Mycobacterium tuberculosis Dethiobiotin ... - ACS Publications

Subscriber access provided by UNIV TEXAS SW MEDICAL CENTER

Article

Mycobacterium tuberculosis dethiobiotin synthetase facilitates nucleoside triphosphate promiscuity through alternate binding modes Andrew Philip Thompson, Wanisa Salaemae, Jordan L Pederick, Andrew D. Abell, Grant William Booker, John B Bruning, Kate Louise Wegener, and Steven W. Polyak ACS Catal., Just Accepted Manuscript • Publication Date (Web): 09 Oct 2018 Downloaded from http://pubs.acs.org on October 9, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Mycobacterium tuberculosis dethiobiotin synthetase facilitates nucleoside triphosphate promiscuity through alternate binding modes Authors Andrew P. Thompson1, Wanisa Salaemae1, †, Jordan L. Pederick1, Andrew D. Abell2,3, Grant W. Booker1, John B. Bruning1,2, Kate L. Wegener1,2, Steven W. Polyak1,2* Affiliations 1

Department of Molecular and Biomedical Science, School of Biological Sciences, The University of Adelaide,

Adelaide, South Australia, 5005, Australia 2

Institute for Photonics and Advanced Sensing (IPAS), School of Biological Sciences, The University of

Adelaide, Adelaide, South Australia, 5005, Australia 3

Centre for Nanoscale BioPhotonics (CNBP) and Department of Chemistry, The University of Adelaide,

Adelaide, South Australia, 5005, Australia * To whom correspondence should be addressed. Tel: +61 8 8313 4062; Email: [email protected] †Current

address: Department of Biochemistry, Faculty of Science, Prince of Songkla University, Songkhla, 90110, Thailand

1 ACS Paragon Plus Environment

ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 31

Abstract The penultimate step in the biosynthesis of biotin is the closure of the ureido heterocycle in a reaction requiring a nucleotide triphosphate (NTP). In Mycobacterium tuberculosis this reaction is catalysed by dethiobiotin synthetase (MtDTBS). MtDTBS is unusual as it can employ multiple nucleoside triphosphates (NTPs), with a >100-fold preference for cytidine triphosphate (CTP). Here the molecular basis of NTP binding was investigated using a surface plasmon resonance-based ligand binding assay and X-ray crystallography. The biophysical and structural data revealed two discrete mechanisms by which MtDTBS binds NTPs: i) A high affinity binding mode employed by CTP (KD 160 nM) that is characterised by a slow dissociation rate between enzyme and ligand (kd 5.3 x 10-2 s-1), and that is defined by an extended network of specific ligand-protein interactions involving both the cytidine and triphosphate moieties, and ii) A low affinity mode employed by the remaining NTPs (KD > 16.5 M), that is characterised by weak interactions between protein and ligand. Previously intractable structures of MtDTBS in complex with ATP, GTP, UTP, and ITP were obtained to define the molecular basis of the low affinity ligand binding. Anchoring of the triphosphate moiety into the phosphate binding loop of MtDTBS allows the promiscuous utilization of multiple NTPs. Both high and low binding mechanisms showed conserved hydrogen bonding interactions involving the β-phosphate of NTPs and a highaffinity anion binding site within the phosphate binding loop. This study provides insights into enzymes that can likewise utilize multiple NTPs. Keywords Mycobacterium tuberculosis, nucleoside triphosphate, enzyme, X-ray crystallography, surface plasmon resonance, dethiobiotin synthetase


Page 3 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Introduction Tuberculosis (TB), a highly contagious airborne disease caused by the bacterium Mycobacterium tuberculosis, is one of the most common causes of premature death worldwide1. It is often treatable and curable, with a global treatment success rate of 83% for patients that were diagnosed in 20161. However, there has been a significant rise in cases of multidrug-resistant (MDR) TB, with an estimated 490,000 new cases of MDR-TB in 2016 alone1. By definition, MDR strains are resistant to the two first line anti-TB drugs rifampicin and isoniazid. It is estimated that 6.2% of patients affected by MDR-TB were also resistant to second line anti-TB drugs2, resulting in further classification as extensively drug resistant TB (XDR-TB). The rise of drug resistant TB must be combated with renewed efforts in antibiotic drug discovery. One promising avenue is to develop novel classes of antibiotics for which there are no existing resistance mechanisms. Biotin biosynthesis has been identified as a promising pathway for the development of new anti-TB therapeutics3,4. Biotin (vitamin B7) is an essential cofactor for certain enzymes that catalyze the carboxylation, decarboxylation and transcarboxylation of metabolites5. In M. tuberculosis, biotin dependent enzymes play key roles in crucial cellular processes including fatty acid metabolism, energy production, and cell membrane maintenance and biogenesis. Bioinformatics studies using M. tuberculosis genomic data found that these bacteria lack a high affinity biotin transport system homologous to those found in other bacteria4,6,7. These results suggested that mycobacteria are unable to acquire exogenous biotin from the surrounding host environment, rendering the bacteria dependent upon de novo synthesis to satisfy their biotin requirements. The final four steps of biotin biosynthesis require four enzymes encoded by bioF, bioA, bioD and bioB genes respectively4. Targeted knockouts of several of these genes have demonstrated that they are essential for the survival of cultured tuberculi8, as well as acute and latent infection models in mice9, thereby genetically validating biotin biosynthetic enzymes as potential drug targets.

Here we investigate dethiobiotin synthetase from M. tuberculosis (MtDTBS, encoded by bioD), the enzyme that catalyzes the penultimate step in biotin biosynthesis. MtDTBS facilitates the carboxylation of 7,8diaminopelargonic acid (DAPA) to form the ureido ring of dethiobiotin in a reaction requiring CO2 and a nucleoside triphosphate (NTP) as depicted in scheme 110–12. We have previously shown that MtDTBS can use a broad range of NTPs in this reaction, with a preference for cytidine triphosphate (CTP)13. This promiscuous NTP binding activity has not been observed for DTBS from other bacteria. Our crystal structure of MtDTBS in complex with CTP defined the binding mode for this ligand (PDB ID: 4WOP). MtDTBS crystallizes as a dimer of the biologically relevant homodimers, with each monomer composed of alternating α-helices and β-sheets interconnected by coil regions. This fold is conserved amongst DTBS homologs from other bacteria, including Escherichia coli11, Helicobacter pylori14 and Francisella tularensis (PDB ID: 3OF5). The CTP and DAPA binding pockets are juxtaposed to facilitate phosphorylation of the DAPA-carbamate intermediate, necessary for the closure of the ureido ring of biotin (Figure 1). A comparison of the available


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 31

structures of MtDTBS either alone or in complex with CTP or DAPA carbamate (PDB IDs: 3FGN, 4WOP and 3FMF, respectively)8,13 suggests that the DAPA and NTP binding sites are pre-formed, as there are no significant conformational changes observed upon ligand binding. DAPA-carbamate binds to a cavity between the two protein subunits formed by the heterodimer 8. The cytosine moiety of CTP binds into a pocket formed by the coils connecting β7-3102, and β6-α7, hydrogen bonding with the backbones of residues Gly169, Pro197, Ala200 and Ala201 (Figure 1). Amino acids in the phosphate binding loop (P-loop, residues Gly8 – Thr16; a.k.a. Walker A motif15), present between β1 and the N-terminus of α1, make backbone-mediated hydrogen bonds and electrostatic contacts to the triphosphate of the bound CTP (Figure 1). We previously hypothesized that specific structural features in the MtDTBS nucleoside pocket were responsible for promiscuous NTP binding. Repeated efforts to crystallize the enzyme with alternate NTPs proved unsuccessful, presumably due to the presence of crystallographic precipitants competing with ligands for binding to the MtDTBS active site. We recently developed a crystallographic technique termed precipitant-ligand exchange16, which allowed us to overcome this technical hurdle. Proof of concept that a protein bound precipitant could be displaced by a competitive ligand was established using CTP. The crystal structure obtained using our new crystal soaking approach demonstrated that CTP adopted the same mode of binding described above16. Here, we use this technique to investigate the atomic interactions between NTPs and MtDTBS. In the current study, surface plasmon resonance (SPR) binding assays and precipitant-ligand exchange were employed to investigate the molecular interactions between MtDTBS and a range of NTPs. MtDTBS was shown to utilize two discrete binding mechanisms: i) a high affinity interaction employed by CTP; and ii) a low affinity, promiscuous binding mode employed by other NTPs. SPR binding assays using nucleoside mono-, di- and triphosphates were also performed to determine the relative contribution of each phosphate to binding. Importantly, precipitant-ligand exchange allowed capture of enzyme-NTP complexes that were otherwise unattainable. Together these data define a key interaction between the -phosphate of NTPs and the P-loop of MtDTBS as crucial for both the high and low affinity binding modes.


Page 5 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Materials and Methods Cloning Construction of the expression plasmid pET-H6-MtbioD, required for the production of recombinant His-tagged MtDTBS used in crystallography, has been previously reported13. For SPR binding assays, MtDTBS was engineered with a GLNDIFEAQKIEWH sequence on the C-terminus to facilitate site specific biotinylation17. DNA encoding the peptide was fused onto the 3' end of MtbioD (encoding MtDTBS) in a polymerase chain reaction using oligonucleotides B492 (5'AGTGATGGATCCTTATTAGTGCCACTCGATTTTTTGAGCTTCAAAAATGTCATTCAGACCACCAACC AGACCTGCAACCCAATTACG) and B491 (5' – ATCACTCCATGGGTCATCATCATCACCATCATGG) and template pET-H6-MtbioD. The product was treated with NcoI and BamHI endonucleases and ligated into similarly treated pET-16b (Novagen). Recombinant Protein Production All recombinant MtDTBS proteins were expressed, purified (using immobilized metal ion chromatography) and concentrated as previously described13. An additional size exclusion chromatography step (HiPrep 26/60 Sephacryl S-300 HR, GE Healthcare) was included to further purify the protein together with buffer exchange into 25 mM Tris buffer (pH 7.5), 30 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol (DTT), 5% (v/v) glycerol. X-ray crystallography CTP-DAPA-MtDTBS: 1 mM of each of CTP, DAPA, NaHCO3 and MgCl2 were added to a 10 mg/mL stock of MtDTBS and incubated on ice for 30 minutes. Crystals were then grown via the hanging drop method with a 500 µL well solution of 0.7 M NaCitrate, 0.1 M Tris pH 7 and 20% glycerol. A drop ratio of 1:1 (MtDTBS solution:well solution) was used. Bi-pyramidal crystals grew after 3 days at 16ºC. Crystals were flash cooled in liquid nitrogen. CDP-MtDTBS: MtDTBS crystals were grown via the hanging drop method with a 500 µL well solution of 0.7 M NaCitrate, 0.1 M Tris pH 7 and 20% glycerol using a 1:1 drop ratio (MtDTBS solution:well solution). 20 mM CDP and 2 mM MgCl2 were added directly to drops containing MtDTBS crystals and incubated overnight at 16ºC. Crystals were cryoprotected with paratone-N before flash cooling in liquid nitrogen. CTN-MtDTBS: MtDTBS crystals were grown via the hanging drop method with a 500 µL well solution of 1.0 – 1.5 M (NH4)2SO4, 0.1 M Tris pH 8 and 10 – 25% glycerol using a 1:1 drop ratio (MtDTBS solution:well solution). Cytidine (CTN) was soaked into crystal containing drops at 65 mM for 3 days at 16ºC before flash cooling in liquid nitrogen. ATP, ITP, TTP, UTP – MtDTBS: MtDTBS crystals were grown via the hanging drop method with a 500 µL well solution of 1.2 – 1.7 M (NH4)2SO4, 0.1 M Tris pH 8 and 10 – 15% glycerol using a 1:1 drop ratio (MtDTBS solution:well solution) at 16ºC. All following crystal handling steps were performed at 16ºC. Another well was


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 31

set up containing 100μL of 0.1M Tris pH 8 and the corresponding amount of glycerol. An MtDTBS crystal was then transferred from its growth condition into an 8μL drop of 0.1 M Tris pH 8, 10 – 20% glycerol containing the ligand of interest (300 mM ATP, 248 mM ITP, 217 mM GTP, 230 mM TTP, 255 mM UTP, respectively). High ligand concentrations were used to ensure the P-loop remained occupied throughout to prevent crystal degradation. Soak duration depended on crystal quality and ranged from 1 hour to 72 hours. Collection and refinement: All crystals were flash cooled in liquid nitrogen and diffraction data was collected on the MX-1 beamline at the Australian Synchrotron, part of ANSTO18. Data were collected at 100K and at a wavelength of 0.7108 Å or 0.9537Å. Data were indexed, scaled and merged using either XDS19 or iMosflm20 and aimless (CCP421). Resolution truncation was performed in accordance with previously described CC1/2 cutoff values22,23. In all cases the MtDTBS structure was solved in the P212121 space group. Phasing was performed with either phaserMR24 or DIMPLE using in house MtDTBS search models. Structures were iteratively refined with rounds of manual modelling in Coot25 and refinement with phenix.refine26. Phenix.ensemble refinement was performed to model ligand disorder. A pTLS of 1 was used, as was a harmonic restraint on the phosphate atoms of ATP in the ATP-MtDTBS refinement, with default settings for remaining parameters27. PDB files were submitted to the Protein Data Bank with the following accession codes: CTPDAPA-carbamate-MtDTBS (6CVE), CDP-MtDTBS (6CZD), CTN-MtDTBS (6CVU), ATP-MtDTBS (6CVV), ITP-MtDTBS (6CZE), UTP-MtDTBS (6CZB), TTP-MtDTBS (6CZC). Surface plasmon resonance binding assays NTP binding assays were performed on a Biacore S200 (GE Healthcare) at 25ºC. CM5 sensorchips (GE Healthcare) were pre-conditioned with two 50 s injections at 10 μL/min consisting of each of the following individual solutions: 50 mM NaOH, 10 mM HCl, 0.1% SDS, 0.85% H3PO4 then 50 mM glycine pH 9.5. Streptavidin coating of the CM5 sensorchips was then carried out in a running buffer of 10 mM HEPES pH 7.4, 150 mM NaCl and 0.05% Tween20. The surface was activated with NHS and EDC (GE Healthcare) for 900 s at 10μL/min, before streptavidin (100 μg/mL, pH 4.5 in NaAcetate) was injected at 2 μL/min until ~6000 – 10,000 RU of material had been immobilized. To block the surface and remove uncoupled streptavidin, two 210 s injections of ethanolamine (GE Healthcare) were performed at 10 μL/min. Biotin-MtDTBS was diluted to 500 μg/mL in SPR running buffer (50 mM Tris pH 7.4, 150 mM NaCl, 25 mM MgCl2 and 0.05% Tween20) and injected onto the streptavidin coated surface until ~5,000 RU had been captured. The sensorchip was then equilibrated overnight in SPR running buffer before commencing binding experiments. Biological activity of the immobilized MtDTBS was confirmed with binding assays using DAPA (purchased from Santa Cruz Biotechnology sc-207183). Binding curves were obtained by injecting varying concentrations of analyte across the sensorchip for 30 s followed by a 30 s dissociation phase for all NTPs except for CDP (~60-80 s) and CTP (~120-180 s) where longer dissociation times were required. At least 2 buffer-only controls were included within and between each serial dilution. Analysis of affinity and kinetic parameters was performed using Biacore S200 Evaluation Software (GE Healthcare). Mean and standard error of the mean (SEM) values for ka, kd and KD were


Page 7 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

determined from the values given by independent replicate experiments (both different sample preparations and different immobilizations). Mass transport was assessed by the Karlsson metric28. Preparation of Nucleotide Solutions Nucleotides were purchased from Sigma-Aldrich (analytical grade powder) and dissolved to high concentrations (500 – 600 mM) in MQ H2O, followed by adjustment to pH 7 with NaOH. The UV absorption was measured (Nanodrop 200, Thermo Scientific) and used to calculate ligand concentration using Beer’s Law and the extinction coefficient for each nucleotide29. Compounds were prepared by mixing the NTP with 20x SPR running buffer and diluting with H2O to ensure buffer matching in the SPR assays. Compounds were then diluted with SPR running buffer to the appropriate assay concentrations and serially diluted with a Microlab Nimbus pipetting workstation (Hamilton Company). Results MtDTBS binds NTPs through two alternate modes A SPR-based quantitative ligand binding assay was used to investigate the mechanism of NTP binding. Previous attempts at immobilizing MtDTBS onto SPR sensor surfaces by amine coupling proved problematic13. This chemical approach is less than ideal as it can lead to protein denaturation and loss of activity. Hence, we sought to maintain biological activity by performing the immobilization under milder, more biologically compatible conditions. MtDTBS was engineered with a C-terminal peptide allowing site specific biotinylation of the enzyme17 and, consequently, binding onto streptavidin-coated sensor surface under physiological conditions. The biological activity of the enzyme immobilized using this approach was confirmed by measuring the equilibrium binding constant (KD) for the natural substrate DAPA. The enzyme retained full binding activity for 3 weeks (cf. 1 week using amine coupling) with the calculated KD in agreement with published literature (KD = 80 µM ± 20 µM, n = 6; Table S1; Figure S1), thereby validating the optimised SPR protocol. The interaction between MtDTBS and NTPs was then addressed. Tris-saline running buffer (pH 7.4) supplemented with 25 mM MgCl2 was found to be optimal for NTP binding studies. No ligand binding was measured when phosphate buffered saline was employed as the running buffer, presumably due to competitive binding to the enzyme between free phosphate and the NTP (see further details below). The affinities and binding kinetics for a panel of 6 NTPs were determined using this SPR protocol with the results summarized in Table 1 (additional data provided in Table S1 and the sensorgrams in Figure S1). These results clearly demonstrated that MtDTBS exhibited the highest affinity for CTP (KD = 160 ± 10 nM, n = 5). CTP binding sensorgrams showed a slow dissociation phase requiring more than two minutes to return to baseline characteristic of a high affinity interaction (Figure 2A). These data were fitted with a kinetic binding model (Biacore S200 Software) allowing the calculation of rates of association (ka = 3.2 ± 0.3×105 M-1s-1) and dissociation (kd = 5.3 ± 0.4×10-2 s-1). In contrast, the sensorgrams


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 31

for the other NTPs exhibited fast association and dissociation rates that were unable to be fitted to the kinetic model (Figure 2B-D). Accordingly, a steady state affinity model was applied to calculate KD values from these data (Biacore S200 Software). The affinities for the other NTPs in the panel were all weaker than that measured for CTP, ranging from 16.5 to 93 µM (Table 1). Uridine triphosphate (UTP), the most structurally similar NTP to CTP (3-N and 4-NH2 of CTP replaced with 3-NH and 4-O in UTP; refer to Table 1 for nomenclature) bound ~300-fold weaker than CTP (UTP KD = 47 ± 1 µM, n = 3; Table 1). This data implies that key hydrogen bonding interactions involving 3-N and 4-NH2 of CTP are necessary for high affinity binding (details of these interactions are described in more detail later). Similarly, another pyrimidine deoxythymidine triphosphate (dTTP, KD = 16.5 ± 0.7 µM, n = 3) bound ~100-fold weaker than CTP. The purines guanidine triphosphate (GTP, KD = 48 ± 5 µM, n = 3), adenosine triphosphate (ATP, KD = 75 ± 3 µM, n = 3) and inosine triphosphate (ITP, KD = 93 ± 8 µM, n = 3) also had >100-fold lower affinities than CTP. Together, the SPR binding data suggest that NTP binding to MtDTBS occurs by either (i) a high affinity and specificity binding mode employed by CTP, characterized by slow dissociation rates between enzyme and ligand or (ii) a low affinity promiscuous binding mode adopted by all remaining NTPs, characterized by fast association and dissociation kinetics. A structural definition of the high affinity binding mode X-ray crystallographic structures for MtDTBS in complex with cytidine (CTN; 2.46Å; PDB ID: 6CVU), cytidine diphosphate (CDP; 2.3Å; PDB ID: 6CVF), and both CTP and DAPA-carbamate (2.2Å; PDB ID: 6CVE) were solved in order to further explore the high affinity NTP binding mode. Crystallographic details are provided in Materials and Methods, and statistics in Table S1. All structures were solved as a dimer of the biological homodimers (i.e. tetramer) in the P212121 space group previously reported (monomeric α/β fold as observed in Figure 1) 8,13. Minimal conformational changes in the protein backbone were observed between our new structures and those in the literature (RMSD < 1.3 Å; Figure S2). In each structure well defined electron density within the active site was modelled with the corresponding ligand (reduced bias (polder30) density maps provided in Figure 3; wall-eye view of density in Figure S3A-C). CTP was observed in three out of four active sites of the tetramer, whilst CTN and CDP were observed in all four active sites. Accordingly, all three structures exhibited >80% ligand occupancy after refinement (Table S3) and low B-factors indicative of low local mobility for all heavy atoms in the ligand (Figure 4A). All three ligands adopt similar binding poses as per CTP in a shallow, solvent exposed nucleoside binding pocket (PDB ID: 4WOP). The hydrogen bonding interactions between MtDTBS and the cytosine moiety were conserved in all structures, namely hydrogen bonds between the cytosine 4-NH2 and the backbone carbonyls of Pro197 and Gly169, as well as between the cytosine 3-N of CTP and the backbone amide of Ala200 (Figure 3). MtDTBS complexes were further stabilized by hydrogen bonds between cytosine 2-O and the backbone amide of Ala201. Hydrophobic interactions were also observed between the pyrimidine heterocycle of CTP and the side chains of Val17 and Ser170. Approximately 50% of the CTN


Page 9 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

molecular surface was in contact with the enzyme compared to ~77% for CTP (Molsoft ICM Pro). This disparity is due to the P-loop enclosing the triphosphates. These structural data demonstrate that in the absence of the phosphates, CTN adopts precisely the same mode of binding into the cytidine pocket as its di- and triphosphate analogues CDP and CTP. Amino acids in the P-loop formed a network of intermolecular interactions with the polyphosphate moieties of CDP and CTP. The triphosphate forms polar interactions with amide backbones of Thr11, Gly12, Val13, Gly14, Thr16 and Val17, as well as the side chains of Thr11, Lys15 and Thr16 (Figure 5A in the CTP-DAPACarbamate-MtDTBS complex). Of note was the β-phosphate of CTP, that interacts with the P-loop through a network of hydrogen bonding interactions comprising the backbone amides of Gly12, Val13, Gly14, Lys15, Thr16 and the side chains of Lys15 and Thr16. Residues Gly12-Lys15 make up a structural feature within the Ploop known as the LRLR nest, so called due to the dihedral angles adopted by each amino acid31. The α and ɣphosphates participated in comparatively fewer hydrogen bonding interactions compared with the β-phosphate (Figure 5A). Mg2+ was observed bound to one oxygen from each of the β and ɣ-phosphates of CTP, the side chains of Thr16, Asp49 and Glu108, and a water molecule (Figure 5B). This requirement for Mg2+ for nucleotide binding was consistent with the observation that MgCl2 was required in the SPR running buffer during ligand binding assays. In contrast to CTP, CDP coordinated to fewer P-loop residues, and bound the magnesium ion through the β-phosphate alone, with the ɣ-phosphate interaction replaced by a water molecule. In the co-crystal structure of MtDTBS with both CTP and DAPA, electron density observed in the active site was clearly larger than that expected for DAPA but was consistent with that of the reaction intermediate DAPAcarbamate (CTP-DAPA-carbamate-MtDTBS structure, Figure 3A), produced by the reaction of DAPA with sodium carbonate present in the crystallization liquor (Scheme 1). It is likely that the reaction intermediate was captured due to the low temperature the crystal were grown in (16oC). This is consistent with earlier work Dey et al. (PDB ID: 3FMF) where DAPA-carbamate was also observed in crystals of MtDTBS grown in the presence of DAPA8. Our CTP-DAPA-carbamate structure is the first example of MtDTBS in complex simultaneously with both the reaction intermediate and an NTP. This structure revealed that the nucleophilic oxygen (15O) from the carbamate moiety is positioned adjacent to the oxygen atoms from the ɣ-phosphate of CTP (2.29 – 3.26Å; chains A, C), ready to facilitate the transfer of phosphate from CTP to DAPA-carbamate in the enzyme catalyzed reaction. Structural characterization of the promiscuous nucleotide binding mode Initial attempts to solve the structures of MtDTBS in complex with ATP, GTP, ITP, TTP, and UTP using either crystal soaking or co-crystallization experiments were unsuccessful. Electron density corresponding to the crystallography precipitants (sulfate or citrate) was consistently observed bound within the LRLR nest of the P-


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 31

loop (Figure S4). To overcome this, a crystallographic technique was developed to displace the precipitant with the target ligands – an approach we termed precipitant-ligand exchange16. Here, crystals were initially grown to approximately 100 – 400 m in conditions containing ammonium sulfate. They were then transferred into a soaking solution where the precipitant was replaced with NTP at high concentrations (200 – 300 mM). Crystals rapidly cracked and dissolved if the crystal soaking solution was devoid of either precipitant or NTP but were stable for up to 1-2 days in the presence of an appropriate molecule to occupy the LRLR nest. Using precipitantligand exchange crystal structures were successfully solved for the previously intractable structures of MtDTBS in complex with ATP (2.41Å), UTP (2.4Å), TTP (2.3Å) and ITP (2.3Å). Each NTP-MtDTBS structure was solved in the P212121 space group by molecular replacement, with MtDTBS adopting an identical α/β fold to that previously observed, and minimal conformational change and flexibility upon ligand binding (RMSD < 1.2 Å to the CTP-DAPA-carbamate-MtDTBS structure). Electron density observed within the LRLR nest was consistent with between two and three heavy atoms for the ATP, ITP, UTP and TTP complexes (polder map > 6σ, Figure 6), corresponding to phosphorus from the triphosphate moiety. This was in contrast to the cytidine series of structures described earlier, where clear electron density was observed for the entire chemical structures (compare to polder map 10σ in Figure 3C). Importantly, the size of this electron density was larger than that expected for the sulfate precipitant present in the crystallographic liquor. This demonstrated that the NTPs had indeed competitively displaced sulfate from its binding site in the LRLR nest. In each NTP structure, a magnesium ion was also modelled into the electron density observed at the same binding site defined earlier (Figure 5B). However, reduced bias electron density representing the nucleoside was absent. Data analysis was performed using a polder map to ensure that bulk solvent did not obscure weak electron density for the nucleoside30. Clearly, the nucleoside moieties of ATP, UTP, TTP and ITP did not occupy the cytidine binding site. In this binding mode, the NTP is predominantly “anchored” to the enzyme through an interaction between the triphosphate moiety and the P-loop. As such, the triphosphate of each NTP was modelled in the electron density at the P-loop with the ɣ-phosphate adjacent to the DAPA pocket, as would be necessary for catalysis. Interestingly, the binding mode of the triphosphate moieties varied with the α, β and ɣ phosphates occupying subtly altered positions within the P-loop (differing binding modes detailed in Figure S5). Notably, the same hydrogen bonds and electrostatic interactions with the P-loop that were described earlier for CTP were also observed in each structure (Figure 5A). The occupancy of each NTP atom was refined individually, considering the disordered nature of the nucleoside relative to the high occupancy of the triphosphate moiety. B-factor analysis highlighted the low local mobility of the triphosphate moieties and high mobility of the nucleoside moieties. As described earlier, low B-factors were consistently observed for all heavy atoms for CTP, as expected as this compound was modelled into the electron density with high confidence (Figure 4A). In contrast, while low B-factors were observed for the three phosphates of the other NTPs, the nucleoside moieties showed far greater mobility (Figure 4B showing structurally similar UTP as an example). To visually illustrate the two alternate binding modes adopted by CTP and the other NTPs, molecular dynamics simulations were performed


Page 11 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

using Ensemble Refinement (PHENIX)27 software. This program performs a molecular simulation of the protein-ligand interaction using X-ray crystallographic data. Here the CTP-DAPA-carbamate-MtDTBS and ATP-MtDTBS structures generated above were employed. Optimal Rfree values were determined using a pTLS value of 1 (Table S4). For the complex with ATP an additional harmonic restraint was necessary to anchor the phosphate atoms into the observed electron density27. The ensemble refinement demonstrated that CTP adopted a single stable binding conformation with low mobility across all atoms in the chemical structure, except the ɣphosphate that was more mobile (Figure 7A). Conversely, the nucleoside moiety of ATP exhibited multiple different conformations, highlighting the absence of specific interactions between the protein and the nucleoside moiety (Figure 7B). The LRLR nest interaction is essential to NTP binding The structural data described above had established a key role for the triphosphate moiety in NTP binding to MtDTBS. The relative contribution of each phosphate to binding was then measured using the SPR binding assay described above and a panel of nucleoside mono-, di and tri-phosphates. The affinities for CTN, cytidine monophosphate (CMP), CDP and CTP were quantitated alongside adenosine, adenosine monophosphate (AMP), ADP and ATP (Table 1; Figure S1). CTN, adenosine and their corresponding monophosphates all displayed weak affinities (KD > 1 mM). In contrast, the contribution of the β phosphate was more pronounced. CDP (KD = 450 nM ± 50, n = 4) exhibited more than a 2,000-fold increase in affinity over CMP, whilst CTP (KD = 160 nM ± 10, n = 5) had a modest ~3-fold increase over CDP. CDP produced sensorgrams similar to those observed previously for CTP, allowing the calculation of association and dissociation rates. Whereas both CTP and CDP had similar association rates (CDP ka = 3.4 ± 0.3×105 M-1s-1; CTP ka = 3.2 ± 0.3×105 M-1s-1) CTP dissociated 3fold slower (CDP kd = 15.0 ± 0.8×10-2 s-1; CTP kd = 5.3 ± 0.4×10-2 s-1). A similar trend was observed for ADP (KD = 17.9 ± 0.5 µM, n = 3) which had a >58-fold increase in affinity over AMP, whilst ATP (KD = 75 ± 3 µM, n = 3) bound a modest 3-fold weaker than ADP. The observation that the β-phosphate plays a key role in binding for both CTP and ATP was consistent with the structural data above that demonstrated the LRLR nest specifically harbors this important phosphate. Discussion The hydrolysis of NTPs occurs ubiquitously throughout the biological world and provides a source of chemical energy to catalyze a wide variety of biochemical reactions. Studies on numerous enzymes suggest that most are selective for one specific NTP. However, enzymes that can utilize multiple NTPs do appear in the literature. Nucleoside diphosphate kinase and nucleoside triphosphate diphosphohydrolase are examples of enzymes with the ability to bind multiple NTPs and/or NDPs, and for which structural data are available32,33. Nucleoside diphosphate kinase regenerates the cellular pool of NTPs other than ATP, that are required in metabolic activities such as DNA synthesis, CTP for lipid synthesis and GTP for protein elongation and signal


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 31

transduction. Nucleoside triphosphate diphosphohydrolase, anchored on outer cell membranes, catalyzes the hydrolysis of NTPs and NDPs in reactions implicated in the regulation of blood clotting, inflammatory processes and immune reactions. Inspection of the crystal structures of these enzymes in complex with NTPs reveals a common ligand binding mechanism where the benzyl side chain of a phenylalanine in the binding site interacts with aromatic purine and pyrimidine heterocycles through pi-pi stacking interactions. This is often accompanied by an arginine to ‘sandwich’ the nucleoside base32,33. This provides the molecular basis for the broad substrate specificity. In this study, we investigated DTBS from M. tuberculosis as a metabolic enzyme with promiscuous NTP binding activity. Our biophysical and structural data has identified the molecular basis for this promiscuity whereby the triphosphate moiety binds into the highly charged P-loop through electrostatic and hydrogen bonding interactions. This binding mechanism is distinct to the one described above involving aromatic stacking interactions between protein and ligand. Biochemical assays have shown that the complex between MtDTBS and NTPs other than CTP is competent to catalyze the synthesis of dethiobiotin from DAPA-carbamate13. Additional hydrogen-bonding between the cytosine base and Gly169, Pro197, Ala200 and Ala 201 in the cytidine binding pocket further govern selectivity for CTP. Noteworthy is the observation that these interactions all involve the peptide backbone, and not amino acid side chains. Promiscuous NTP utilization appears unique to the DTBS from M. tuberculosis as this property has not been demonstrated in homologues from other bacteria. Analysis of available sequences and structures from E. coli, H. pylori and F. tularensis reveal structural differences at the nucleoside binding site between species (Figure 8). E. coli and H. pylori DTBS in complex with ATP show the involvement of specific amino acid side chains in ligand binding. In particular, Asn175 is required for binding the purine ring (Figure 8B-C)11,14 and F. tularensis also possesses this amino acid at the equivalent position (Figure 8D). In contrast, MtDTBS possesses a glycine, so is unable to replicate this side chain interaction. Glu211 in E. coli DTBS hydrogen bonds to the ribose of ATP, presumably restraining the nucleoside into the binding site. There is no structural equivalent in M. tuberculosis DTBS and this may also contribute to nonselective NTP binding. Finally, the P-loops differ by size and charge between the species. M. tuberculosis DTBS possesses a small Gly12 in its highly positively charged P-loop (Figure 8A). By comparison, the P-loops of the E. coli and F. tularensis homologues are more negatively charged and contain a glutamic acid at position 12 (Figure 8B, D), whereas H. pylori has an asparagine at the equivalent position (Figure 8C). Further investigation into DTBS homologues may confirm the exact structural requirements for the NTP promiscuity employed by MtDTBS. It is possible that further examples of enzymes with promiscuous NTP binding activity involving a P-loop may exist, and have been technically difficult to study using X-ray crystallography. Indeed, optimization of the crystallography method was required in the current study to overcome precipitant occupation of the P-loop. For high affinity CTP (KD = 160 nM) and CDP (KD = 450 nM), these ligands out-competed the precipitant in the crystallization solution for binding to the P-loop. However, this was not observed for the other weaker binding NTPs, even at concentrations greater than 100 mM. P-loop-bound precipitants were competitively displaced with


Page 13 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

NTPs using our precipitant-ligand exchange technique16, whereby crystals grown in ammonium sulfate were transferred to a solution in which the ammonium sulfate precipitant was replaced by high concentrations of NTPs. Here, crystal stability was reliant on the presence of a suitable ligand (either NTP, NDP, citrate or sulfate), suggesting that occupation of the P-loop aids in forming and maintaining crystal lattice contacts. The use of this technique allowed for the capture of complexes that were otherwise unattainable. Precipitants are universally used in crystallography, and we therefore assert that precipitant-ligand exchange may be broadly applicable, particularly for ATP and GTP binding proteins, which commonly contain P-loops31. It is possible that further examples of biologically significant complexes are yet to be reported due to similar technical difficulties. Our precipitant-ligand exchange method is a solution for researchers who are presented with this problem. The promiscuous NTP activity reported here for MtDTBS may be important for the mycobacterium tuberculli. M. tuberculosis has a complex lifecycle involving an active growth stage as well as the ability to enter into a dormant (latent) state inside host cells such as macrophages and other phagocytic cells. This dormant stage is difficult to treat with most current front-line antibiotics that target metabolic processes essential during the active growth phase but not required in latency34. We propose that biotin is an important micronutrient required by the tuberculli in both stages of the lifecycle, where it is a cofactor for fatty acid biosynthesis (catalyzed by acyl CoA carboxylase, active growth) and gluconeogenesis (pyruvate carboxylase, latency)4,7. Unlike many other bacteria that can both make biotin and scavenge it from the environment, M. tuberculosis fulfills its biotin requirements solely through de novo synthesis. This self-reliance has also been noted for other enzyme cofactors such as the flavin derivative F42035 and Coezyme A36. The biosynthesis of biotin requires a source of NTP. However, it has been observed that the concentration of intracellular NTPs diminishes in certain bacteria as they transition from the active growth phase and enter into stationary phase37,38. We propose that the NTP promiscuity reported here may allow MtDTBS to remain active in vivo, regardless of fluctuating cellular NTP levels at different stages of the M. tuberculosis lifecycle13. This observation has wider implications for the discovery of new chemotherapies for the treatment of tuberculosis. Pharmaceutical disruption of targets that are essential for the survival of M. tuberculosis during the latency phase provides a new approach for treating the one third of the world’s population that are carriers of the latent tuberculli. Concluding remarks MtDTBS provides an example of an enzyme that possesses two mechanisms for binding NTPs; a high affinity mode employed by CTP and a promiscuous mode employed by a panel of other NTPs. We propose that the ability to alternate between these two mechanisms allows MtDTBS to utilize a range of NTPs for catalysis, depending upon their intracellular availability in M. tuberculosis. The P-loop of MtDTBS harbours an LRLR nest (Gly12-Val13-Gly14-Lys15) that, in combination with Thr16, was defined as a key structural element for both NTP binding modes. The nest was also a high affinity binding site for other anionic compounds, such as citrate and sulfate that were used as protein precipitants in protein crystallography. Traditional co-crystallisation


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 31

was sufficient to capture MtDTBS in complex with CTP and other cytidine containing compounds. However, investigation of the promiscuous binding mode was enabled by the development of an improved crystallographic methodology that we term precipitant-ligand exchange. This technique allowed us to solve the previously unobtainable structures of MtDTBS in complex with the low affinity NTPs and define, for the first time, the molecular basis of promiscuous NTP binding. Precipitant ligand exchange may be useful for other researchers that are confronted with similar challenges during the crystallization of difficult protein-ligand complexes. Supporting Information Available

Supporting information contains additional figures concerning SPR, MtDTBS structural comparison, ligand density and interactions between ligands and the P-loop. SPR and crystallographic data tables are also provided. This information is available free of charge on the ACS Publications website. Acknowledgements A.P.T. is a recipient of a University of Adelaide Post-Graduate Scholarship. We thank the Channel 7 Children’s Research Foundation for funding (Project: 181614). This research was undertaken on the MX1 beamline at the Australian Synchrotron, part of ANSTO. References (1) World Health Organisation. Global Tuberculosis Report; Factsheet; 2017. (2) World Health Organisation. Tuberculosis; Factsheet; World Health Organisation, 2017. (3) Thompson, A. P.; Sternicki, L. M.; Wegener, K. L.; Wei, L. U.; Limei, Z. U. O.; Booker, G. W.; Polyak, S. W.; Yan, L. I. Biotin Biology as a Target for New Anti-Tuberculosis Drugs. Jiangsu J. Prev. Med. 2016, 27, 257–261. (4) Salaemae, W.; Azhar, A.; Booker, G. W.; Polyak, S. W. Biotin Biosynthesis in Mycobacterium Tuberculosis: Physiology, Biochemistry and Molecular Intervention. Protein Cell 2011, 2, 691–695. (5) Polyak, S. W.; Bailey, L. M.; Azhar, A.; Booker, G. W. Biotin (Vitamin H or B7). In Micronutrients: Sources, properties and health benefits. Eds Betancourt, A.I. & Gaitan, H.F.; Nova Science Publishers Inc., Hauppauge, New York, 2012; pp 65–94. (6) Azhar, A.; Polyak, S. W.; Booker, G. W. Mechanisms of Biotin Transport. Biochem. Anal. Biochem. 2015, 04, 210. (7) Salaemae, W.; Booker, G. W.; Polyak, S. W. The Role of Biotin in Bacterial Physiology and Virulence: A Novel Antibiotic Target for Mycobacterium Tuberculosis. Microbiol. Spectr. 2016, 4, 1-20. (8) Dey, S.; Lane, J. M.; Lee, R. E.; Rubin, E. J.; Sacchettini, J. C. Structural Characterization of the Mycobacterium Tuberculosis Biotin Biosynthesis Enzymes 7,8-Diaminopelargonic Acid Synthase and Dethiobiotin Synthetase,. Biochemistry (Mosc.) 2010, 49, 6746–6760. (9) Woong Park, S.; Klotzsche, M.; Wilson, D. J.; Boshoff, H. I.; Eoh, H.; Manjunatha, U.; Blumenthal, A.; Rhee, K.; Barry, C. E.; Aldrich, C. C.; Ehrt, C.; Schnappinger, D.; Behr, M. A. Evaluating the Sensitivity of Mycobacterium Tuberculosis to Biotin Deprivation Using Regulated Gene Expression. PLoS Pathog. 2011, 7, e1002264. (10) Huang, W.; Jia, J.; Gibson, K. J.; Taylor, W. S.; Rendina, A. R.; Schneider, G.; Lindqvist, Y. Mechanism of an ATP-Dependent Carboxylase, Dethiobiotin Synthetase, Based on Crystallographic Studies of Complexes with Substrates and a Reaction Intermediate. Biochemistry (Mosc.) 1995, 34, 10985–10995. (11) Käck, H.; Gibson, K. J.; Lindqvist, Y.; Schneider, G. Snapshot of a Phosphorylated Substrate Intermediate by Kinetic Crystallography. Proc. Natl. Acad. Sci. 1998, 95, 5495–5500. (12) Käck, H.; Sandmark, J.; Gibson, K. J.; Schneider, G.; Lindqvist, Y. Crystal Structure of Two Quaternary Complexes of Dethiobiotin Synthetase, Enzyme-MgADP-AlF3-Diaminopelargonic Acid and Enzyme-


Page 15 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(13) (14)

(15) (16) (17) (18)

(19) (20) (21)

(22) (23) (24) (25) (26)

(27) (28) (29) (30) (31)

ACS Catalysis

MgADP-Dethiobiotin-Phosphate; Implications for Catalysis. Protein Sci. Publ. Protein Soc. 1998, 7, 2560–2566. Salaemae, W.; Yap, M. Y.; Wegener, K. L.; Booker, G. W.; Wilce, M. C. J.; Polyak, S. W. Nucleotide Triphosphate Promiscuity in Mycobacterium Tuberculosis Dethiobiotin Synthetase. Tuberculosis 2015, 95, 259–266. Porebski, P. J.; Klimecka, M.; Chruszcz, M.; Nicholls, R. A.; Murzyn, K.; Cuff, M. E.; Xu, X.; Cymborowski, M.; Murshudov, G. N.; Savchenko, A.; Edwards, A.; Minor, W. Structural Characterization of H. Pylori Dethiobiotin Synthetase Reveals Differences between Family Members. FEBS J. 2012, 279, 1093–1105. Walker, J. E.; Saraste, M.; Runswick, M. J.; Gay, N. J. Distantly Related Sequences in the Alpha- and Beta-Subunits of ATP Synthase, Myosin, Kinases and Other ATP-Requiring Enzymes and a Common Nucleotide Binding Fold. EMBO J. 1982, 1, 945–951. Thompson, A. P.; Wegener, K. L.; Booker, G. W.; Polyak, S. W.; Bruning, J. B. Precipitant-Ligand Exchange Technique Reveals ADP Binding Mode in MtDTBS. Acta Cryst. D 2018, 74, 965-972. Beckett, D.; Kovaleva, E.; Schatz, P. J. A Minimal Peptide Substrate in Biotin Holoenzyme SynthetaseCatalyzed Biotinylation. Protein Sci. Publ. Protein Soc. 1999, 8, 921–929. McPhillips, T. M.; McPhillips, S. E.; Chiu, H.-J.; Cohen, A. E.; Deacon, A. M.; Ellis, P. J.; Garman, E.; Gonzalez, A.; Sauter, N. K.; Phizackerley, R. P.; Soltis, S. M.; Kuhn, P. Blu-Ice and the Distributed Control System: Software for Data Acquisition and Instrument Control at Macromolecular Crystallography Beamlines. J. Synchrotron Radiat. 2002, 9, 401–406. Kabsch, W. XDS. Acta Cryst D 2010, 66 , 125–132. Battye, T. G. G.; Kontogiannis, L.; Johnson, O.; Powell, H. R.; Leslie, A. G. W. IMOSFLM: A New Graphical Interface for Diffraction-Image Processing with MOSFLM. Acta Cryst D 2011, 67 , 271–281. Winn, M. D.; Ballard, C. C.; Cowtan, K. D.; Dodson, E. J.; Emsley, P.; Evans, P. R.; Keegan, R. M.; Krissinel, E. B.; Leslie, A. G. W.; McCoy, A.; McNicholas, S. J.; Murshudov, G. N.; Pannu, N. S.; Potterton, E. A.; Powell, H. R.; Read, R. J.; Vagin, A.; Wilson, K. S. Overview of the CCP4 Suite and Current Developments. Acta Cryst D 2011, 67, 235–242. Karplus, P. A.; Diederichs, K. Assessing and Maximizing Data Quality in Macromolecular Crystallography. Curr. Opin. Struct. Biol. 2015, 34, 60–68. Karplus, P. A.; Diederichs, K. Linking Crystallographic Model and Data Quality. Science 2012, 336, 1030–1033. McCoy, A. J.; Grosse-Kunstleve, R. W.; Adams, P. D.; Winn, M. D.; Storoni, L. C.; Read, R. J. Phaser Crystallographic Software. J. Appl. Crystallogr. 2007, 40, 658–674. Emsley, P.; Cowtan, K. Coot: Model-Building Tools for Molecular Graphics. Acta Cryst D 2004, 60, 2126–2132. Adams, P. D.; Afonine, P. V.; Bunkóczi, G.; Chen, V. B.; Davis, I. W.; Echols, N.; Headd, J. J.; Hung, L.-W.; Kapral, G. J.; Grosse-Kunstleve, R. W.; McCoy, A. J.; Moriarty, N. W.; Oeffer, R.; Read, R. J.; Richardson, D. C.; Richardson, J. S.; Terwilliger, T. C.; Zwart, P. H. PHENIX: A Comprehensive Python-Based System for Macromolecular Structure Solution. Acta Cryst D 2010, 66, 213–221. Burnley, B. T.; Afonine, P. V.; Adams, P. D.; Gros, P. Modelling Dynamics in Protein Crystal Structures by Ensemble Refinement. eLife 2012, 1, e00311. Karlsson, R. Affinity Analysis of Non-Steady-State Data Obtained under Mass Transport Limited Conditions Using BIAcore Technology. J. Mol. Recognit. 1999, 12, 285–292. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; New York: Cold Spring Harbor Laboratory Press, 1989. Liebschner, D.; Afonine, P. V.; Moriarty, N. W.; Poon, B. K.; Sobolev, O. V.; Terwilliger, T. C.; Adams, P. D. Polder Maps: Improving OMIT Maps by Excluding Bulk Solvent. Acta Cryst D 2017, 73, 148–157. Watson, J. D.; Milner-White, E. J. A Novel Main-Chain Anion-Binding Site in Proteins: The Nest. A Particular Combination of φ,ψ Values in Successive Residues Gives Rise to Anion-Binding Sites That Occur Commonly and Are Found Often at Functionally Important Regions11Edited by J. Thornton. J. Mol. Biol. 2002, 315, 171–182.


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(32) (33) (34) (35) (36) (37) (38) (39)

Page 16 of 31

Xu, Y. W.; Moréra, S.; Janin, J.; Cherfils, J. AlF3 Mimics the Transition State of Protein Phosphorylation in the Crystal Structure of Nucleoside Diphosphate Kinase and MgADP. Proc. Natl. Acad. Sci. U. S. A. 1997, 94, 3579–3583. Zebisch, M.; Krauss, M.; Schäfer, P.; Lauble, P.; Sträter, N. Crystallographic Snapshots along the Reaction Pathway of Nucleoside Triphosphate Diphosphohydrolases. Structure 2013, 21, 1460–1475. Caño-Muñiz, S.; Anthony, R.; Niemann, S.; Alffenaar, J.-W. C. New Approaches and Therapeutic Options for Mycobacterium Tuberculosis in a Dormant State. Clin. Microbiol. Rev. 2018, 31, 1-13. Greening, C.; Ahmed, F. H.; Mohamed, A. E.; Lee, B. M.; Pandey, G.; Warden, A. C.; Scott, C.; Oakeshott, J. G.; Taylor, M. C.; Jackson, C. J. Physiology, Biochemistry, and Applications of F420- and Fo-Dependent Redox Reactions. Microbiol Mol Biol Rev 2016, 80, 451–493. Spry, C.; Kirk, K.; Saliba, K. J. Coenzyme A Biosynthesis: An Antimicrobial Drug Target. FEMS Microbiol. Rev. 2008, 32, 56–106. Buckstein, M. H.; He, J.; Rubin, H. Characterization of Nucleotide Pools as a Function of Physiological State in Escherichia Coli. J. Bacteriol. 2008, 190, 718–726. Conlon, B. P.; Rowe, S. E.; Gandt, A. B.; Nuxoll, A. S.; Donegan, N. P.; Zalis, E. A.; Clair, G.; Adkins, J. N.; Cheung, A. L.; Lewis, K. Persister Formation in Staphylococcus Aureus Is Associated with ATP Depletion. Nat. Microbiol. 2016, 1, 16051. Pettersen, E. F.; Goddard, T. D.; Huang, C. C.; Couch, G. S.; Greenblatt, D. M.; Meng, E. C.; Ferrin, T. E. UCSF Chimera--a Visualization System for Exploratory Research and Analysis. J. Comput. Chem. 2004, 25, 1605–1612.


Page 17 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Scheme 1. Reaction scheme of the DTBS catalyzed conversion of 7,8-diaminopelargonic acid (DAPA) to dethiobiotin using carbon dioxide and a nucleoside triphosphate10,11.


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 31

Figures and Tables Figure 1. Cartoon representation of the MtDTBS. Superimposition of MtDTBS in complex with CTP (yellow; Chain A from PDB: 4WOP13) and DAPAcarbamate (black; Chain B from PDB: 3FMF8). The structure consists of α-helices (light blue), β-sheets (green) and interlinking coils (grey). The phosphate binding loop (Val13-Thr17, magenta) is highlighted. (Inset) Hydrogen bonding interactions between the cytosine moiety of CTP and MtDTBS are shown (dashed yellow lines). Interaction distances shown as a range from all ligand-bound active sites. Figure 2. SPR sensorgrams for select NTPs binding to MtDTBS. (A) CTP exhibits curved sensorgrams, in particular a long dissociation phase, indicative of high affinity binding (sensorgram pertains to data in replicate 2 in Table S2). (B) UTP (Table S1, replicate 3), (C) TTP (Table S1, replicate 2) and (D) ATP (Table S1, replicate 2) binding curves that had much faster association and dissociation phases. Each of these NTPs had lower affinity. Figure 3. Crystallographic data for the high affinity binding mode. The crystal structures of MtDTBS in complex with CTN (A), CDP (B) and CTP-DAPA-Carbamate (C) are shown (cytidine series ligands in yellow) along with amino acids required for nucleotide binding (grey sticks). The MtDTBS surface (light blue) and P-loop (salmon) are shown to demonstrate the solvent exposed nucleotide binding pocket. A magnesium ion (green sphere) binds via the polyphosphates of CDP and CTP. Electron density is shown at polder 3σ (grey mesh) and polder 10σ (cyan mesh). Interaction distances shown as a range from all ligand-bound active sites (yellow dashed lines). (C) DAPA carbamate (black) is positioned such that the catalytic carbamate oxygen is adjacent to the gamma phosphate of CTP. Figure 4. B-factor analysis Comparison of B-factors for each heavy atom in CTP (A) and UTP (B). Data are presented as floating bars, showing minimum to maximum values measured for each ligand in the four separate subunits of crystallized MtDTBS. Figure 5. The P-loop is required for phosphate binding. A. Hydrogen bonding interactions between MtDTBS and the triphosphate moiety of CTP are shown. The cytidine moiety is represented as yellow lines and the triphosphate moiety as red (phosphorous) and orange (oxygen) sticks. Interactions to water molecules are not depicted. B. Co-ordinated binding of a single magnesium ion (green sphere). Figure 6. Crystallographic data for the promiscuous binding mode. The crystal structures of MtDTBS in complex with ATP (A, light green), ITP (B, grey) TTP (C, magenta) and UTP (D, dark green). The MtDTBS surface (light blue) and P-loop (salmon) are shown. MtDTBS is represented as a monomer to increase the clarity of interpretation. A magnesium ion (green sphere) is observed in all structures. Polder electron density is shown at either the 3σ contour level (grey), 6σ for ATP (cyan) or 10σ for ITP, TTP and UTP (cyan). Figure 7. Molecular simulation of ligand binding. Ensemble refinement (PHENIX) of MtDTBS in complex with CTP (A) and ATP (B). Calculated binding poses were overlaid from each ensemble refinement model to demonstrate predicted binding modes. Figure 8. Comparison of the DTBS nucleoside binding site from multiple species. Electrostatic surface models of DTBS were generated using PDB2PQR and APBS (UCSF Chimera39). The blue to red colouring represents positively to negatively charged protein surface. (A) MtDTBS dimer bound to CTP (yellow sticks) (PDB ID: 6CVE). The MtDTBS P-loop and surrounding region is highly positively charged. The small, hydrophobic Ala201 does not hydrogen bond to the CTP ribose. This, along with Gly12 within the P-loop may allow for conformational flexibility of nucleosides. (B) EcDTBS monomer bound to ATP (green sticks)


Page 19 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

(PDB ID: 1A8211). The EcDTBS active site is generally more electronegative than other DTBS. The ATP base binds to Asn175, a residue that is present in other DTBS but has no structural equivalent in MtDTBS. The Glu211 side chain hydrogen bonds to the ribose of ATP providing conformational rigidity to this ligand. The large and negatively charged Glu12 encloses the triphosphate tail more than the Gly12 of MtDTBS. (C) HpDTBS monomer bound to ATP (green sticks) (PDB ID: 3QXC14). The nucleoside binding site is more open, with no structural equivalence to the MtDTBS Ala201 or the EcDTBS Glu211. The P-loop of HpDTBS carries a similar positive charge to MtDTBS. Asn175 hydrogen bonds to the ATP base, and a large Asn10 encloses over the triphosphate tail. (D) Apo FtDTBS dimer (PDB ID: 3OF5) possesses Asn174 in the same position to Asn175 from Ec and Hp DTBS. Similarly, a Glu12 is present in the P-loop.


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 31

Table 1. Affinity (KD), association (ka) and dissociation (kd) constants determined by SPR binding assay. Chemical structures of nucleosides and nucleoside polyphosphates are shown. Data are the means of experiments performed in triplicate ± standard error of the mean (SEM). N/D: not determined.

KD (µM)

ka 5 (×10 M-1s-1)

kd (×10-2 s-1)

Replicates

Cytidine triphosphate

0.16 ± 0.01

3.2 ± 0.3

5.3 ± 0.4

5

Cytidine diphosphate

0.45 ± 0.05

3.4 ± 0.3

15.0 ± 0.8

4

Cytidine monophosphate

>1,000

N/D

N/D

3

Thymidine triphosphate

16.5 ± 0.7

N/D

N/D

3

Uridine triphosphate

47 ± 1

N/D

N/D

3

Guanosine triphosphate

48 ± 5

N/D

N/D

3

Adenosine triphosphate

75 ± 3

N/D

N/D

3

Adenosine diphosphate

17.9 ± 0.5

N/D

N/D

3

Adenosine monophosphate

>1,000

N/D

N/D

3

Structure


Page 21 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Inosine triphosphate

ACS Catalysis

93 ± 8

N/D

N/D

3


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Cartoon representation of the MtDTBS. Superimposition of MtDTBS in complex with CTP (yellow; Chain A from PDB: 4WOP13) and DAPA-carbamate (black; Chain B from PDB: 3FMF8). The structure consists of α-helices (light blue), β-sheets (green) and interlinking coils (grey). The phosphate binding loop (Val13Thr17, magenta) is highlighted. (Inset) Hydrogen bonding interactions between the cytosine moiety of CTP and MtDTBS are shown (dashed yellow lines). Interaction distances shown as a range from all ligand-bound active sites. 200x94mm (300 x 300 DPI)

ACS Paragon Plus Environment

Page 22 of 31

Page 23 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 2. SPR sensorgrams for select NTPs binding to MtDTBS. (A) CTP exhibits curved sensorgrams, in particular a long dissociation phase, indicative of high affinity binding (sensorgram pertains to data in replicate 2 in Table S2). (B) UTP (Table S1, replicate 3), (C) TTP (Table S1, replicate 2) and (D) ATP (Table S1, replicate 2) binding curves that had much faster association and dissociation phases. Each of these NTPs had lower affinity. 101x70mm (300 x 300 DPI)


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 3. Crystallographic data for the high affinity binding mode. The crystal structures of MtDTBS in complex with CTN (A), CDP (B) and CTP-DAPA-Carbamate (C) are shown (cytidine series ligands in yellow) along with amino acids required for nucleotide binding (grey sticks). The MtDTBS surface (light blue) and P-loop (salmon) are shown to demonstrate the solvent exposed nucleotide binding pocket. A magnesium ion (green sphere) binds via the polyphosphates of CDP and CTP. Electron density is shown at polder 3σ (grey mesh) and polder 10σ (cyan mesh). Interaction distances shown as a range from all ligand-bound active sites (yellow dashed lines). (C) DAPA carbamate (black) is positioned such that the catalytic carbamate oxygen is adjacent to the gamma phosphate of CTP. 199x199mm (300 x 300 DPI)


Page 24 of 31

Page 25 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 4. B-factor analysis Comparison of B-factors for each heavy atom in CTP (A) and UTP (B). Data are presented as floating bars, showing minimum to maximum values measured for each ligand in the four separate subunits of crystallized MtDTBS. 149x70mm (300 x 300 DPI)


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. The P-loop is required for phosphate binding. A. Hydrogen bonding interactions between MtDTBS and the triphosphate moiety of CTP are shown. The cytidine moiety is represented as yellow lines and the triphosphate moiety as red (phosphorous) and orange (oxygen) sticks. Interactions to water molecules are not depicted. B. Co-ordinated binding of a single magnesium ion (green sphere). 49x24mm (300 x 300 DPI)


Page 26 of 31

Page 27 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 6. Crystallographic data for the promiscuous binding mode. The crystal structures of MtDTBS in complex with ATP (A, light green), ITP (B, grey) TTP (C, magenta) and UTP (D, dark green). The MtDTBS surface (light blue) and P-loop (salmon) are shown. MtDTBS is represented as a monomer to increase the clarity of interpretation. A magnesium ion (green sphere) is observed in all structures. Polder electron density is shown at either the 3σ contour level (grey), 6σ for ATP (cyan) or 10σ for ITP, TTP and UTP (cyan). 199x199mm (300 x 300 DPI)


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 7. Molecular simulation of ligand binding. Ensemble refinement (PHENIX) of MtDTBS in complex with CTP (A) and ATP (B). Calculated binding poses were overlaid from each ensemble refinement model to demonstrate predicted binding modes. 199x61mm (300 x 300 DPI)


Page 28 of 31

Page 29 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

Figure 8. Comparison of the DTBS nucleoside binding site from multiple species.Electrostatic surface models of DTBS were generated using PDB2PQR and APBS (UCSF Chimera39). The blue to red colouring represents positively to negatively charged protein surface. (A) MtDTBS dimer bound to CTP (yellow sticks) (PDB ID: 6CVE). The MtDTBS P-loop and surrounding region is highly positively charged. The small, hydrophobic Ala201 does not hydrogen bond to the CTP ribose. This, along with Gly12 within the P-loop may allow for conformational flexibility of nucleosides. (B) EcDTBS monomer bound to ATP (green sticks) (PDB ID: 1A8211). The EcDTBS active site is generally more electronegative than other DTBS. The ATP base binds to Asn175, a residue that is present in other DTBS but has no structural equivalent in MtDTBS. The Glu211 side chain hydrogen bonds to the ribose of ATP providing conformational rigidity to this ligand. The large and negatively charged Glu12 encloses the triphosphate tail more than the Gly12 of MtDTBS. (C) HpDTBS monomer bound to ATP (green sticks) (PDB ID: 3QXC14). The nucleoside binding site is more open, with no structural equivalence to the MtDTBS Ala201 or the EcDTBS Glu211. The P-loop of HpDTBS carries a similar positive charge to MtDTBS. Asn175 hydrogen bonds to the ATP base, and a large Asn10 encloses over the triphosphate tail. (D) Apo FtDTBS dimer (PDB ID: 3OF5) possesses Asn174 in the same position to Asn175 from Ec and Hp DTBS. Similarly, a Glu12 is present in the P-loop. 126x80mm (300 x 300 DPI)


ACS Catalysis 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Reaction scheme of the DTBS catalyzed conversion of 7,8-diaminopelargonic acid (DAPA) to dethiobiotin using carbon dioxide and a nucleoside triphosphate. 10,11 158x78mm (300 x 300 DPI)


Page 30 of 31

Page 31 of 31 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Catalysis

82x44mm (300 x 300 DPI)


Mycobacterium tuberculosis Dethiobiotin ... - ACS Publications

Recommend Documents