Nanoparticle Counting by Microscopic Digital ... - ACS Publications

Subscriber access provided by Kaohsiung Medical University

Article

Nanoparticle Counting by Microscopic Digital Detection: Selective Quantitative Analysis of Exosomes via Surface-Anchored Nucleic Acid Amplification Qingchang Tian, Chuanjiang He, Guowu Liu, Yueqi Zhao, Lanlan Hui, Ying Mu, Ruikang Tang, Yan Luo, Shu Zheng, and Ben Wang Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b00189 • Publication Date (Web): 01 May 2018 Downloaded from http://pubs.acs.org on May 1, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Nanoparticle Counting by Microscopic Digital Detection: Selective Quantitative Analysis of Exosomes via Surface-Anchored Nucleic Acid Amplification Qingchang Tian,§,† Chuanjiang He,§,† Guowu Liu,§,† Yueqi Zhao,¶ Lanlan Hui,§,† Ying Mu,‡ Ruikang Tang,¶ Yan Luo,# Shu Zheng,§ Ben Wang*,§,† §

Cancer Institute (Key Laboratory of Cancer Prevention and Intervention, National Ministry of Education & Key Laboratory of Molecular Biology in Medical Sciences, Zhejiang Province), The Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, 310009 China † Institute of Translational Medicine, School of Medicine, Zhejiang University, Hangzhou, 310029 China # College of Biomedical Sciences, School of Medicine, Zhejiang University, Hangzhou, 310058 China ‡ Research Center for Analytical Instrumentation, Institute of CyberSystems and Control, State Key Laboratory of Industrial Control Technology, Zhejiang University, Hangzhou, 310027 China ¶ Center for Biomaterials and Biopathways & Department of Chemistry, Zhejiang University, Hangzhou, 310027 China ABSTRACT: Exosomes are nanosized vesicles with a lipid bilayer membrane secreted by cells with protein and nucleic acid contents. Here, we present the first method for the selective and quantitative analysis of exosomes by digital detection integrated with nucleic acid-based amplification in a microchip. An external biocompatible anchor molecule conjugated with DNA oligonucleotides was anchored in the lipid bilayer membrane of exosomes via surface self-assembly for total exosome analysis. Then, specific antibody-DNA conjugates were applied to label selective exosomes among the total exosomes. The DNA-anchored exosomes were distributed into microchip chambers with one or fewer exosomes per chamber. The signal from the DNA on the exosomes was amplified by a rapid isothermal nucleic acid detection assay. A chamber with an exosome exhibited a positive signal and was recorded as “1”, while a chamber without an exosome presented a negative signal and was recorded as “0”. The “10100101” digital signals give the number of positive chambers. According to the Poisson distribution, the exosome stock concentration was calculated by the observed fraction of positive chambers. The findings showed that nanoscale particles can be digitally detected via DNA-mediated signal amplification in a microchip with simple microscopic settings. This approach can be integrated with multiple types of established nucleic acid assays and provides a versatile platform for the quantitative detection of various nanosomes, from extracellular vesicles such as exosomes and enveloped viruses to inorganic and organic nanoparticles, and it is expected to have broad applications in basic research areas as well as disease diagnosis and therapy.

Exosomes are nanosized (30-100 nm) extracellular vesicles with a lipid bilayer membrane exterior and proteins and nucleic acids in the interior.1,2 Exosomes are secreted by almost all cell types, and they exist in cell culture supernatants, urine, blood, cerebrospinal fluid and other body fluids.3 Exosomes transport messages from original cells to target cells either locally or remotely and are involved in both physiological and pathological processes, including the formation of metastatic niches and organotropic metastases.4-7 Recent reports have revealed that exosomes are a promising plasma biomarker for cancer diagnosis8-11 and a versatile drug delivery toolbox for cancer therapy.8,12 A method for the separation and quantitative analysis of exosomes is desired for biomedical research and related disease diagnosis. Antibody-based isolation and exosome labeling methods were achieved by capturing the exosomes on the surface of microscale objects, such as on microfluidics chips or microbeads.9,13,14 This method is convenient for separating labeled exosomes with superfluous antibodies. However, this approach is limited to the analysis of labeled

exosomes in a free state. Determining the vesicle concentration via either the quantification of biomolecules within a vesicle sample or the direct quantification of the number of particles present in the sample (given as a mass or number) is possible.15 For example, exosomes can be relatively quantified by the amount of specific biomolecules they contain using assays such as ELISA,16 or they are very generally determined using a lipophilic dye.17 Currently, vesicles with sizes below a few hundred nanometers remain difficult to detect by conventional flow cytometry. Nanosight-led nanoparticle tracking analysis has grown in popularity, particularly for exosome quantification, but this approach may be difficult to apply for distinguishing exosomes from other types of particles, particularly from protein aggregates.15 Furthermore, the detection sensitivity is limited to diameters larger than approximately 50-70 nm,18 which may leave out smaller exosomes and particles. Digital detection (such as digital PCR) enables the analysis of extremely dilute nucleic acids and has thus been used for the absolute quantification of rare nucleic acids found in cancer and other diseases. Most positive amplifications reflect the

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

signal from a single molecule of template,19-22 a fact that inspired us to quantitatively analyze exosomes using a digital method by randomly dividing the exosomes into the thousands of chambers contained in a microchip. This physical random partitioning enables directly counting of the number of individual exosomes per chamber at the reaction endpoint. Because the lipid bilayer membrane of exosomes originates from the cell membrane, the membrane properties of exosomes and cells are similar. A lipid-nanoprobe system that enables the spontaneous labeling of extracellular vesicle membranes has been used for subsequent magnetic enrichment,13 and a specific aptamer-based molecular recognition of exosome surface markers and in situ DNA assemblies has been developed for exosome modification and functionalization;23 however, the exosomes are confined on the surface of bulky solid particles in these methods, making single exosome analysis difficult. Recently, exosomes were anchored through bivalent-cholesterol-labeled DNA and detected with an enzymatic product change via horseradish peroxidase;24 however, a standard curve is needed for quantification, and such a color change in a large volume may result in error. Herein, we report a surface self-assembly based labeling approach for single exosomes that specifically anchors DNA oligonucleotides on the exosome membrane via conjugation with a biocompatible anchor molecule (BAM). In vitro anchoring of hydrophilic macromolecular compounds, such as oligonucleotides, to cell surfaces or lipid membranes can also be achieved by chemical conjugation.25,26 Enzymes and other proteins can be anchored to the cell membrane by conjugation with BAMs, such as single or double oleyl chains derivatively coupled with poly(ethylene glycol) (PEG), which enables self-assembly and insertion into the cell membrane.27-29 Thus, it is possible to anchor BAM-DNA to the single exosome membrane for further analysis via the amplification of BAM-DNA. Quantitative analysis of the nanoscale exosome amount and digital detection at a single particle level are conveniently achieved using a microscale setting with thousands of dimensional magnifications by integration with platforms for well-established nucleic acid assays, such as rapid isothermal nucleic acid detection assay (RIDA)30 and digital PCR, among others. To the best of our knowledge, this is the first report to achieve precise, digital detection of the total amount or a selective amount of nanosomes at the single particle level. Experimental Section Synthesis of biocompatible, anchor-molecule-conjugated DNA oligonucleotides (BAM-DNA) All of the DNAs in this study (Table 1) were synthesized using a synthesizer (Sangon, Shanghai, China). The BAM (2 kDa) used in this study is poly(ethylene glycol) oleyl ether, which is succinylated at the hydroxyl end of the poly(ethylene glycol) (PEG) and modified with N-hydroxysuccinimide (NHS) at the succinyl PEG end. The BAM-NHS is amino-reactive and can be conjugated with amino-modified DNA (12.2 kDa). A 10 mM BAM-NHS solution (2.5 µL) in DMSO was mixed with 22.5 µL of PBS and added in to 10 OD of DNA powder to prepare a 1 mM solution that was

incubated for 2 h at room temperature to form the BAM-DNA (14.2 kDa). Synthesis of DNA-antibody conjugates Biotinylated human glypican-1 (GPC-1) antibody (BAF4519, R&D Systems, MN) and biotinylated DNA (DNA2 in Table 1) were conjugated together with streptavidin. One streptavidin molecule could bind four biotin molecules, which could bind one GPC-1 biotinylated antibody and three biotinylated DNAs strands together. First, 20 µL of GPC-1 antibody (10 µg/mL, approximately 0.06 nM) and 2 µL of DNA2 (10 µM) were mixed together. Then, 3 µL of streptavidin (100 µg/mL, approximately 1.6 µM) was added into the mixture and incubated for 30 min. Cell culture The HeLa and Panc-1 cell lines were cultured in 1640 medium with 10% FBS at 37°C for 24 h. Isolation of exosomes Urine samples (200 mL) were harvested from healthy subjects. All the urine samples were processed within 5 hours of collection. All samples were preliminarily purified by centrifugation for 10 min at 300 × g and 4°C. The resulting supernatant was centrifuged at 2,000 × g at 4°C for 10 min. Then, the cell debris and microvesicles (MVs) were removed by centrifugation for 30 minutes at 10,000 × g and 4°C. The pellets were discarded, and the supernatant was then centrifuged at 100,000 × g and 4°C for 70 min in a Type 70 Ti Rotor to precipitate the extracellular vesicles (EVs). The pellet in each tube was resuspended in 20 mL of PBS after the supernatant was carefully removed. The reducing agent dithiothreitol (DTT) was add at 30-50 mM/L to prevent the aggregation of the Tamm-Horsfall protein (also referred to as uromodulin). Then, the EVs were washed by centrifugation for 70 min at 100,000 × g and 4ºC. The supernatant was removed as completely as possible. A small volume (100 to 500 µL) of PBS was added and the pellet was resuspended. All the isolated EVs were stored at −80°C until further use. The supernatant (200 mL) from the Panc-1 cell line was harvested, and the exosomes were isolated as above (without DTT). In this section, 200 µL of Dynabeads Oligo (dT)25 (61011, Thermo Fisher Scientific) were used to isolate BAM-DNA-labeled exosomes via an adapter with a restriction enzyme recognition site (Table 2). The isolated exosomes were released into the solution by cleaving the adapter using the enzyme Hin dIII. Rapid isothermal nucleic acid detection assay The non-fluorescent probes (8.2 kDa) (Table 2) were labeled with a fluorescein isothiocyanate isomer (FITC) and 6-Carboxy-X-Rhodamine (ROX) fluorophores at one end and with a black hole quencher (BHQ) at the other end. At 55°C, the probe hybridized with the DNA and formed the N.BstNBI recognition site. Then, the probe was nicked into 2 shorter fragments with melting temperatures (Tm) of 17.2 and 29.7°C (calculated by Primer Premier), respectively. At 55°C, the two shorter fragments were separated from the target DNA, and


Page 2 of 9

Page 3 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry another probe was bound to the target DNA, which was once again nicked into 2 shorter fragments again. As the probes were continually nicked by N.BstNBI, the fluorescent light signal was amplified. Labeled exosomes were mixed with the RIDA reaction solution in 0.2 mL PCR tubes and incubated at 55°C for 90 min. As the RIDA reaction proceeded, the fluorescent signal was amplified and could be detected in real time by a fluorescence reader (ABI ViiA 7 real-time PCR system, ThermoFisher Scientific). Exosomes labeling with the synthesized BAM-DNA The exosomes were labeled with the synthesized BAM-DNA (200 µM) by incubating BAM-DNA with exosomes at 37°C for 30 min. The BAM-DNA/exosome ratio is based on the following hypothesis. If one liter (106 mm3) of exosome solution is filled by exosomes (mean diameter, 100 nm) without water and packaged one by one, the number of exosomes in one liter can be represented as follows: 1 L volume of single exosome =

1,000,000 4 × × 50 × 10 3 =

1,000,000 4 × × 125 × 10 3 =

10! 4 × 3.14 × 125 3

= 1.91 ×1018 This number is approximately 3.15 micromoles of BAM-DNA in a one-liter solution. In other words, 3.15 µM BAM-DNA is enough for exosome labeling with a 1:1 labeling state. If the exosome diameter is set as 30 nm in this calculation, the according BAM-DNA concentration is 116 µM, which is enough for exosome labeling with a 1:1 labeling state. In a realistic case, the exosome concentration in solution is not as high; thus, 200 µM BAM-DNA is a large excess and enough to make sure that there is at least a BAM-DNA chain per EVs. Then, the labeled exosomes were washed 5 times to remove the superfluous BAM-DNA by filtration. An ultrafiltration unit (UFN, 100 kDa) (Millipore UFC510096, Merck) was applied to separate the labeled exosomes from the superfluous BAM-DNA. The exosomes were concentrated with a UFN membrane, and the BAM-DNA and/or the hybridized DNA probe-FITC (6.7 kDa), which are smaller molecules, were removed by filtration. The synthesized BAM-DNA was tested for its ability to label exosomes. BAM-DNA was incubated and then purified, and the labeled exosomes were adsorbed onto the polystyrene (PS) beads (diameter, 13 µm) in advance for 30 min. Before the exosomes were absorbed on the surface of the PS beads, 200 µM of BAM-DNA and the hybridized DNA probe-FITC were

added and incubated at 37°C for 30 min. Then, the labeled exosomes were purified with a 100 kDa UFN and absorbed onto the PS beads. A flow cytometry experiment further showed the binding efficiency of the BAM-DNA to the exosomes and the cell membrane. Fabrication of the microchip and sample loading The microfluidics chips were composed of polydimethylsiloxane (PDMS), and the sample solution was loaded by negative pressure, as shown in a previous work.31 The chip mold, composed a photoresist (SU-8, MicroChem Corp., MA), was 100 µm high, and each chip chamber was 50 × 50 µm2. The volume of each chamber was 2.5 × 10-4 µL, and the number of total chambers was 20,000. Therefore, each chip could accommodate 5 µL of solution. Poisson distribution According to the Poisson distribution, [Eq. (1)] P%, λ = '( ) * /%! the probability that a chamber in the microchip contains at least one exosome is [Eq. (2)] P% > 0, λ = 1 − P% = 0, λ = 1 − ) / . Here, λ is the average number of exosomes of per chamber; thus, [Eq. (3)] λ = 01 ⋅ 3456 ⋅ 7, where c0⋅xdil is the diluted concentration, and v is the chamber volume. When a chamber showed a positive signal, it contained one or more exosomes. Therefore, the observed fraction of positive chambers is [Eq. (4)] 81 % > 0, ' = 1 − ) 9: ⋅; ⋅? , which can be translated to [Eq. (5)] ln1 − 81 = −01 ∙ 3456 ∙ 7. The regression curve equation that relates ln1 − 81 and the dilution factor xdil exhibits a linear variation relationship. GPC-1(+) exosome isolation and detection The total exosomes from the PANC-1 cell line supernatant were isolated via ultracentrifugation, labeled with BAM-DNA and purified with UFN as described before. DNA-conjugated glypican-1 antibody (25 µL) was added to 10 µL of BAM-DNA-labeled exosomes and incubated for 30 min. At the same time, 200 µL of Dynabeads Oligo (dT)25 (61011, ThermoFisher) beads and 5 µL of two kinds of adapters were mixed together for 5 min to attach the adapters onto the beads. Then, the beads were collected and washed three times before the supernatant was discarded. The antibody-labeled exosomes were mixed with the adapter-containing beads for 5 min, separated by a magnet and washed for five times to obtain clean exosomes. Finally, the exosomes on the beads were released into the solution by cutting the adapter with the enzyme Hind III. Double-labeled exosomes were detected by RIDA and were mixed with the RIDA solution to enter the microchip chambers to proceed with the digital isothermal exosome detection assay (RIEDA). Results and Discussion



We applied lipid-like self-assembly to anchor DNA oligonucleotides to the exosome membrane through BAMs (Scheme 1a). The BAMs are a series of poly(ethylene glycol) oleyl ether28 molecules with one or two arms that can be inserted into the lipid bilayer membrane, leaving the other active end to combine with DNA; a BAM with one arm was used in this study (Figure 1a). There was no selectivity, and no harsh reaction conditions were required for the BAM-DNA to anchor to the surface of the exosomes. Superfluous BAM-DNA was removed with a 100 kDa UFN (Scheme 1b).

Scheme 1. Schematic diagram of the digital detection of BAM-DNA-anchored exosomes at the single nanoparticle level reliant on nucleic acid-based amplification. (a) Synthetic BAM-DNA was inserted into the exosome membrane by self-assembly, and the anchored DNA was available on the exosome surface. (b) Purification of labeled exosomes; superfluous BAM-DNA was filtered out with a UFN. (c) Less than one BAM-DNA-labeled total exosomes were distributed into a microchip chamber according to the Poisson distribution. The chambers with an exosome presented a positive signal “1” (red), while the chambers without an exosome showed a negative signal “0”. The chambers with a specific antibody-DNA-labeled exosome presented a yellow signal (merged from red and green). Once DNA was anchored to the exosome surface, the exosomes were detected using DNA-based techniques. To quantitatively analyze the exosomes, we applied a digital detection method similar to digital PCR. In general, DNA-labeled exosomes at a low concentration were randomly distributed into the microchip chambers to ensure that no more than one exosome was present per chamber; then, the nanoscale signals from the exosomes were amplified to a microscale digital fluorescence point with thousands of dimensional magnifications via DNA-based reactions. A chamber with an exosome presented a positive fluorescence signal and was recorded as “1”. A chamber without an exosome presented a negative signal and was recorded as “0”. The microscale “10100101” digital signals denote the number of exosomes based on the Poisson distribution (Scheme 1c). BAM-DNA-labeled total exosomes were re-labeled by

antibody-DNA to show a dual signal in the positive chambers for selective exosome detection according to the required types (Scheme 1c).

Figure 1. Exosomes were isolated, and the lipid bilayers were successfully labeled with BAM-DNA. (a) BAM with the NHS end group is carboxyl-reactive and can be conjugated with amino-modified DNA. (b) Isolated exosomes were identified by transmission electron microscopy. (c) Cell lipid bilayers were labeled with a BAM-DNA probe to exhibit fluorescence. (d) Flow cytometry results of the labeled cells. (e) Exosomes were labeled with PKH26 (red fluorescent cell linker, Sigma) and BAM-DNA (FITC, green) and merged in yellow, as identified by structured illumination microscopy (Nikon, Japan). Scale bar in (b) is 200 nm; in (c) is 20 µm, and in (e) is 500 nm.

BAM-DNA was synthesized with two components, BAM and DNA, via amine-carboxylate conjugation chemistry (Figure 1a). The synthesized BAM-DNA (200 µM) was first tested on a cell membrane by incubating BAM-DNA and HeLa cells at 37°C for 30 min. The labeled cells were centrifuged and washed 3 times to remove the superfluous BAM-DNA. Then, the cells were soaked in a solution containing a 5-carboxyfluorescein (FAM) probe that could hybridize to the BAM-DNA. It was shown that fluorescence attributed to the presence of BAM-DNA was detected on individual cells (Figure 1c). Flow cytometry experiment results further visualized the binding efficiency between BAM-DNA and the cells (Figure 1d) and demonstrated excellent binding efficiency. These results clearly demonstrated that the synthesized BAM-DNA could anchor into the lipid bilayer membrane. Exosomes were isolated via ultracentrifugation and identified with electron microscopy (Figure 1b). Exosomes were labeled by BAM-DNA and the superfluous BAM-DNA was removed with a UFN. For the dimensions of the cells, antibodies were used to recognize the cell antigen, and the superfluous antibodies were removed by centrifuging the cells. Antibodies are also a suitable marker for exosomes, but the dimensions of the exosomes and antibodies are both at the nanoscale level; thus, there is no simple method to separate the exosomes and


Page 4 of 9

Page 5 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry the superfluous antibodies in a free state. In this study, we labeled exosomes with BAM-DNA, which has a molecular weight of approximately 10 kDa, and a 100 kDa UFN was applied to separate the labeled exosomes from the smaller molecules, such as superfluous BAM-DNA. The exosomes were concentrated by the UFN membrane, and BAM-DNA and/or probe-FITC were transferred into the filtrate by filtration (Figure S2a). No fluorescence signal indicates that the labeled exosomes are thoroughly washed without any BAM-DNA remaining and ready for the next detection (Figures 2a and b). The exosomes labeled by BAM-DNA and probe-FITC, which is a FITC-conjugated hybridized DNA chain, were adsorbed onto PS beads in advance. As shown in Figure S2a, fluorescence was detected in tubes in which the exosomes were labeled with BAM-DNA and probe-FITC, while fluorescence was not detected in the filtrate and in tubes No. 1 and 3, which contained exosomes labeled with DNA and FITC only. The fluorescence attributed to the presence of BAM-DNA was detected on the PS beads (Figure S2c). In contrast, the fluorescence was not detected on the surface of the PS beads that were not treated with the BAM-DNA solution (Figure S2d). These results clearly demonstrated that the synthesized BAM-DNA could be anchored to the exosome membrane. A flow cytometry experiment further visualized the binding efficiency of BAM-DNA to the exosomes (Figure S2b). The confocal images of fluorescent exosomes clearly show BAM-DNA anchorage to the exosome membranes, demonstrating that BAM-DNA has excellent binding affinity to the exosomes (Figure 1e). Combining all this evidence, it is clearly shown that BAM-DNA has excellent anchoring affinity for the exosomes, is anchored on the exosome surface and that superfluous BAM-DNA is removed with the UFN, which prepared the samples for the subsequent digital detection. Once the exosomes are labeled with DNA, they can be easily detected at the microscale setting with thousands of dimensional magnifications through DNA-based reactions and signal amplification technologies. In this paper, the RIDA method (Table 2) consisted of a probe, N.BstNBI, and buffer that was applied to detect the DNA on the surface of the labeled exosomes. RIDA is a “probe amplification” assay that uses the single strand’s nicking activity from restriction endonucleases to repeatedly cleave synthetic probes hybridized to the same target sequences. As the probes are continually cleaved by the N.BstNBI, the fluorescent signal is accordingly amplified (Figure S1 and Table 1). The results showed that the labeled exosomes were detected by the RIDA reaction, and the DNA was not detected in the filtrate alone (Figures 2a and b). After exosomes were labeled with BAM-DNA, single exosomes were distributed into the chambers of a microchip, and the DNA on the exosomes was detected by DNA-based reactions. A positive signal was presented by a chamber containing an exosome; thus, the number of exosomes could be calculated from the number of positive chambers. A series of dilutions of exosomes was mixed with the RIDA reaction solution. The progression of the RIDA reactions in each tube was monitored using a real-time fluorescence reader. The fluorescence intensity corresponded to the number of

exosomes in the reaction (Figure 2c). As an indication of the reaction specificity, exosomes without BAM-DNA exhibited no signal. These results suggested that RIDA could specifically detect the BAM-DNA sequence anchored to the exosome membrane and could be considered a digital RIEDA. Digital RIEDA operates via a principle similar to digital PCR, in which less than one exosome is distributed in one microchip chamber.

Figure 2. DNA-anchored exosomes were rinsed and determined quantitatively via RIDA-based signal amplification at a microscopic setting. (a and b) Fluorescent and relatively quantitative RIDA results for labeled exosomes (3), the filtrate (2) and the double-distilled water control (1). (c) Quantitative counting of four diluted exosome concentrations by digital detection in the microchip at the single particle level. (d) The exosome concentration detected by digital RIEDA compared to the results by Nanosight tracking analysis (NTA) (p < 0.05).

Exosomes were labeled with BAM-DNA, mixed with RIDA solution and allowed to enter the microchip chambers via negative pressure as shown in our previous work.31 The exosome distribution among the chambers was random; therefore, it can be regarded as a statistical process following a Poisson distribution. The DNA anchored on the labeled exosomes in independent chambers amplified the fluorescent signal by RIDA with thousands of dimensional magnifications and revealed the positive microscale chambers. According to the Poisson distribution, the exosome stock concentration could be determined by the observed fraction of positive chambers via the successful reactions in each chamber. To quantify the exosome concentration, the exosome solution was prepared at 4 orders of magnitude (Table S2). The 25 µL pre-mixed RIDA solution contained 5 µL of a diluted exosome solution. The digital RIEDA results demonstrated the robustness of the technique (R2 = 0.993) (Figure 2d). The raw statistical data are included in the Supporting Information (Table S2). The exosome stock concentration was determined from a linear regression fit, yielding a stock concentration, c0, of (1.2223 ± 0.2215) × 108 particles/mL. The exosomes were also detected with the NTA system (NanoSight NS300, Malvern) (Figure S3c and Table S3). The exosome concentration detected by digital RIEDA compared to the NTA result is a little different (p < 0.05) (Figure 2d). These are two different methods for exosomes detection, but digital detection with fluorescence light amplification may be more



accurate than the scattered light associated with NTA. Digital RIEDA is suited for multiple exosome concentration detection and especially for rare samples, such as tumor-associated exosomes, while the detection limitation of NTA is approximately 106-109 particles/mL, and the detection sensitivity is limited to the ones with diameters larger than approximately 50-70 nm; therefore, in this case, the smaller ones are left out of the quantitative analysis.18 Furthermore, the new method could convert the quantitative analysis of exosomes to nucleic acid quantification with a molecular biology platform, which could solve the difficulty of exosome quantitative determination without expensive equipment, such as NTA. The identification of specific exosomes among the total exosomes was more helpful for cancer detection; for example, GPC-1-circulating exosomes have been used to detect early pancreatic cancer.32 In this paper, DNA-conjugated anti-glypican-1 antibody was applied to label GPC-1(+) exosomes. The total exosomes from the PANC-1 cell line supernatant were isolated via ultracentrifugation, labeled with BAM-DNA and purified with a UFN as described before. Then, the exosomes were re-labeled with DNA-antibody conjugates. As shown in Figure 3a, after the GPC-1(+) exosomes were labeled with the DNA-antibody conjugates, the total exosomes were magnetically separated to remove the superfluous DNA-antibody conjugates. Doubly labeled exosomes were detected by RIDA (Figures 3b and c) and were mixed with the RIDA solution to enter the microchip chambers and proceed with the digital RIEDA (Figures 3d and e). Dynabeads Oligo (dT)25 beads were added to the exosomes solution, and total exosomes can be captured by the Dynabeads; thus, the C0 of the total exosomes in Figure 3d may be calculated based on the presented number of the exosomes in the microchip and the loading quantity of sample volume when the total exosome are captured by beads. These results suggested that specific exosomes could be selectively and digitally detected through double-labeling, magnetic separation and enzyme-mediated recovery.

Page 6 of 9

Conclusions In summary, surface self-assembly on a lipid bilayer was applied to anchor DNA oligonucleotides to the exosome membrane by conjugation with BAMs. After the DNA was successfully bound to the exosome surface, nanoscale exosomes could be digitally detected on a microscale setting with thousands of dimensional magnifications by DNA-based amplification technology. In this paper, labeled exosomes were distributed in a microchip and quantitatively detected by using an isothermal signal amplification. Digital detection (such as digital PCR) has been used for the absolute quantification of rare nucleic acids to detect cancer and other diseases. Combined with the digital detection of a single nucleic acid, we converted an exosome counting approach to single exosome digital detection for the first time. Single exosome detection was achieved by distributing a single exosome per chamber in a microchip followed by signal amplification based on the DNA that was anchored to the exosome surface. A series of further developments could be achieved to digitally detect extracellular vesicles by relying on RIDA or digital PCR platforms, via the surface-anchored nucleic acid approach. This concept and platform can be applied to other kinds of nanoparticles, such as liposomes, enveloped viruses, and inorganic/organic nanoparticles, among others. Exosomes are a typical example from many possibilities for this study; as mentioned above, nanoscale counting of exosomes is a popular topic that is essential but challenging. Additionally, the digital method can be integrated with other established DNA/RNA-based assay techniques. In addition to relying on chemical conjugation and molecular recognition, the anchoring of the BAM-DNA assembly on the exosome surface is a biocompatible and versatile labeling method for exosomes. This study may inspire and introduce possibilities for the future exploration with the digital detection of nanoparticles using nucleic acid-based interfacial engineering. Table 1. DNA sequences used in this study.

Figure 3. Specific exosomes were separated and detected selectively among the total exosomes. (a) Schematic diagram of specific exosome labeling and magnetic separation. (b and c) Fluorescent and relatively quantitative RIDA results for doubly labeled exosomes (3), BAM-DNA-labeled exosomes (1), doubly labeled exosomes with antibody (2) and the double-distilled water control (4). (d and e) Digital RIEDA signals in the microchip showing the differences between the total exosomes (green) and GPC-1(+) exosomes (red).

Oligonucleoti des

Sequence (5' to 3')

Modificat ion

DNA 1

ACGATAACCCGC-TTCAGCAA GACTCACT*CGCCCT

5' NH2 C6

Probe 1

AGTGAGTCTTGC|*TGAAGCGGGTT

5' 6-FITC, 3' BHQ1

Probe 1-FAM

AGTGAGTCTTGCTGAAGCGGGTT

5' 6-FAM,

DNA 2

AATAGCAGCCACG-ACACAGC ACTTCTGACTCCACA*

5' Biotin

Probe 2

TGTGGAGTCAGAA|*GTGCTGTGTCG

5' 6-ROX, 3' BHQ1

Adapter-magn etic beads

AAGCTTACGTCGAATGAGTGTAAAAAAAAAAA-


Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry AAAAAAAAAAAAAAAA Adapter-exos omes

This study was supported by the National Natural Science Foundation of China (81401541, 81570168, and 81702959), the National Key R&D Program of China (2016YFC1100800), the Distinguished Young Scientist Award of Natural Science Foundation of Zhejiang Province (LR16H180001), and the Major Project in Science and Technology of Zhejiang Province (2014C03048-2). We are grateful to the Core Facilities at the Institute of Translational Medicine of Zhejiang University for their assistance with the experimental equipment.

ACACTCATTCGACGTAAGCTTTGAGTCTTGCTGAAGCGGGTGAGT

|*: The N.BstNBI digestion site. *: Probe hybridization region.

REFERENCES

Table 2. DNA Oligonucleotides in RIDA. Oligonucleotide s

Sequence (5' to 3')

Tm (°C)

Probe 1

FITC-AGTGAGTCTTGCTGA AGCGGGTT-BHQ

64.4

Probe 1-part 1

FITC-AGTGAGTCTTGC

17.2

Probe 1-part 2

TGAAGCGGGTT-BHQ

29.7

Probe 2

ROX-TGTGGAGTCAGAAGT GCTGTGTCG-BHQ

64.9

Probe 2-part 1

ROX-TGTGGAGTCAGAA

20.4

Probe 2-part 2

GTGCTGTGTCG-BHQ

18.4

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Schematic illustration of RIDA (Figure S1). Exosomes were labeled with BAM-DNA (Figure S2), Exosomes RIDA and NTA (Figure S3). Schematic diagram of the magnetic separation and recovery system for selected exosomes via DNA hybridization and enzyme-mediated cutting (Figure S4). The RIDA reaction system (Table S1), the results from the digital detection of total exosomes (Table S2) and determination of exosomes concentration in solution using the NanoSight NS300 (Table S3) are included (PDF).

AUTHOR INFORMATION Corresponding Author * [email protected].

Author Contributions Dr. Q. Tian undertook the main experimental investigation, curated the data and wrote the original draft. C. He and G. Liu isolated and labeled the exosomes. Y. Zhao prepared the BAM-DNA. L. Hui performed the cell culture. Prof. Y. Mu, R. Tang, Y. Luo and S. Zheng validated and shared the experimental equipment and resources. Prof. B. Wang conceptualized, designed and administered the project, wrote the manuscript and acquired the funding. All authors have given approval to the final version of the manuscript.

Notes The authors declare no competing financial interests.

ACKNOWLEDGMENT

(1) Fevrier, B.; Raposo, G. Curr. Opin. Cell Biol. 2004, 16, 415-421. (2) Pisitkun, T.; Shen, R. F.; Knepper, M. A. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 13368-13373. (3) Thery, C.; Zitvogel, L.; Amigorena, S. Nat. Rev. Immunol. 2002, 2, 569-579. (4) Peinado, H.; Aleckovic, M.; Lavotshkin, S.; Matei, I.; Costa-Silva, B.; Moreno-Bueno, G.; Hergueta-Redondo, M.; Williams, C.; Garcia-Santos, G.; Ghajar, C.; Nitadori-Hoshino, A.; Hoffman, C.; Badal, K.; Garcia, B. A.; Callahan, M. K.; Yuan, J.; Martins, V. R.; Skog, J.; Kaplan, R. N.; Brady, M. S., et al. Nat. Med. 2012, 18, 883-891. (5) Hoshino, A.; Costa-Silva, B.; Shen, T. L.; Rodrigues, G.; Hashimoto, A.; Tesic Mark, M.; Molina, H.; Kohsaka, S.; Di Giannatale, A.; Ceder, S.; Singh, S.; Williams, C.; Soplop, N.; Uryu, K.; Pharmer, L.; King, T.; Bojmar, L.; Davies, A. E.; Ararso, Y.; Zhang, T., et al. Nature 2015, 527, 329-335. (6) Liu, Y.; Gu, Y.; Han, Y.; Zhang, Q.; Jiang, Z.; Zhang, X.; Huang, B.; Xu, X.; Zheng, J.; Cao, X. Cancer Cell 2016, 30, 243-256. (7) Costa-Silva, B.; Aiello, N. M.; Ocean, A. J.; Singh, S.; Zhang, H.; Thakur, B. K.; Becker, A.; Hoshino, A.; Mark, M. T.; Molina, H.; Xiang, J.; Zhang, T.; Theilen, T. M.; Garcia-Santos, G.; Williams, C.; Ararso, Y.; Huang, Y.; Rodrigues, G.; Shen, T. L.; Labori, K. J., et al. Nat. Cell Biol. 2015, 17, 816-826. (8) Melo, S. A.; Luecke, L. B.; Kahlert, C.; Fernandez, A. F.; Gammon, S. T.; Kaye, J.; LeBleu, V. S.; Mittendorf, E. A.; Weitz, J.; Rahbari, N.; Reissfelder, C.; Pilarsky, C.; Fraga, M. F.; Piwnica-Worms, D.; Kalluri, R. Nature 2015, 523, 177-182. (9) Liang, K.; Liu, F.; Fan, J.; Sun, D.; Liu, C.; Lyon, C. J.; Bernard, D. W.; Li, Y.; Yokoi, K.; Katz, M. H.; Koay, E. J.; Zhao, Z.; Hu, Y. Nat. Biomed. Eng. 2017, 1, 0021. (10) Tavoosidana, G.; Ronquist, G.; Darmanis, S.; Yan, J. H.; Carlsson, L.; Wu, D.; Conze, T.; Ek, P.; Semjonow, A.; Eltze, E.; Larsson, A.; Landegren, U. D.; Kamali-Moghaddam, M. Proc. Natl. Acad. Sci. U. S. A. 2011, 108, 8809-8814. (11) Silva, J.; Garcia, V.; Rodriguez, M.; Compte, M.; Cisneros, E.; Veguillas, P.; Garcia, J. M.; Dominguez, G.; Campos-Martin, Y.; Cuevas, J.; Pena, C.; Herrera, M.; Diaz, R.; Mohammed, N.; Bonilla, F. Genes Chromosomes Cancer 2012, 51, 409-418. (12) Kamerkar, S.; LeBleu, V. S.; Sugimoto, H.; Yang, S.; Ruivo, C. F.; Melo, S. A.; Lee, J. J.; Kalluri, R. Nature 2017, 546, 498-503. (13) Wan, Y.; Cheng, G.; Liu, X.; Hao, S.-J.; Nisic, M.; Zhu, C.-D.; Xia, Y.-Q.; Li, W.-Q.; Wang, Z.-G.; Zhang, W.-L.; Rice, S. J.; Sebastian, A.; Albert, I.; Belani, C. P.; Zheng, S.-Y. Nat. Biomed. Eng. 2017, 1, 0058. (14) Vaidyanathan, R.; Naghibosadat, M.; Rauf, S.; Korbie, D.; Carrascosa, L. G.; Shiddiky, M. J.; Trau, M. Anal. Chem. 2014, 86, 11125-11132. (15) Rupert, D. L.; Claudio, V.; Lasser, C.; Bally, M. Biochim. Biophys. Acta 2017, 1861, 3164-3179. (16) Logozzi, M.; De Milito, A.; Lugini, L.; Borghi, M.; Calabro, L.; Spada, M.; Perdicchio, M.; Marino, M. L.; Federici, C.; Iessi, E.; Brambilla, D.; Venturi, G.; Lozupone, F.; Santinami, M.; Huber, V.; Maio, M.; Rivoltini, L.; Fais, S. PLoS One 2009, 4, e5219. (17) Kanwar, S. S.; Dunlay, C. J.; Simeone, D. M.; Nagrath, S. Lab Chip 2014, 14, 1891-1900. (18) Shang, J.; Gao, X. Chem. Soc. Rev. 2014, 43, 7267-7278. (19) Vogelstein, B.; Kinzler, K. W. Proc. Natl. Acad. Sci. U. S. A. 1999, 96, 9236-9241. (20) Chiu, R. W.; Cantor, C. R.; Lo, Y. M. Trends Genet. 2009, 25, 324-331. (21) Lo, Y. M.; Lun, F. M.; Chan, K. C.; Tsui, N. B.; Chong, K. C.; Lau, T. K.; Leung, T. Y.; Zee, B. C.; Cantor, C. R.; Chiu, R. W. Proc. Natl. Acad. Sci. U. S. A. 2007, 104, 13116-13121.



(22) Heyries, K. A.; Tropini, C.; Vaninsberghe, M.; Doolin, C.; Petriv, O. I.; Singhal, A.; Leung, K.; Hughesman, C. B.; Hansen, C. L. Nat. Methods 2011, 8, 649-651. (23) Wan, S.; Zhang, L.; Wang, S.; Liu, Y.; Wu, C.; Cui, C.; Sun, H.; Shi, M.; Jiang, Y.; Li, L.; Qiu, L.; Tan, W. J. Am. Chem. Soc. 2017, 139, 5289-5292. (24) He, F.; Liu, H.; Guo, X.; Yin, B. C.; Ye, B. C. Anal. Chem. 2017, 89, 12968-12975. (25) Liu, H.; Kwong, B.; Irvine, D. J. Angew. Chem. Int. Ed. Engl. 2011, 50, 7052-7055. (26) Borisenko, G. G.; Zaitseva, M. A.; Chuvilin, A. N.; Pozmogova, G. E. Nucleic Acids Res. 2009, 37, e28. (27) Sakai, S.; Taya, M. ACS Macro Lett. 2014, 3, 972-975. (28) Kato, K.; Itoh, C.; Yasukouchi, T.; Nagamune, T. Biotechnol. Prog. 2004, 20, 897-904.

(29) Paulick, M. G.; Bertozzi, C. R. Biochemistry 2008, 47, 6991-7000. (30) Gao, W.; Li, X.; Zeng, L.; Peng, T. Diagn. Microbiol. Infect. Dis. 2008, 60, 133-141. (31) Tian, Q. C.; Song, Q.; Xu, Y. N.; Zhu, Q. Y.; Yu, B. W.; Jin, W.; Jin, Q. H.; Mu, Y. Anal. Methods 2015, 7, 2006-2011. (32) Melo, S. a.; Luecke, L. B.; Kahlert, C.; Fernandez, A. F.; Gammon, S. T.; Kaye, J.; LeBleu, V. S.; Mittendorf, E. a.; Weitz, J.; Rahbari, N.; Reissfelder, C.; Pilarsky, C.; Fraga, M. F.; Piwnica-Worms, D.; Kalluri, R. Nature 2015, 523, 177-182.


Page 8 of 9

Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Insert Table of Contents artwork here


9

Nanoparticle Counting by Microscopic Digital ... - ACS Publications

Recommend Documents