New Insights into DNA Polymerase Function Revealed by

Sep 5, 2017 - The bacteriophage T4 DNA polymerase (pol) and the closely related RB69 DNA pol have been developed into model enzymes to study family B ...
1 downloads 11 Views 8MB Size
Download PDF
Article pubs.acs.org/crt

Cite This: Chem. Res. Toxicol. 2017, 30, 1984-1992

New Insights into DNA Polymerase Function Revealed by Phosphonoacetic Acid-Sensitive T4 DNA Polymerases Likui Zhang†,‡,* †

Marine Science & Technology Institute Department of Environmental Science and Engineering, Yangzhou University, No. 196 Huayang West Road, Hanjiang, Yangzhou, Jiangsu 225127, China ‡ Department of Biological Sciences, University of Alberta, Edmonton, Alberta T6G 2R3, Canada ABSTRACT: The bacteriophage T4 DNA polymerase (pol) and the closely related RB69 DNA pol have been developed into model enzymes to study family B DNA pols. While all family B DNA pols have similar structures and share conserved protein motifs, the molecular mechanism underlying natural drug resistance of nonherpes family B DNA pols and drug sensitivity of herpes DNA pols remains unknown. In the present study, we constructed T4 phages containing G466S, Y460F, G466S/Y460F, P469S, and V475W mutations in DNA pol. These amino acid substitutions replace the residues in drug-resistant T4 DNA pol with residues found in drug-sensitive herpes family DNA pols. We investigated whether the T4 phages expressing the engineered mutant DNA pols were sensitive to the antiviral drug phosphonoacetic acid (PAA) and characterized the in vivo replication fidelity of the phage DNA pols. We found that G466S substitution marginally increased PAA sensitivity, whereas Y460F substitution conferred resistance. The phage expressing a double mutant G466S/Y460F DNA pol was more PAA-sensitive. V475W T4 DNA pol was highly sensitive to PAA, as was the case with V478W RB69 DNA pol. However, DNA replication was severely compromised, which resulted in the selection of phages expressing more robust DNA pols that have strong ability to replicate DNA and contain additional amino acid substitutions that suppress PAA sensitivity. Reduced replication fidelity was observed in all mutant phages expressing PAA-sensitive DNA pols. These observations indicate that PAA sensitivity and fidelity are balanced in DNA pols that can replicate DNA in different environments.

■

INTRODUCTION DNA polymerases (pols) are frequent targets for the development of antiviral drugs. For example, nucleoside chain terminators are effective inhibitors of HIV-1 reverse transcriptase (RT) and herpes family DNA pols.1−8 The antiviral nucleoside drugs are phosphorylated in vivo, to the triphosphate form, and then incorporated during viral genome replication by the viral pol. These drugs are effective because the essential host chromosomal DNA pols, the conserved eukaryotic α, δ, and ε DNA pols, are largely resistant. Therefore, viral replication is preferentially inhibited. A second choice for treatment is the pyrophosphate (PPi) mimic, phosphonoformic acid (PFA), which is clinically known as Foscarnet. PFA is effective against herpesviridae DNA pols, especially human cytomegalovirus (HCMV) DNA pol.9 Single amino acid changes in HCMV DNA pol confer PFA resistance.10,11 Recently, a likely mechanism of action was proposed by using RB69 phage expressing DNA pol with multiple mutations. The phage RB69 DNA pol was developed as a model of the PFAsensitive herpes DNA pol because of technical problems in working with HCMV DNA pol.12 Both the phage and herpes DNA pols are members of the family B DNA pols, but the phage DNA pols, like human α, δ, and ε DNA pols, are resistant to PFA. A long-standing question in the field is why only herpes DNA pols are sensitive to PPi-like drugs. © 2017 American Chemical Society

To convert PFA resistance of RB69 DNA pol to sensitivity, nine amino acid substitutions were introduced. However, only a single amino acid substitution, V478W, was needed to confer drug sensitivity.9 Structural studies with chimeric RB69 DNA pol revealed that the PFA trapped the DNA pol on a primertemplate DNA in a closed, pretranslocation (pre-T) complex. PPi is produced following nucleotide incorporation. The structure containing PFA in the place of PPi was observed in the crystallographic studies.9 PFA also inhibits HIV-1 RT by trapping a pre-T complex,13,14 which suggests a common mechanism of inhibition. T4 DNA pol (a close relative of RB69 DNA pol15) and PAA (the first PPi-like antiviral drug discovered that was too toxic for clinical use) were employed to determine the reason behind PPi-like drug sensitivity in certain family B DNA pols. Another aspect that distinguished this study was the in vivo characterization of drug sensitivity and the utilization of genetic selection to identify mutant T4 DNA pols that have amino acid substitutions that would not necessarily be apparent in structural studies. From the beginning of our studies, we Special Issue: DNA Polymerases: From Molecular Mechanisms to Human Disease Received: May 17, 2017 Published: September 5, 2017 1984

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology

Since the processivity is dramatically increased,22 enzyme dissociation is decreased, indicating reduced pol to exonuclease switching. However, the mechanism underlying the drug sensitivity of the herpes family DNA pols in contrast to the nonherpes family B DNA pols remains unclear. We proposed that the basis of drug sensitivity of DNA pol is increased processivity resulting from the formation of stable pre-T complexes. We predicted that there might be many amino acid differences between the drug-sensitive and drug-resistant DNA pols, which act coordinately to determine processivity. These amino acid differences will need to be identified to produce a model phage DNA pol that is drug-sensitive and also retains high DNA pol activity. Therefore, we have initiated genetic selection strategies to identify mutant T4 DNA pols that are highly active in vivo and are more drug-sensitive. We constructed G466S, Y460F, and G466S/Y460F mutants of T4 DNA pols. These amino acid substitutions were screened by genetic methods, and PAA sensitivity of the corresponding mutant T4 phages was investigated. We also engineered V475W T4 DNA pol, which is analogous to V478W RB69 DNA pol, to characterize its activity in vivo.

compared the drug-resistant HSV1 DNA pol mutants with the collection of phage T4 DNA pol mutants.16 We reasoned that L412M T4 DNA pol, which has the amino acid substitution in the conserved Motif A sequence (Figure 1), may be PAA-

Figure 1. Motif A sequences of several family B DNA pols.

sensitive because this DNA pol is sensitive to the chainterminator ddGTP, whereas HSV1 DNA pol is naturally sensitive to both nucleoside and PPi-like drugs; single amino acid changes conferred resistance to both drugs.17 If that was the case, then a single mechanism was the basis for sensitivity and resistance of both types of viral inhibitors. However, L412M T4 DNA pol is not nearly as drug-sensitive as herpes family DNA pols.17 It is revealing that while L412M substitution in the conserved Motif A sequence confers drug sensitivity, the highly drug-sensitive herpes DNA pols retain the conserved L residue (Figure 1). Furthermore, structural studies of the PFA-sensitive RB69 DNA pol mutant show that the conserved L residue does not contact PFA in the crystal structure.9 Thus, residue L412 in T4 DNA pol is not a natural determinant of drug sensitivity and does not directly interact with PPi. Instead, L412M substitution in T4 DNA pol likely confers drug sensitivity by affecting kinetically coupled reactions. Changes in the equilibrium between these reactions might be responsible for drug sensitivity or resistance.17 Several biochemical studies using the fluorescent base analog, 2-aminopurine, revealed a rapid equilibrium between pre-T and post-T complexes and that L412M T4 DNA pol favored a preT complex.18 L412M T4 DNA pol exhibited increased processivity and pyrophosphorolysis and decreased proofreading.19 These characteristics can be explained within the context of the nucleotide incorporation scheme (Figure 2).20 Immediately following nucleoside incorporation, PPi is bound in a closed pre-T complex. Release of PPi and movement of the fingers domain forms the open pre-T complex, which can rebind PPi to re-form the closed complex. This has been demonstrated by the structure of the PFA-sensitive RB69 DNA pol with PFA bound in the PPi binding site.9 Alternatively, the DNA pol may translocate to the next nucleotide in the template to be in position to bind the incoming nucleotide. There is rapid equilibrium between the open pre-T and post-T complexes. Binding the correct nucleotide traps the post-T complex, which can result in nucleotide incorporation (chemistry step). A third possibility that concerns proofreading also exists. If an incorrect nucleotide was incorporated, then the equilibrium between the pre-T and post-T complexes would be disrupted, providing an opportunity for polymerase-toexonuclease switching, where the primer end was transferred to the exonuclease active site, which is likely involved in enzyme dissociation and rebinding.21 The increased pyrophosphorolysis activity of the L412M T4 DNA pol compared to that of the wild type DNA pol resulted from the increased stability of the pre-T complex compared to that of the post-T complex.

■

EXPERIMENTAL PROCEDURES

Structure-Based Sequence Alignments and Databases. Sequences of the family B DNA pols included in this work were retrieved from the protein sequence database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/ protein/). The structures of the open binary complex of RB69 DNA pol with an abasic site in a DNA template (PDB ID: 1Q9X) and the closed ternary complex with DNA containing a templating A and an incoming dTTP (PDB ID: 1IG9) were aligned and modified via their fingers domains using Pymol software. Clustal X was used to align protein sequences. Structurally equivalent regions were manually put into the Clustal program as distinct alignment regions. Bacteria and Bacteriophage T4 Strains. All T4 phage cultures were prepared with the Escherichia coli strain CR63 (K strain, supD) by standard procedures.23 The CR63 lambda lysogenic strain (CR63λ) was used to determine rII+ mutant frequencies. The mutant T4 phages were selected using E. coli strain B after recombination. E. coli strain optA1 was used to test optA1 sensitivity of the mutant T4 phages.23 The bacteriophage T4 strains were derived from the T4D strain. Engineering of T4 DNA Pol Mutants. T4 DNA pol mutants used in this work were constructed by the single mutagenic primer method using the T4 DNA pol expression vector.24−26 The mutagenic primer sequences are summarized in Table 1. Phusion DNA pol (Thermo Scientific, MA, USA) was used for DNA amplification. DpnI (New England Biolabs, MA, USA) was used to digest the Dammodified plasmid template, which was the source of the nonmutant plasmid. E. coli DH5α competent cells were transformed with the DpnI-digested DNA. The complete DNA sequences of T4 DNA pol in the mutant plasmids were sequenced to confirm the presence of all desired mutations and the absence of extra mutation(s). Four primers were used for sequencing: 5′-AG ATG CGG TTC AGC AAA TCG C, 5′-C ACT CGG TTT AGG AGC TGT TCC TGC, 5′-TTC CAT GAG CAT ATC ACG CTC, and 5′-GCA TAT CGT GAG TTA TGT G. Engineering the Corresponding Mutant T4 DNA Pol Phages. The T4 phages containing mutant DNA pol were constructed by recombination between coinfected mutant phage strains or between the infecting phage with cloned copies of mutant DNA pol genes carried on plasmids within the host bacteria. The methods were described in detail by Li et al.23 T4 genomic DNA was prepared from 0.75 mL of frozen/thawed phage culture (∼1011 phage) using the standard phenol/chloroform extraction method. The T4 DNA pol gene was amplified using the following primers: F, 5′-GCC TAA TAA CTC GGG CTA TAA ACT AAG G and R, 5′-GGG ACC TGG AGG 1985

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology

Figure 2. Nucleotide incorporation scheme for T4 DNA pol. The details of nucleotide incorporation by T4 DNA pol are described in the text. Adapted from Reha-Krantz, L. J.; Hariharan, C.; Subuddhi, U.; Xia, S.; Zhao, C.; Beckman, J.; Christian, T.; and Konigsberg W. Structure of the 2aminopurine-cytosine base pair formed in the polymerase active site of the RB69 Y567A-DNA polymerase. Biochemistry 2011, 50, 10136−10149. Copyright 2011 American Chemical Society.20

Table 1. Sequences of DNA Primers Used for Constructing the Mutant T4 DNA Pols

a

DNA substrates

sequences (5′ to 3′)a

G466S Y460F V475W P469S

GGATGTATGATAAACATCAAGAAGCTATCATTCCAAAGGAAATCGC CTTGTTCTCCGAATGGATGGATGTTTGATAAACATGAACAAGG GGAAAGGAAATCGCTAAATGGTTTTTCCAGCGTAAAGACTGG CATCAAGAACCTATCATTTCTAAGGAAATCGCTAAAG

Mutagenic bases are underlined. (CR63). The PAA gradient plates were formed by first pouring 35 mL of agar solution containing 2 or 1 mg/mL PAA into a 100 × 100 mm2 plate and then elevating one edge with a pencil. After the agar hardened for more than 3 h, the plate was placed flat on the bench, and 35 mL of drug-free agar solution was added. The plates were used on the following day. The agar solution contained, in 100 mL, 1.3 g of

TCC TAG. The PCR product was purified by gel electrophoresis and sequenced using the primers mentioned above. PAA Sensitivity Assays of T4 Phages Containing Mutant DNA Pol in Vivo. PAA sensitivity of the T4 phages containing mutant DNA pol was determined by spotting the T4 phages onto a PAA gradient that was overlaid with soft agar containing host bacteria 1986

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology tryptone, 0.8 g of NaCl, 0.1 g of sodium citrate, 0.1 g of glucose, 1.2 g of Noble agar, and 200 mg or 100 mg of PAA for PAA agar and no PAA for drug-free agar. Overnight cultures of E. coli CR63 strains (100 μL) were poured into the plate with PAA gradients. Phage suspensions (10 μL, ∼104 phages/ml) were spotted onto the plates containing the host strain CR63 and PAA gradients (1 or 2 mg/mL) and incubated overnight at 30 °C. Replication Fidelity Assays of T4 Phages Containing Mutant DNA Pol in Vivo. Replication fidelity of the wild type and mutant T4 phages was determined by measuring the in vivo reversion frequencies for the rII mutant, rIIUV199oc to rII+. The total number of phage plaques per culture was measured by plating on the permissive host CR63. The number of rII+ revertants was determined by plating on the host CR63λ, which restricted the growth of rII mutant T4 phage. Replication fidelity was reflected by the reversion frequency, which was the ratio of the number of rII+ revertants to the total number of phage plaques. At least 10 parallel T4 phage cultures were tested for each experiment, and the median reversion frequency was reported.

confer PAA sensitivity (Figure 4). However, PAA sensitivity of G466S T4 DNA pol was predicted to be weak because several

Figure 4. Cycle of optA1-sensitive and PAA-sensitive T4 DNA pol mutants by second site substitution.

■

RESULTS G466S and G466S/Y460F T4 DNA Pols Are Sensitive to PAA. An earlier study demonstrated that P424L substitution in the NPL motif of T4 DNA pol yielded a weak DNA pol that could not replicate DNA when the dGTP pool was reduced (optA1 sensitivity).23,27 Sixteen amino acid substitutions were identified that restored the replication activity in low dGTP environment.23 Several of these amino acid substitutions exchanged T4 DNA pol residues for residues found in herpes family DNA pols such as G466S (Figure 3). G466S substitution

amino acid substitutions would be needed to construct a chimeric T4-herpes DNA pol with same PAA sensitivity as observed for the herpes viral DNA pol. The mutant encoding G466S substitution was inserted into the T4 DNA pol expression vector and transferred to the DNA pol gene in phage by recombination. The G466S T4 phage exhibited weaker PAA sensitivity in the presence of 1 or 2 mg/ mL PAA (Figure 5) compared to that of L412M T4 phage. Thus, the results were consistent with our hypothesis that G466S T4 DNA pol is mildly sensitive to PAA. The two amino acid substitutions, Y460F and Y460H, suppress optA1 sensitivity of P424L T4 DNA pol23 and are therefore predicted to confer PAA sensitivity. However, little PAA sensitivity was expected in this case because identical or similar residues were found in analogous positions in drugresistant and drug-sensitive family B DNA pols in general and thus was not specific for the herpes family DNA pols. As expected, Y460F T4 DNA pol was not sensitive to either 1 or 2 mg/mL PAA. However, Y460F/G466S T4 DNA pol was more PAA-sensitive than G466S T4 DNA pol (Figure 5). Note that G466 and Y460 residues in T4 DNA pol correspond to S772 and F764 residues in HSV1 DNA pol, respectively. The results suggest that both S772 and F764 residues in the HSV1 DNA pol contribute to its natural PAA sensitivity. V475W T4 DNA Pol Is Sensitive to PAA but Is a Weak DNA Pol. Previous studies showed that the mutant RB69 DNA pol with nine amino acid substitutions was approximately 100times more sensitive to PFA than the wild type RB69 DNA pol. V478W substitution alone increased PFA 30-fold sensitivity of RB69 DNA pol.9,12 Thus, changing a single residue, V478 to W478, significantly increased the drug sensitivity of RB69 DNA pol. T4 and RB69 DNA pols share 61% identical residues and another 14% are similar. Furthermore, T4 and RB69 DNA pols are functionally similar, as determined by a variety of biochemical assays.15 Residue V475 in T4 DNA pol is equivalent to residue V478 in RB69 DNA pol (Figure 3). Therefore, we hypothesized that V475W T4 DNA pol is sensitive to PAA. As expected, V475W T4 DNA pol exhibited PAA sensitivity, similar to that of L412M T4 DNA pol (Figure 6), which was consistent with PFA sensitivity of V478W RB69 DNA pol.9 While the herpes family DNA pols have a conserved Trp residue in helix N that is not present in drug-resistant family B DNA pols (Figure 3), V478W substitution in RB69 DNA pol does not appear to directly affect drug binding. Instead, W478

Figure 3. Alignment of helix N (fingers domain) amino acid sequences of several family B DNA pols. A Ser in helix N in herpes family DNA pols is shown in purple. Nonherpes family B DNA pols have a Gly that corresponds to G466 in T4 DNA pol (red), whereas herpes viral DNA pols have a Ser. An Arg, shown in blue font, is a conserved residue in family B DNA pols that interacts with phosphates in the dNTPs. Block A residues are boxed. A chimeric RB69 DNA pol was constructed with Block A residues (WVS) replacing VFN in RB69 DNA pol plus six additional amino acid substitutions in Block B and Block C.9,22 V781I substitution in HCMV DNA pol resulted in reduced susceptibility to antiviral drugs.32 The conserved Trp residue in herpes family DNA pols (shown in green) was proposed to be important for PFA binding.22,23

in T4 DNA pol was identified as a strong suppressor of optA1 sensitivity of P424L T4 DNA pol.23 Ser is conserved in this position in the drug-sensitive herpes family DNA pols, but Gly is found in the drug-resistant family B DNA pols (Figure 3). Therefore, a Ser at this position may be a herpes DNA polspecific determinant of PAA sensitivity. Thus, G466S T4 DNA pol was predicted to be PAA-sensitive because suppressors of optA1 sensitivity generally encode amino acid substitutions that 1987

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology

Figure 6. V475W T4 phage is sensitive to PAA, whereas P469S T4 phage is not. Equal concentrations of phage are spotted across PAA gradients of 2 mg/mL PAA. Plaques (clearing in the bacterial lawn) are produced by phage infection. V475W T4 phage exhibited PAA sensitivity similar to that of L412M T4 phage, whereas P469S T4 phage displayed PAA resistance. Both A566T and Y347C substitutions suppressed PAA sensitivity of V475W T4 phage.

Figure 5. PAA sensitivity of G466S and G466S/Y460F T4 phages. Equal concentrations of phage were spotted across PAA gradients of 1 and 2 mg/mL PAA. Plaques (clearing in the bacterial lawn) are produced by phage infection. G466S T4 phage is PAA-sensitive, but not as sensitive as L412M T4 phage. Substitution Y460F increased PAA sensitivity of G466S T4 phage.

LB plate with 2 mg/mL PAA and grew them in LB medium with the host strain CR63. The genomic DNA of the ten phages was extracted, and the T4 DNA pol genes were amplified by high-fidelity Phusion DNA pol. The T4 DNA pol genes were sequenced to confirm the mutations that suppress PAA sensitivity of V475W T4 DNA pol. Y347C and A566T were identified as the amino acid substitutions that suppressed PAA sensitivity of V475W T4 DNA pol. We tested if Y347C/ V475W or A566T/V475W T4 phage was sensitive to PAA and E. coli optA1. As expected, both Y347C/V475W and A566T/ V475W T4 phages were resistant to PAA (Figure 6) and E. coli optA1 (data not shown). Thus, Y347C and A566T substitutions suppressed PAA sensitivity and optA1 sensitivity of the V475W T4 phage. P469S T4 DNA Pol Mutant Is Resistant to PAA. A Pro residue corresponding to P469 in T4 DNA pol is generally found in the drug-resistant family B DNA pols, but not in the herpes family DNA pols (Figure 3). Since the corresponding residues in HSV1 and HCMV DNA pols are Ser, we hypothesized that P469S DNA pol might be weakly sensitive to PAA. Even though genetic experiments did not point to P469, we constructed P469S T4 DNA pol. However, we found that P469S T4 phage did not exhibit any PAA sensitivity (Figure 6). In fact, Ser residue in this position is not conserved in the herpes family DNA pols (Figure 3). Note that residue

in RB69 DNA pol appears to clash with residue W365 in the Nterminal domain in the “open” conformation (Figure 7A), which is proposed to trap the “closed” confirmation with bound PFA (Figure 7B).9 RB69 DNA pol is easier to crystallize than T4 DNA pol, and therefore, the structure of RB69 DNA pol, rather than that of T4 DNA pol, has been shown. As can be seen in this figure, the fingers domain is highly dynamic during cycles of nucleotide incorporation. The corresponding Trp residue in the herpes family DNA pols (Figure 3) is proposed to bind PFA, but domain clashes that reduce pol efficiency were observed instead.9 Thus, we hypothesized that V475W DNA pol might be a weak DNA pol because of a severe steric clash between W475 and W362. We found that only 5% of the T4 phage containing V475W DNA pol can grow using the E. coli optA1 as host strain (data not shown), suggesting that V475W DNA pol is sensitive to E. coli optA1. Thus, V475W T4 DNA pol is sensitive to both PAA and optA1 but is a weak DNA pol that has decreased pol efficiency. Suppression of PAA and optA1 Sensitivity of V475W T4 DNA Pol by Second Site Substitution. We selected randomly ten plaques containing V475W T4 DNA pol on the 1988

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology

Table 2. PAA Sensitivity and Replication Fidelity of T4 Phages Containing Mutant DNA Pols DNA pol mutant

PAA sensitivitya

spontaneous mutation frequencyb (fold change compared to wild type T4)

L412Mc G466S Y460F Y460F/G466S P469S V475W V475W/Y347C V475W/A566T

++++ + − +++ − ++++ − −

9 11 0.6 22 0.2 70 5.0 2.5

a

PAA sensitivity was determined with PAA gradients. The highest PAA sensitivity score is + +++; the lowest is −, which is the PAA sensitivity of the wild type T4 DNA pol. bSpontaneous mutation frequency was determined by the reversion of an rII mutant, rUV199oc. The wild type reversion frequency is approximately 1 × 10−6. cCited from Li et al.23

■

DISCUSSION In this work, we first demonstrated PAA sensitivity of T4 phages expressing the G466S, Y460F/G466S and V475W DNA pol mutants in vivo. We showed that PAA sensitivity of V475W DNA pol could be suppressed by A566T and Y347C substitutions. These amino acid substitutions exchange drugresistant T4 DNA pol residues for residues found in drugsensitive herpes family DNA pols, which contribute to the natural drug sensitivity of the herpes DNA pols. We also tested the effects of other amino acid substitutions. Genetic selection method showed that G466S substitution in T4 DNA pol suppressed optA1 sensitivity of P424L T4 phage.23 Here, we found that the G466S T4 phage is sensitive to PAA, which adds to the examples of mutual suppression of PAA-sensitive and E. coli optA1-sensitive T4 DNA pol mutants (Figure 4). Considering the fact that Ser is highly conserved in the drug-sensitive herpes family DNA pols and Gly is highly conserved in the drug-resistant family B DNA pols (Figure 3), PAA sensitivity of G466S T4 DNA pol indicated that residue S772 in HSV1 DNA pol is a viral determinant of PAA sensitivity. An important finding in this work is that Y460F substitution caused the G466S mutant T4 phage to be more PAA-sensitive; however, the Y460F mutant DNA pol-containing T4 phage was resistant to PAA. Y460 in T4 DNA pol that corresponds to F764 in HSV1 DNA pol is positioned to form H-bonds with residue N579, which suppresses optA1 sensitivity of P424L T4 DNA pol.23 The apparent Y460−N579 interaction is an adaptation for phage-specific replication conditions. Even if the amino acid substitutions that alter the Y460−N579 interaction do not confer PAA sensitivity, preventing this interaction may be required to make the herpes family DNA pols highly sensitive to PAA. PAA resistance of Y460F T4 DNA pol and increased PAA sensitivity of G466S T4 DNA pol suggest that S772 and F764 residues in HSV1 DNA pol play a role in determining its natural PAA sensitivity. Since residue Y460 in T4 DNA pol is not conserved in the family B DNA pols, our results provided important evidence to support the idea that genetic methods are a powerful tool for identifying potential amino acid substitutions that are neglected by structural comparison studies. Our findings demonstrated PAA sensitivity of V475W T4 DNA pol in vivo, which supports for PFA sensitivity of V478W

Figure 7. Steric clash between W478 in helix N and W365 in helix K in the N-terminal domain. Residues of interest are depicted in space fill; T4 DNA pol residues are indicated in parentheses. The N, P, I, J, and K helices are colored red, magenta, cyan, green, and yellow, respectively. Residues V478, Y350, W365, and A569 (T4 residues V475, Y347, W362, and A566) are depicted in red space fill. (a) Open and (b) closed conformations show the steric clash between W478 and W365 in helix K in the N-terminal domain. The open (PDB ID: 1Q9X) and closed (PDB ID: 1IG9) RB69 DNA pol structures were adapted from Freisinger, E.; Grollman, A. P.; Miller, H.; and Kisker, C. Lesion (in)tolerance reveals insights into DNA replication fidelity. EMBO J. 2004, 23, 1494−14505.34 Reproduced with permission from EMBO. They were also based on data from Franklin et al.33

S775 in HSV1 DNA pol is analogous to residue P469 in T4 DNA pol. Thus, residue S775 in HSV1 DNA pol is not a natural determinant of PAA sensitivity. Replication Fidelity of T4 Phages Containing Mutant DNA Pol. Replication fidelity of the T4 phages containing mutant DNA pol was determined by reversion of an rII mutant, which is a well-established assay for measuring DNA pol fidelity in vivo.23 rII reversion frequency increased 11-fold in the case of G466S T4 phage, thus supporting the idea that PAA-sensitive T4 DNA pol mutant has increased mutation frequency. G466S T4 phage had a mutation frequency similar to that of L412M T4 phage, which exhibited a nine-fold increase in the reversion frequency (Table 2) despite the former being relatively less PAA-sensitive than the latter. PAA-sensitive Y460F/G466S T4 phage exhibited a 22-fold increase in the reversion frequency. The highest increase in reversion frequency, approximately 70fold, was observed for the V475W T4 phage. Its replication fidelity was restored by A566T and Y347C substitutions, which also suppressed PAA sensitivity. Interestingly, the reversion frequency of the P469S T4 phage decreased five-fold when compared to that of the wild-type T4 phage, which suggested that this mutation was helpful for DNA replication fidelity. 1989

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology RB69 DNA pol in vitro.9 PAA sensitivity of V475W T4 DNA pol resulted from a steric clash between the two tryptophans (W475 and W362) in helix N and helix K (Figure 7A,B), respectively. Since V475 and W362 residues in T4 DNA pol correspond to W781 and V621 residues in HSV1 DNA pol (Figures 3), respectively, the corresponding steric clash in V475W T4 DNA pol was not observed in HSV1 DNA pol. Recent studies showed that W781 V substitution in HSV1 DNA pol and W780 V substitution in HCMV DNA pol conferred resistance to PFA with 3- and 1.5-fold increases in 50% effective concentrations, respectively.28 Thus, residue W781 in HSV1 DNA pol may be a determinant of drug sensitivity. However, V475W T4 DNA pol was a weak DNA pol, suggesting that this DNA pol is not a superior surrogate that mimics the usual drug sensitivity of the herpes family DNA pols. Genetic studies showed that A566T and L567F substitutions suppressed PAA sensitivity of V475W T4 DNA pol and optA1 sensitivity of P424L T4 DNA pol,23 respectively. These residues, in reverse order (A566 and L567 residues in T4 DNA pol correspond to T820 and F821 residues in HSV1 DNA pol, respectively), are found in the herpes family DNA pols and in the yeast and human DNA pol δ (Figure 8). Thus,

DNA pols may have the ability to maintain the stability of pol complexes at pause sites but still retain the ability to proofread mismatches. In this work, we provided evidence that P469S substitution increased the replication fidelity of T4 DNA pol (Table 2), suggesting that S775 residue in HSV1 is important for replication fidelity since P469 residue in T4 DNA pol corresponds to S775 residue in HSV1 DNA pol. In the future, we will test if P469S substitution increases the replication fidelity of Y460F/G466S T4 DNA pol without decreasing PAA sensitivity. Thus, the engineered PAA-sensitive T4 DNA pol that retains robust pol activity must also have high fidelity. In conclusion, we first revealed PAA sensitivity of mutant G466S and G466S/Y460F T4 DNA pols. V475W T4 DNA pol was found to be highly sensitive to PAA, but weak as a DNA pol that also acquired optA1 sensitivity. G466S, G466S/Y460F, and V475W T4 DNA pols displayed mutator phenotype with varied mutation frequency. Our findings revealed for the first time the molecular basis for natural drug sensitivity of the herpes DNA pols and provided new insight into DNA pol function in specific environments. Future studies will focus on purifying G466S and G466S/Y460F T4 DNA pols and investigate their sensitivity to PAA and their biochemical characteristics including processivity and fidelity. It is a remote possibility that we will engineer a T4 DNA pol with multiple mutations that is a superior and rigorous surrogate that mimics the drug sensitivity of the herpes family DNA pols.

■

AUTHOR INFORMATION

Corresponding Author

*E-mail: [email protected]. Phone: +86-514-89795882. Fax: +86-514-87357891. ORCID

Likui Zhang: 0000-0002-4662-1107 Funding

All of the research was funded by the Canadian Institutes of Health Research and the Natural Sciences and Engineering Research Council of Canada grants to Linda J. Reha-Krantz at University of Alberta, Canada. Funding to pay the publication charges for this article was provided by the National Natural Science Foundation of China (No. 41306131) and the Natural Science Foundation of Jiangsu Province grant (No. BK20130440) to L.Z.

Figure 8. Alignment of helix P (fingers domain) amino acid sequences of several family B DNA pols. Highly conserved Motif B residues are shown in red. Block B and Block C residues described in refs 9 and 22 are boxed. Q807A substitution in Block B of HCMA DNA pol conferred resistance to PFA, whereas the K805Q-containing mutant enzyme showed an increased susceptibility to PFA.35,36 V812L mutation in HCMV DNA pol was associated with a moderate (2− 3-fold) decrease in susceptibility to PFA.37 Genetic studies identified A566T and L567F as the amino acid substitutions that suppress PAA sensitivity of V475W T4 DNA pol and optA1 sensitivity of P424L T4 DNA pol.23 These residues are found in reverse order in herpes family DNA pols and in yeast and human DNA pol δ.

Notes

The author declares no competing financial interest.

■

ACKNOWLEDGMENTS

The author expresses special thanks to Prof. Linda J. RehaKrantz at University of Alberta since all of the work was done in their lab. The author also thanks Prof. Linda J. Reha-Krantz for designing the experiments, providing interpretations, and editing the manuscript.

these studies illustrate the advantage of assessing the activity of mutant DNA pols in vivo using genetic methods. Mutational analyses are in progress to determine if amino acid substitutions, which prevent domain clashing but allow V475W substitution to confer PAA sensitivity, can be identified. One consequence of increased PAA sensitivity of DNA pol is reduced replication fidelity as proofreading is compromised when the stability of the pol complexes is increased. Although herpes infections induce dNTP pool imbalances,29 the highly PAA/PFA-sensitive HSV1 DNA pol replicates DNA in vivo with accuracy similar to that of cellular DNA pols.30,31 The relatively high fidelity and PAA/PFA sensitivity of the herpes

■

ABBREVIATIONS DNA pol, DNA polymerase; HCMV, human cytomegalovirus; HSV1, herpes simplex virus 1; NPL, a new motif composed of conserved residues in interacting loops in the N-terminal (N) and palm (P) domains and a highly conserved proline residue in the linker region (L) that connects the N-terminal and palm domains; PAA, phosphonoacetic acid; PDB, Protein Data Bank; PFA, phosphonoformic acid; RT, reverse transcriptase 1990

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology

■

(18) Hariharan, C., and Reha-Krantz, L. J. (2005) Using 2aminopurine fluorescence to detect bacteriophage T4 DNA polymerase-DNA complexes that are important for primer extension and proofreading reactions. Biochemistry 44, 15674−15684. (19) Reha-Krantz, L. J., Woodgate, S., and Goodman, M. F. (2014) Engineering processive DNA polymerases with maximum benefit at minimum cost. Front. Microbiol. 5, 380. (20) Reha-Krantz, L. J., Hariharan, C., Subuddhi, U., Xia, S., Zhao, C., Beckman, J., Christian, T., and Konigsberg, W. (2011) Structure of the 2-aminopurine-cytosine base pair formed in the polymerase active site of the RB69 Y567A-DNA polymerase. Biochemistry 50, 10136−10149. (21) Reha-Krantz, L. J. (2010) DNA polymerase proofreading: Multiple roles maintain genome stability. Biochim. Biophys. Acta, Proteins Proteomics 1804, 1049−1063. (22) Reha-Krantz, L. J., and Nonay, R. L. (1994) Motif A of bacteriophage T4 DNA polymerase: role in primer extension and DNA replication fidelity. Isolation of new antimutator and mutator DNA polymerases. J. Biol. Chem. 269, 5635−5643. (23) Li, V., Hogg, M., and Reha-Krantz, L. J. (2010) Identification of a new motif in family B DNA polymerases by mutational analyses of the bacteriophage T4 DNA polymerase. J. Mol. Biol. 400, 295−308. (24) Zhang, L., Kang, M., Xu, J., and Huang, Y. (2015) Archaeal DNA polymerases in biotechnology. Appl. Microbiol. Biotechnol. 99, 6585−6597. (25) Zhang, L., Radziwon, A., and Reha-Krantz, L. J. (2014) Targeted mutagenesis of a specific gene in yeast. Methods Mol. Biol. 1163, 109− 129. (26) Lin, T. C., Rush, J., Spicer, E. K., and Konigsberg, W. H. (1987) Cloning and expression of T4 DNA polymerase. Proc. Natl. Acad. Sci. U. S. A. 84, 7000−7004. (27) Gauss, P., Gayle, M., Winter, R. B., and Gold, L. (1987) The bacteriophage T4 dexA gene: sequence and analysis of a gene conditionally required for DNA replication. Mol. Gen. Genet. 206, 24− 34. (28) Piret, J., Goyette, N., Eckenroth, B. E., Drouot, E., Gotte, M., and Boivin, G. (2015) Contrasting effects of W781V and W780V mutations in helix N of herpes simplex virus 1 and human cytomegalovirus DNA polymerases on antiviral drug susceptibility. J. Virol. 89, 4636−4644. (29) Jamieson, A. T., and Bjursell, G. (1976) Deoxyribonucleoside triphosphate pools in cells infected with deoxypyrimidine kinase less herpes simplex virus. J. Gen. Virol. 31, 115−123. (30) Hwang, Y. T., Zuccola, H. J., Lu, Q., and Hwang, C. B. (2004) A point mutation within conserved region VI of herpes simplex virus type 1 DNA polymerase confers altered drug sensitivity and enhances replication fidelity. J. Virol. 78, 650−657. (31) Hwang, Y. T., Liu, B. Y., Hong, C. Y., Shillitoe, E. J., and Hwang, C. B. (1999) Effects of exonuclease activity and nucleotide selectivity of the herpes simplex virus DNA polymerase on the fidelity of DNA replication in vivo. J. Virol. 73, 5326−5332. (32) Mousavi-Jazi, M., Schloss, L., Drew, W. L., Linde, A., Miner, R. C., Harmenberg, J., Wahren, B., and Brytting, M. (2001) Variations in the cytomegalovirus DNA polymerase and phosphotransferase genes in relation to foscarnet and ganciclovir sensitivity. J. Clin. Virol. 23, 1− 15. (33) Franklin, M. C., Wang, J., and Steitz, T. A. (2001) Structure of the replicating complex of a pol alpha family DNA polymerase. Cell 105, 657−667. (34) Freisinger, E., Grollman, A. P., Miller, H., and Kisker, C. (2004) Lesion (in)tolerance reveals insights into DNA replication fidelity. EMBO J. 23, 1494−14505. (35) Tchesnokov, E. P., Gilbert, C., Boivin, G., and Götte, M. (2006) Role of helix P of the human cytomegalovirus DNA polymerase in resistance and hypersusceptibility to the antiviral drug foscarnet. J. Virol. 80, 1440−1450. (36) Martin, M., Azzi, A., Lin, S. X., and Boivin, G. (2010) Opposite effect of two cytomegalovirus DNA polymerase mutations on replicative capacity and polymerase activity. Antiviral Ther. 15, 579− 586.

REFERENCES

(1) Fraley, A. W., Chen, D., Johnson, K., and McLaughlin, L. W. (2003) An HIV reverse transcriptase-selective nucleoside chain terminator. J. Am. Chem. Soc. 125, 616−617. (2) Anderson, K. S. (2002) Perspectives on the molecular mechanism of inhibition and toxicity of nucleoside analogs that target HIV-1 reverse transcriptase. Biochim. Biophys. Acta, Mol. Basis Dis. 1587, 296− 299. (3) Painter, G. R., Almond, M. R., Mao, S., and Liotta, D. C. (2004) Biochemical and mechanistic basis for the activity of nucleoside analogue inhibitors of HIV reverse transcriptase. Curr. Top. Med. Chem. 4, 1035−1044. (4) Bouchard, J., Walker, M. C., Leclerc, J. M., Lapointe, N., Beaulieu, R., and Thibodeau, L. (1990) 5-azacytidine and 5-azadeoxycytidine inhibit human immunodeficiency virus type 1 replication in vitro. Antimicrob. Agents Chemother. 34, 206−209. (5) McMahon, M. A., Siliciano, J. D., Lai, J., Liu, J. O., Stivers, J. T., Siliciano, R. F., and Kohli, R. M. (2008) The antiherpetic drug acyclovir inhibits HIV replication and selects the V75I reverse transcriptase multidrug resistance mutation. J. Biol. Chem. 283, 31289−31293. (6) Allaudeen, H. S., Descamps, J., and Sehgal, R. K. (1982) Mode of action of acyclovir triphosphate on herpesviral and cellular DNA pols. Antiviral Res. 2, 123−133. (7) Reardon, J. E. (1989) Herpes simplex virus type 1 and human DNA pol interactions with 2′-deoxyguanosine 5′-triphosphate analogues. Kinetics of incorporation into DNA and induction of inhibition. J. Biol. Chem. 264, 19039−19044. (8) Neyts, J., and De Clercq, E. (1994) Mechanism of action of acyclic nucleoside phosphonates against herpes virus replication. Biochem. Pharmacol. 47, 39−41. (9) Zahn, K. E., Tchesnokov, E. P., Gotte, M., and Doublie, S. (2011) Phosphonoformic acid inhibits viral replication by trapping the closed form of the DNA polymerase. J. Biol. Chem. 286, 25246−25255. (10) Ducancelle, A., Champier, G., Alain, S., Petit, F., Le Pors, M. J., and Mazeron, M. C. (2006) A novel mutation in the UL54 gene of human cytomegalovirus isolates that confers resistance to foscarnet. Antivir. Ther. 11, 537−540. (11) Baldanti, F., Underwood, M. R., Stanat, S. C., Biron, K. K., Chou, S., Sarasini, A., Silini, E., and Gerna, G. (1996) Single amino acid changes in the DNA polymerase confer foscarnet resistance and slow-growth phenotype, while mutations in the UL97-encoded phosphotransferase confer ganciclovir resistance in three doubleresistant human cytomegalovirus strains recovered from patients with AIDS. J. Virol. 70, 1390−1395. (12) Tchesnokov, E. P., Obikhod, A., Schinazi, R. F., and Gotte, M. (2009) Engineering of a chimeric RB69 DNA polymerase sensitive to drugs targeting the cytomegalovirus enzyme. J. Biol. Chem. 284, 26439−26446. (13) Marchand, B., Tchesnokov, E. P., and Gotte, M. (2007) The pyrophosphate analogue foscarnet traps the pre-translocational state of HIV-1 reverse transcriptase in a Brownian ratchet model of polymerase translocation. J. Biol. Chem. 282, 3337−3346. (14) Beilhartz, G. L., Wendeler, M., Baichoo, N., Rausch, J., Le Grice, S., and Gotte, M. (2009) HIV-1 reverse transcriptase can simultaneously engage its DNA/RNA substrate at both DNA polymerase and RNase H active sites: implications for RNase H inhibition. J. Mol. Biol. 388, 462−474. (15) Hogg, M., Cooper, W., Reha-Krantz, L., and Wallace, S. S. (2006) Kinetics of error generation in homologous B-family DNA polymerases. Nucleic Acids Res. 34, 2528−2535. (16) Chen, H., Beardsley, G. P., and Coen, D. M. (2014) Mechanism of ganciclovir-induced chain termination revealed by resistant viral polymerase mutants with reduced exonuclease activity. Proc. Natl. Acad. Sci. U. S. A. 111, 17462−17467. (17) Reha-Krantz, L. J., Nonay, R. L., and Stocki, S. (1993) Bacteriophage T4 DNA polymerase mutations that confer sensitivity to the PPi analog phosphonoacetic acid. J. Virol. 67, 60−66. 1991

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992

Article

Chemical Research in Toxicology (37) Cihlar, T., Fuller, M. D., Mulato, A. S., and Cherrington, J. M. (1998) A point mutation in the human cytomegalovirus DNA polymerase gene selected in vitro by cidofovir confers a slow replication phenotype in cell culture. Virology 248, 382−393.

1992

DOI: 10.1021/acs.chemrestox.7b00132 Chem. Res. Toxicol. 2017, 30, 1984−1992