


Fig. 4. GC-MS total ion chromatogram (A) and mass spectrum (B) of metabolites produced by fluoranthene transformation in E. coli BL21 FlnA culture extracts



Fig. 5. (A) (B) Horizontal view of ring-hydroxylating dioxygenase α subunit facing the substrate entrance. The surfaces of substrate catalytic site are shown in grey surface. Benzo[a]pyrene is shown in red sticks. Loops LI and LII that form the entrance of substrate binding site are shown in cyan and green, respectively. Amino acid residues Phe223 and Leu223 are shown in cyan. This substrate entrance view shows the importance of amino acid residue 223 on accessibility of BaP to substrate catalytic site. (C) Camparison of catalytic efficiencies of benzo[a]pyrene by E. coli BL21 FlnA (FlnA), E. coli BL21 FlnA223 (FlnA223), and no bacteria control (ck).


Page 26 of 29

Page 27 of 29


Table 1. Bacterial strains and plasmids used in this study plasmids or strains

relevant characteristics

plasmids pSC123

Kmr, vector for transposon-mediated mutagenesis of

pRK600

bacteria Gmr, helper plasmid, mob+, tra+

pMD19-T (simple)

T-A cloning vector, Ampr

pETDuet-1

Ampr, expression vector

pACYCDuet-1

Cmr, expression vector

pET-A1fA2f

pETDuet-1 containing flnA1f and flnA2f

pACYC-A3A4

pACYCDuet-1contaning flnA3 and flnA4

pET-A1f223A2f

pETDuet-1 containing flnA1f223 and flnA2f

strains Sphingobium sp. FB3

PAH degrading isolated

Spningobium sp. 5-41

mutant of FB3 inserting by transpose mariner

Spningobium sp. 12-45

mutant of FB3 inserting by transpose mariner

E. coli DH5α

host strain for cloning vectors

E. coli BL21 (DE3)

F_ompT hsdS(rB- mB-) gal dcm lacY1

E. coli SM10λpir

conjugation strain

E. coli BL21 FlnA

containing plasmids pET-A1fA2f and pACYC-A3A4

E. coli BL21 FlnA12

containing plasmids pET-A1fA2f and pACYCDuet-1

E. coli BL21 CK

containing plasmids pETDuet-1 and pACYCDuet-1

E. coli BL21 FlnA223

containing plasmids pET-A1f223A2f and pACYC-A3A4



Table 2. Oligonucleotide primers used in this study primers

sequences (5’-3’)a

purposes

A1f-F

CATATGAGCGGCGACACCACACTC

amplification of flnA1f

A1f-R

GGTACCTCATTCGGCCGCGTTGAG


A2f-F

CCATGGGCATGTCGACCGAACAAG


A2f-R

CTGCAGCTAACAAAAGAAATACAGATTC


A3-F

CATATGTCGAACAAACTGCGCCTTT

amplification of flnA3

A3-R

GGTACCTCAGGCGCTCCCTTCCG


A4-F

CCATGGGCGTGCGCTCGATTGCT


A4-R

AAGCTTTCAGCCCGCCTGCTTGA


A1f223-1-F

CATATGAGCGGCGACACCACACTC

amplification of flnA1f223

A1f223-1-R

GCCAGTCCCGCCAACGGACC


A1f223-2-F

GGTCCGTTGGCGGGACTGGC


A1f223-2-R

GGTACCTCATTCGGCCGCGTTGAG


ARB1

GGCCACGCGTCGACTAGTACNNNNNNNN

amplification of 5’ flanking

NNGATAT

sequence of the transposon

GGCCACGCGTCGACTAGTACNNNNNNNN


NNACGCC

sequence of the transposon

GGCCACGCGTCGACTAGTAC


ARB2 ARB3

sequence of the transposon F-SP1

AGCCAGGGATGTAACGCACT

amplification of 5’ flanking sequence of the transposon

F-SP2

TAACGGCTGACATGGGAATT

amplification of 5’ flanking sequence of the transposon

a

Restriction sites of primers are italic.


Page 28 of 29

Page 29 of 29


TABLE OF CONTENT GRAPHIC


Mutation of Phenylalanine-223 to Leucine ... - ACS Publications

Recommend Documents