Nanorod Hierarchically Patterned Coatings for

Subscriber access provided by UNIV OF GEORGIA

Article

F-doped micropores/nanorods hierarchically patterned coatings for improving antibacterial and osteogenic activities of bone implants in bacteria-infected case Jianhong Zhou, Bo Li, Lingzhou Zhao, Lan Zhang, and Yong Han ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/acsbiomaterials.6b00710 • Publication Date (Web): 26 Dec 2016 Downloaded from http://pubs.acs.org on December 30, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Biomaterials Science & Engineering is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

F-doped micropores/nanorods hierarchically patterned coatings for improving antibacterial and osteogenic activities of bone implants in bacteria-infected case Jianhong Zhou1,2, Bo Li1, Lingzhou Zhao3, Lan Zhang1, Yong Han1*

1 State Key Laboratory for Mechanical Behavior of Materials, Xi'an Jiaotong University, Xi'an 710049, China 2 Institute of Physics & Optoelectronics Technology, Baoji University of Arts and Sciences, Baoji 721016, China 3 State Key Laboratory of Military Stomatology, Department of Periodontology, School of Stomatology, The Fourth Military Medical University, Xi’an 710032, China

*

Corresponding author: Yong Han. E-mail: [email protected]

ABSTRACT: Advanced titanium (Ti) based bone implants with antibacterial and osteogenic activities are stringently needed in clinic. Herein, biomimetic hierarchical micropores/nanorods patterned coatings (MNRs) on Ti were developed, in which the nanorods revealed a fixed interrod spacing of about 70 nm and consisted of fluorine (F) incorporated Ca9Sr1(PO4)6(OH)2 (Sr1-HA, strontium containing hydroxyapatite) with the fixed Sr but different F content. The incorporation of F was determined by XRD, FTTR and TEM, revealing the substitution of OH- in Sr1-HA to F-. The topography, surface roughness, and hydrophilic nature of MNRs were not apparently affected by the incorporation of F. The antibacterial and osteogenic activities of MNRs were assessed in vitro and in a bacterial-infected rabbit model. Both the in vitro and in vivo results showed that F-free and ∼1 wt% F doped MNR significantly promoted osteogenic activity compared to Ti but lack of antibacterial activity. The

1

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

incorporation of higher dose F led to the significantly improved antibacterial and osteogenic activities, and the effects were related to the incorporated F dose. Totally, compared to F-free, ∼1, ∼2 and ∼7 wt% F doped MNRs, ∼5 wt% F doped MNR significantly enhanced antibacterial and osteogenic activities, especially new bone formation and osseointegration in the bacteria-infected case, showing a high potential as the next generation advanced bone implant. KEYWORDS: Biomimetic hierarchical topography; Fluorine incorporation; Sr-HA nanorod; Mesenchymal stem cell; Antibacterial ability; Osseointegration

1. INTRODUCTION Titanium (Ti) is widely used as bone implants on account of its good mechanical properties, corrosion resistance and biocompatibility.1,2 However, bacteria-induced infection3,4 and inadequate osseointegration of Ti5 will lead to the failure of implantation. Advanced Ti-based implants with high-efficiency antibacterial and osteogenic activities are stringently needed in orthopedic clinic. To achieve improved osseointegration, biomimetic surface modification mimicking the characteristics of natural bone matrix in both chemistry and structure according to the characteristics of natural bone matrix is an efficient and widely adopted strategy.6,7 The bone matrix is assembled from the nanostructures such as collagen fibers and embedded apatite crystals to the microstructures including lamellae, osteons and Haversian systems, and finally to the macrostructures such as cancellous and cortical bone. Accordingly, the natural bone matrix presents a highly ordered micro-to-nanoscale hierarchical structure.8 In terms of chemical mimicry to the bone matrix, hydroxyapatite (HA) as the main inorganic component of bone matrix shall be an ideal choice.9 Meanwhile, there are many trace elements beneficial

2


Page 2 of 50

Page 3 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to bone formation, such as strontium (Sr) and fluorine (F) most notably, moreover, HA constitutes an ideal delivery platform

for these trace elements.10,11

Strontium-doped hydroxyapatite (Ca9Sr1(PO4)6(OH)2, Sr1-HA) nanorods were formed on microporous TiO2 by our group to finally give rise to specific hierarchical micropores/nanorods patterned coatings (MNRs),12-14 which exhibited biomimetic features in terms of both chemistry (Sr1-HA) and structure (hierarchical micro/nanostructure with abundant nanocues comprising nanorod diameter of about 70 nm and interrod spacing of about 70 nm). Consequently, these coatings significantly enhanced in vitro osteoblast functions, osteogenic differentiation of mesenchymal stem cells (MSCs) and in vivo osseointegration.12-14 As above mentioned, antibacterial ability is another essential property for normal function of bone implants. Sr1-HA-comprised MNRs still lack antibacterial ability despite displaying significantly improved osteogenic activity. Loading and delivery of inorganic bioactive elements shall be a good strategy to endow Ti-based implants with antibacterial ability.15 Regarding to the antibacterial dopants, widely studied silver and copper that have been widely studied exhibit antibacterial ability, but overdose of them may induce cytotoxicity.16,17 On contrary, fluorine (F) has not only excellent antibacterial ability against numerous bacteria but also good cytocompatibility and even osteoblastic activity.18-20 Some works have shown a dose-dependent effect of F ions on proliferation and osteogenic differentiation of various relevant cell types,21,22 high concentration of F ions is able to induce cytotoxic effects on cells.21 Accordingly, the F incorporation has drawn considerable attention to enhance the antibacterial activity of medical devices.23-24 Therefore, we hypothesize that the incorporation of F into MNRs has the potential to improve antibacterial and osteogenic activities. Among the nanotechnologies to form 1D nanostructures, the hydrothermal method

3



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

has shown to be an effective way to create HA grade (including HA, fluoridated/carbonated HA and Sr-HA) nanorods and nanofibers.25-27 However, these 1D HA grade products were mostly in the form of powders rather than films. For hydrothermally formed HA films, Chen et al. demonstrated that a film of compacted fluoridated HA nanorods, with a structure similar to dental enamel rather than bone extracellular matrix (ECM), was grown on metal plates;25 recent works have just shown compacted layers of micrometer-sized equiaxed28 or polygonal-shaped29 HA nanoparticles on Ti alloys. To our knowledge, the construction of nanorods-patterned Sr and F co-doped HA coatings on metal plates was still lack of reports in the current literature. In the present study, HA MNRs incorporated with the fixed Sr content but different F content were developed on Ti. MSCs as well as Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli) were employed to investigate the cytocompatibility and osteogenic activity as well as antibacterial activity of the coatings, respectively. Moreover, the in vivo osseointegration and antibacterial property of the coatings were investigated in an osteomyelitis rabbit model.

2. EXPERIMENTAL SECTION 2.1. Material preparation and characterization.For fabrication of Sr1-HA MNRs doped with different F contents, namely MNR-F0, MNR-F1, MNR-F2, MNR-F5 and MNR-F7, where the Arabic numbers indicate the mean F contents in wt%, a two-step method was performed. Firstly pure Ti disks (φ15×2 mm) for in vitro assays and Ti Kirschner wires (φ2×10 mm) for in vivo assays were micro-arc oxidized (MAOed) in an aqueous electrolyte containing 0.167 M calcium acetate (CA), 0.033 M strontium acetate (SA) and 0.020 M β-glycerophosphate disodium (β-GP) at an applied positive pulse voltage of 380 V, a negative pulse voltage of 100 V, a pulse frequency of 100

4


Page 4 of 50

Page 5 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Hz and a duty ratio of 26% for 5 min. Then the MAOed samples were mounted in a Teflon-lined

autoclave

containing

aqueous

NH4F

solutions

with

different

concentrations (Table 1) to receive hydrothermal treatment (HT) at 140°C for 18 h. Table 1. The corresponding NH4F concentrations of the used hydrothermal solutions and the elemental compositions of the coatings surfaces detected by XPS.

Coatings MNR-F0 MNR-F1 MNR-F2 MNR-F5 MNR-F7

NH4F concentration (M) 0 0.05 0.15 0.30 0.45

Elemental composition (wt.%) Ti 8.7±0.6 7.6±0.9 8.1±0.8 7.2±0.7 8.5±0.5

O 59.6±1.7 57.1±1.2 58.2±0.8 56.3±1.3 51.6±1.5

Ca 16.4±0.5 17.5±0.6 15.9±0.7 16.2±0.5 17.1±0.4

P 10.2±0.4 11.3±0.6 10.8±0.4 10.4±0.5 11.2±0.3

Sr 5.1±0.2 5.6±0.3 4.7±0.2 5.3±0.4 4.9±0.1

F 0.9±0.1 2.3±0.2 4.6±0.2 6.7±0.3

The phase components of the coatings were analyzed using X-ray diffraction (XRD; D/max-rA, Rigaku Co., Japan). The elements and chemical species of the coatings were examined with X-ray photoelectron spectroscopy (XPS; Axis Ultra, UK) and Fourier transform infrared spectroscopy (FT-IR; MX-1E, Nicolet Co., USA). The coatings were characterized with field-emission scanning electron microscopy (FE-SEM; JEOL JSM-6700F, Japan), surface contact-angle measurement machine (DSA30; KRUSS, Germany), and atomic force microscopy (AFM; SPM-9500J3, Japan). The nanorods scratched from the coatings were examined with transmission electron microscopy (TEM; JEOL JEM-2000FX, Japan), and quantitative element analyses of Ca, P, Sr, F and O in the nanorods were conducted using TEM-equipped energy-dispersive X-ray spectrometer (EDS; JEOL, Japan). 2.2. Ion release and adhesion strength of the coatings to substrates. The coated samples were immersed in 20 ml of physiological saline solution (PS solution, 0.9 wt% NaCl aqueous solutions) at 37oC for 2, 4, 6, 8, 10, and 12 weeks successively. At the pre-determined time points, the leaching liquids were collected and the 5



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

concentrations of Ca, P and Sr ions released were measured with inductively coupled plasma-mass spectrometry (ICP-MS; Nu Instruments, Wrexham, UK), while the F concentrations were measured using a fluoride ion electrode (9409SC, Orion Research, UK) connected to an Ion Analyzer (901, Orion Research, UK) after diluting the leaching liquids with an ionic strength adjustment buffer solution (TISAB with CDTA). The data were normalized to a standard curve obtained with a standard fluoride solution (Fluoride standard, Orion Research, UK) within a range of 0.1-20 ppm. The ion release tests were performed on five replicates. Scratch tests of the coatings immersed in the PS solution for different durations were performed using an auto scratch coating tester to evaluate their adhesion strength to the Ti substrates. The critical load (Lc) is defined as the smallest load at which a recognizable failure occured, and determined from the load versus acoustic output characteristics. The Lc of each coating was the average of five replicates. 2.3. Protein adsorption assay. The protein adsorption assays were conducted in α-Modified Eagle’s Medium (α-MEM) containing 10% fetal bovine serum (FBS; Life Technologies, USA). After incubation in the medium for 1 and 24 h at 37oC, the proteins adsorbed onto the samples were detached by 1% sodium dodecyl sulfate (Solarbio) and determined using a MicroBCA protein assay kit (Pierce). Five replicates for each group were tested. 2.4. In vitro antibacterial tests. The antimicrobial activities of the samples were evaluated using a plate-counting method with E. coli (ATCC25922) as the gram-negative representative and S. aureus (ATCC43300) as the gram-positive one. Each of the samples was immersed in 10 ml of PBS at 37oC for 1, 14, and 28 days with the PBS refreshed every day, then ultrasonically cleaned, sterilized and employed for antimicrobial assay. The bacteria were cultured in the beef

6


Page 6 of 50

Page 7 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


extract-peptone (BEP, HopeBio, China) medium under agitation for 18 h at 37oC. After dilution with BEP to a concentration of 1.0×105 CFU/ml, 1 ml of the bacteria suspension was introduced onto each sample surface. The samples with the bacteria suspension were incubated at 37oC for 12 h at a relative humidity of >90% in darkness. At the end of the incubation period, each sample was rinsed in phosphate buffer solution (PBS) and ultrasonically agitated to detach the bacteria from the sample. The viable bacteria in the PBS were quantified by standard serial dilution and plate-counting. The antibacterial activities at days 1, 14, and 28 of immersion were calculated using the following formula: R = (B-A)/B×100%, where R is the antibacterial rate, and B and A are the mean numbers of viable bacteria (CFU) on the Ti control and the MNR samples, respectively. Moreover, the antibacterial activities of the samples at day 28 of immersion in PBS were vividly assayed by fluorescent staining. After incubation with the bacteria suspension for 12 h, each sample was rinsed with PBS to remove the non-adherent bacteria. The adherent bacteria on each sample were stained with an acridine orange (AO)/propidium iodide (PI) mixture for 10 min and observed by fluorescence microscopy (DMI6000B Inverted Microscope, Leica, Germany). The morphologies and membrane integrity of E. coli and S. aureus on the samples immersed in PBS for 28 days were observed by FE-SEM with an accelerating voltage of 15 kV. After incubation with the bacteria suspension for 12 h, the samples were rinsed with PBS, fixed with 2.5% glutaraldehyde, dehydrated in graded ethanol series, freeze dried, sputter-coated with thin platinum layers, and finally observed by FE-SEM. 2.5. In vitro osteogenic activity 2.5.1. MSC harvest and culture. MSCs were harvested from 1-week-old New

7



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Zealand rabbits.30 The animal experiments were conducted according to the ISO 10993-2:1992 animal welfare requirements and approved by the Institutional Animal Care and Use Committee (IACUC) of Xi'an Jiaotong University. Briefly, bone marrow was aspirated from the femora and tibias, from which the mononucleated cells were isolated via density gradient centrifugation. The cells obtained were plated in cell culture flasks containing 20 ml of α-MEM containing 10% FBS and 1% antibiotics, and cultured at 37oC in a humidified atmosphere of 5% CO2 and 95% air. The non-adherent cells were removed and the adherent cells were collected for further expanding. All experiments were performed with cells within passage 3. The MSC suspension of 1 ml with 2×104 cells was seeded on the Ti samples. 2.5.2. Cell adhesion, proliferation, and morphology. The Ti samples were placed centrally in 24-well plates. The MSC suspension of 1ml with 2x104 cells were seeded on the samples, and incubated for 1 h, 5 h, 24 h, 3 days, 7 days and 14 days. At the end of each time period, the complete medium was removed from each well, and the samples were washed three times with PBS then transferred to new 24-well plates. Then the cell counting kit-8 (CCK-8) assay was used to assess the adhesion and proliferation of MSCs on the samples. Live/dead staining using the LIVE/DEAD Viability/Cytotoxicity Kit (Invitrogen, France) was performed to identify viable and nonviable MSCs on the samples after 3 days of incubation. The cell-adherent samples were washed thrice using PBS followed by the addition of 500 µL of PBS containing ethidium-homodimer-1 (4 µM) and calcein-AM (2 µM) to each well and incubation at 37°C for 30 min. Consequently, the fluorescence-stained cells were analyzed using an OLYMPUS laser confocal microscope (FV1000) for the collection of images of four random fields on each sample.

8


Page 8 of 50

Page 9 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


After 3 days of incubation, the samples with attached MSCs were washed with PBS, fixed in 3% glutaraldehyde, dehydrated in a graded ethanol series, freeze-dried, and sputter-coated with gold prior to observation by the FE-SEM. 2.5.3. Quantitative real-time PCR assay. After culturing for 3, 7 and 14 days, the total RNA was isolated using the TRIzol reagent (Life Technologies, USA), and 1 µg RNA from the cells on each sample was reversed transcribed into complementary DNA using a PrimeScrip RT reagent kit (TaKaRa, Japan). The expression of osteogenic differentiation markers including runt-related transcription factor 2 (Runx2), bone sialoprotein (BSP), alkaline phosphatase (ALP), osteopontin (OPN), osteocalcin (OCN) and type 1 collagen (Col-I) was quantified on a quantitative real-time polymerase chain reaction (qRT-PCR) detection system (Bio-Rad iQ5 Multicolor) with SYBRPremix ExTaqII (TaKaRa, Japan). Data analysis was carried out using an iQ5 Optical System (Bio-Rad, USA) with software version 2.0. The expression levels of the target genes were normalized to that of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) through the Comparative Ct value method. The primer sequences for the target genes are shown in Table 2: Table 2. Primer sequences used for qRT-PCR. Gene

Forward primer sequence (5′-3′)

Reverse primer sequence (5′-3′)

ALP BSP Col-I OCN OPN Runx2 GAPDH

CTGAGCGTCCTGTTCTGAGG GTCAGAACTGCTGGGACTCG TGCAGGGCTCCAATGATGTT CTTCGTGTCCAAGAGGGAGC GTGTACCCCACTGAGGATGC TGGTGTTGACGCTGATGGAA ATCAAGTGGGGTGATGCTGG

GTTCCTGGGTCCCCTTTCTG TGGCATTAGGTGTACTTGACAGT AGGAAGGGCAAACGAGATGG CAGGGGATCCGGGTAAGGA CACGTGTGAGCTGAGGTCTT ATACCGCTGGACCACTGTTG TACTTCTCGTGGTTCACGCC

9



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2.5.4. Intracellular ALP activity and contents of specific proteins. After 3, 7 and 14 days of culture, the cell-seeded samples were washed thrice with PBS, lysed in 0.1vol% Triton X-100 (Life Technologies, USA) through five standard freeze-thaw cycles, and finally shaken for 10 min. The intracellular ALP activity and contents of proteins (OPN, OCN and Col-I) in the cell lysates were determined with ELISA (Bluegene Ltd., China). The optical absorbance at 450 nm was recorded spectrophotometrically. The ALP activity and the protein contents were drawn from standard curves of absorbance versus known standards of corresponding proteins run in parallel with the experimental samples. The results were normalized to the intracellular total protein content. Five replicates for each group were tested. 2.5.5. Collagen secretion and extracelluar matrix mineralization. Collagen secretion and extracelluar matrix (ECM) mineralization by MSCs on the samples were assessed after 3, 7 and 14 days of culture via the Sirius Red and Alizarin Red staining, respectively. After washing with PBS and fixation, the samples were stained using 0.1% Sirius Red (Sigma, USA) to reveal the collagen and 40 mM Alizarin Red (pH 4.2, Sigma, USA) to show the ECM mineralization. In the quantitative analysis, the Sirius Red or Alizarin Red stain on the samples after washing with 0.1 M acetic acid or distilled water was dissolved in 0.2 M NaOH/methanol (1:1) or 10% cetylpyridinum chloride (Acros) to measure the optical density at 540 nm or 620 nm. 2.6. In vivo osteogenic and antibacterial activities 2.6.1. Surgical implantation. The animal experiments were conducted according to the ISO 10993-2:1992 animal welfare requirements and approved by the Institutional Animal Care and Use Committee (IACUC) of Xi'an Jiaotong University. Twenty-four adult New Zealand male rabbits 3 months in age weighing 2-3 kg were used. S. aureus was chosen to create osteomyelitis. After intraperitoneal injection of

10


Page 10 of 50

Page 11 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4% chloral hydrate (0.9 ml/100 g body weight) and sterilization with povidone iodine, 4 holes of 1 cm distance from each other were sequentially drilled using a disinfected hand-operated drill (2 mm in diameter) on the left femur of rabbit. Four Ti or the coated Kirschner wires were classificatorily implanted into the drilled holes of each femur, as shown in Schematic 1A. Subsequently, 20 µl of the PBS-diluted suspension of S. aureus with a density of 105 CFU/ml was injected into the medullary cavity with a microsyringe to create an infected model. The Ti Kirschner wire together with 20 µl PBS injected into the medullary cavity (denoted as Ti+PBS) was set as a control. After bacterial inoculation, the fascia and skin were sutured. Following surgery, the rabbits were housed in the separated cages and allowed to eat and drink ad libitum up to weeks 8 when they were sacrificed by intraperitoneal injection of overdose pentobarbitone sodium. 2.6.2. Microbiological evaluation. For quantifying the bacteria adhered on Ti and the coated Kirschner wires, they were placed in 4 ml PBS, sonicated, and vortexed to dislodge the adherent bacteria, which were counted to draw CFUs using the spread plate method mentioned above. The amounts of bacterial in the Kirschner wires surrounding femurs were also quantified. After snap freeze in liquid nitrogen, femurs (n=4) of every group were ground to powder under sterile conditions.31 The bone powder of one femur was vortexed in 2 ml PBS for 2 min. After centrifuging at 10,000 g for 15 s, the supernatant was drawn for serial (10-fold) dilutions, and then the samples were analyzed for CFUs in the wires surrounding femurs using the spread plate method. 2.6.3. Histological analysis. Immediately thereafter killing the rabbits, the femurs containing implants were fixed in neutral buffered formalin, dehydrated by ascending concentrations of ethanol, and finally embedded in polymethylmethacrylate (PMMA).

11



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The embedded specimens were cut into 150 µm thick sections perpendicular to the bone long axis using a saw microtome (Leica SP1600, Hamburg, Germany), ground, and polished to a final thickness of about 40 µm. The sections were stained with Van Gieson’s picrofuchsin and examined microscopically to visualize the mineralized bone tissue (red). The images were captured with a fluorescence microscope (Olympus IX 71, Olympus, Japan) and the panoramic images were acquired by Multiple Image Alignment (MIA), an advanced image capturing process enabled by cellSens Dimension software, and analyzed using Image-ProPlus software. Histometric analysis for evaluating the percentage of bone-to-implant contact (BIC) was performed on 4 sections on each embedded specimen. All the regions of interest in this study were within the endosseous part of each implant, as shown in Schematic 1B.

Schematic 1. (A) Position of implant in the rabbit femoral shaft and (B) histological analysis performed region marked by dotted square.

2.6.4. Pull-out test. The biomechanical pull-out test was used to assess the 12


Page 12 of 50

Page 13 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


strength of bone-implant integration. The femurs containing implants (n=3 for each group) were harvested after 8 weeks of implantation in the infected rabbit model , which were partially embedded in PMMA with the implants’ top being horizontal. The testing machine (Shimadzu, AGS-10kNG, Japan) was used to pull the implant vertically out at a cross-head speed of 1 mm/min. The load-displacement curve was recorded and the maximum pull-out force was then calculated. 2.7. Statistical analysis. The data were expressed as mean ± standard deviation (SD) from three independent experiments. The data were analyzed using SPSS 14.0 software (SPSS, USA). A one-way ANOVA followed by a Student-Newman-Keuls post hoc test was used to determine the level of significance. p < 0.05 and 0.01 was considered to be significant and highly significant, respectively.

3. RESULTS AND DISCUSSION 3.1. Structural characterization of the coatings. As shown in Figure 1A, the F-unincorporated and incorporated MNRs all reveal a quite similar hierarchical structure, which at microscale appears microporous with pores of 1-3 µm in diameter distributing homogeneously over the surface, and at nanoscale present dense nanorods array over the micropores walls with average nanorod diameter and interrod spacing both of 70 ± 6 nm. Moreover, MNR-F0 contained elements of Ti, O, Ca, P and Sr, while additional F could be detected by XPS on the surfaces of the coatings MNR-F1∼ MNR-F7 besides the above-mentioned elements (Table 1). The results indicate that adjusting the NH4F concentrations of the solutions used for hydrothermal treatment could modulate the F contents in the coatings, however, the F incorporation did not change the surface topographical structure of MNRs. The XRD patterns of MNRs are displayed in Figure 1B. No other peaks besides

13



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

those ascribed to anatase and rutile TiO2 as well as the peaks especially (2 1 1), (1 1 2) and (3 0 0) diffraction ascribed to Ca9Sr1(PO4)6(OH)2 (Sr1-HA) were observed for MNR-F0. The F-containing coatings exhibit quite similar patterns to that of MNR-F0. Focusing on the short-range XRD patterns, however, (2 1 1), (1 1 2) and (3 0 0) diffraction peaks detected on the F-incorporated MNRs shifted to a higher angle compared to those of MNR-F0, and the shift to higher angle was positively related to the increase of F incorporating amounts. This phenomenon was usually observed in the fluoridation of HA,32,33 suggesting the incorporation of F into Sr1-HA over the F-incorporated MNRs. The Figure 1C depicted FT-IR spectra of the coatings show the typical feature of apatite vibration bands, with PO43- bands at around 1090, 1039, 599 and 571 cm-1 for all the MNRs, and OH- bands at around 3570 and 633 cm-1 for MNR-F0. However, split and shift of the OH- stretching peak at 3570 cm-1 were observed for the F incorporated MNRs, and the stretching peak intensity of OH- decreased as the F incorporating content increased. The split and shift of OH- peak at 3570 cm-1 was an indicative of the partial substitution of OH- in apatite to F-, because an additional OH-F stretching band appeared at a lower frequency when OH- was partially replaced by F-.34,35 Moreover at the wavenumber slightly higher than 633 cm-1 shown by MNR-F0, new peaks appeared around 674 and 720 cm-1 for the F-incorporated MNRs. These results indicate that F was incorporated into the apatite lattice as the substitution of OH-, in agreement with the literature data reported by the other researchers.34,35 To identify the nanorods, they were scratched from the coatings and examined using TEM-equipped EDS, as shown in Figure 1D (comprising bright field image, SAED pattern and EDS spectrum, taken from the nanorod scratched from MNR-F5)

14


Page 14 of 50

Page 15 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


as a representative of TEM images and Table 3 depicted elemental compositions. The results confirm that the nanorods comprise F-doped Sr1-HA for MNR-F1∼MNR-F7 and Sr1-HA for MNR-F0. In comparison of Table 3 with Table 1, a higher content of F

Figure 1 (A) Surface morphologies and magnified images (insets) of the coatings. (B) XRD patterns and (C) FT-IR spectra of MNR-F0 (I), MNR-F1 (II), MNR-F2 (III), MNR-F5 (IV) and MNR-F7 (V). (D) TEM image of the nanorod scratched from 15



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 50

MNR-F5, the bottom inset showing EDX pattern of the nanorod, in which the emerged Cu peak is ascribed to the Cu-grid, and the upper inset showing the SAED pattern which identifies the nanorod component to be F-incorporated Sr1-HA. (E) Cross-sectional morphology and elemental profiles of MNR-F5.

in the coatings than in the corresponding nanorods can be drawn, indicating that F was not only doped in the nanorods component but also doped in TiO2 component of the coatings. By means of examining the cross-sectional morphologies and elemental profiles, as shown in Figure 1E (taken from MNR-F5) as a representative, combined with the aforementioned XRD, FT-IR and TEM results, it is clear that the F-doped coatings are bilayered with a nanorod-shaped 3D surface topographical outer layer composed of F-doped Sr1-HA and an inner layer composed of F-doped TiO2. Such bilayer structure is quite similar to that of MNR-F0 as described in our works.10,12

Table 3. The elemental compositions of the nanorods scratched from the coatings as detected by TEM-equipped EDS. Elemental composition (wt.%)

Coatings MNR-F0 MNR-F1 MNR-F2 MNR-F5 MNR-F7

O 48.6±3.3 49.3±2.9 48.5±3.5 47.8±3.8 47.2±3.1

Ca 34.6±2.7 33.9±2.5 34.9±2.8 34.2±2.6 33.5±2.8

P 8.7±0.8 8.3±0.5 7.9±0.9 8.2±1.1 8.6±0.7

Sr 8.1±0.9 7.9±0.5 7.6±0.4 8.0±0.8 7.8±0.6

F 0.6±0.1 1.1±0.3 1.8±0.2 2.9±0.4

3.2. Roughness, wettability, ion release and adhesion strength of the coatings. The measured roughness and wettability of the coatings are listed in Table 4. There was no significant difference in the microscale roughness among the MNRs, as characterized by the average roughness (Ra), root-mean-square roughness (RMS), and

16


Page 17 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


selection of 10-point height of irregularity roughness (Rz). Also, MNRs showed quite similar water contact angles of around 3-4°, revealing superhydrophilicity. Totally, the F incorporation did not apparently alter the surface roughness and wettability of MNRs. Table 4. Roughness values and contact angles of pristine Ti and the coatings. Coatings Ti MNR-F0 MNR-F1 MNR-F2 MNR-F5 MNR-F7

Ra 5±1 451±40 458±39 462±35 473±36 469±43

Roughness (nm) RMS 9±2 482±41 469±38 476±36 485±34 476±32

Rz 37±4 1196±132 1215±143 1223±145 1204±146 1216±138

Contact angle (deg.) 115.8±5.1 3.6±1.4 3.2±1.3 4.1±1.5 3.8±1.6 3.4±1.2

Figure 2 shows the release of Ca, P, Sr and F ions and the adhesion strength of the coatings after immersion in the PS solution for different durations. MNR-F0 only released the Ca, P and Sr ions, while MNR-F1, MNR-F2, MNR-F5 and MNR-F7 released the F ion additionally. The doses of the released Ca, P, Sr and F ions increased commensurate with the soaking duration, indicating a constant release mode. The F incorporation obviously influenced the releasing amounts of Ca, P and Sr ions, leading to lower Ca, P and Sr ion release compared with the MNR-F0 mounted Sr1-HA, which followed the rank of MNR-F0 > MNR-F1 > MNR-F2 > MNR-F5 > MNR-F7 (Figure 2A). This can be explained by the disordered structure of Sr1-HA with relatively poorer chemical stability accompanied with faster release of Ca, P and Sr ions, while the incorporation of F into HA lattice, e.g. the partial substitution of OH in HA to F, can enhance the chemical stability of HA via hydrogen bonding in OH group to F- and low its solubility.36-38 In spite of the role of F incorporation in enhancing the chemical stability of Sr-HA, Figure 2A still shows that the released F

17



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

doses followed the order of MNR-F7 > MNR-F5 > MNR-F2 > MNR-F1, in line with the F incorporating amounts in the coatings. This may be due to that F also doped in TiO2 and can release from the component besides from F-doped Sr1-HA component.

Figure 2. (A) Cumulative release of Ca, P, Sr and F by MNR-F0, MNR-F1, MNR-F2, MNR-F5 and MNR-F7 coatings, and (B) adhesion strength of the coatings immersed in PS solution for different durations.

18


Page 18 of 50

Page 19 of 50

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


The firm adhesion of the coating to the substrate is crucial for the long-term normal function of the bone implants, because the debris exfoliated from the coating can cause cytotoxicity, aseptic implant loosening and thus failure.39 The adhesion strength of the coatings immersed in the PS solution for different durations is shown in Figure 2B. The Lc values of MNRs without immersion were about 22.4 N in average, with no significant difference among the different coatings, indicating a strong bonding of the coatings to the substrates, which was not influenced by the F incorporation. After immersion in the PS solution for as long as 12 weeks, the coatings retained their adhesion strength well with slight decrease, suggesting good long-term adhesion strength stability during application in the biological environment. 3.3. In vitro antibacterial activities of the coatings. The antibacterial activities of the MNRs immersed in PBS for 1 to 28 days against E. coli and S. aureus were evaluated as shown in Figures 3A and B, respectively. Ti, MNR-F0 and MNR-F1 did not reveal any antibacterial efficacy against the bacteria at any time within 28 days of immersion, suggesting that the Ca, P, and Sr ions released from MNRs and low dosage of F ions cannot kill the bacteria. Compared with Ti, MNR-F0 and MNR-F1, MNR-F2, MNR-F5 and MNR-F7 significantly enhanced the antibacterial activity (p

Nanorod Hierarchically Patterned Coatings for

Recommend Documents