Article pubs.acs.org/JAFC
Novel Effect of Adenosine 5′-Monophosphate on Ameliorating Hypertension and the Metabolism of Lipids and Glucose in StrokeProne Spontaneously Hypertensive Rats Ardiansyah,†,*,§ Hitoshi Shirakawa,† Takuya Koseki,# Kazuyuki Hiwatashi,⊗ Saori Takahasi,⊗ Yoshinobu Akiyama,⊥ and Michio Komai† †
Laboratory of Nutrition, Graduate School of Agricultural Science, Tohoku University, Sendai, Japan Division of Food Management and Environmental Health, Department of Community Nutrition, Faculty of Human Ecology, Bogor Agricultural University (IPB), Bogor, Indonesia # Department of Bioresource Engineering, Faculty of Agriculture, Yamagata University, Tsuruoka, Japan ⊗ Akita Research Institute for Food and Brewing, Akita, Japan ⊥ Faculty of Bioresource Sciences, Akita Prefectural University, Akita, Japan §
ABSTRACT: The aim of the study was to investigate the effects of adenosine 5′-monophosphate (AMP) in stroke-prone spontaneously hypertensive rats (SHRSP). Male rats (10 weeks old) were divided into three groups: a control group fed an AIN93 M diet and two others fed supplemental AMP (17.5 and 87.5 mg/kg diet) for 3 weeks. AMP effectively improved hypertension, plasma triglyceride, and HDL-cholesterol, glucose, kidney function parameters, hepatic lipid, enhances plasma nitric oxide, and plasma adiponectin accompanied by the up-regulation of mRNA expression levels of the hepatic adiponectin receptor 2. Single and chronic oral administration of AMP affected the hepatic mRNA expression levels of genes involved in βoxidation, fatty acid synthesis, and AMP-activated protein kinase. Furthermore, a single oral dose of AMP (40 mg/kg body weight) improved hypertension and hyperglycemia in SHRSP. In conclusion, AMP displays a novel effect in ameliorating metabolic-related diseases in SHRSP and could be beneficial as a functional food. KEYWORDS: adenosine monophosphate, glucose, hypertension, lipid, stroke-prone spontaneously hypertensive rats
■
role in thermoregulation and induces hypothermia in mice and humans; these effects are mediated via adenosine receptors. 5,6 In our previous study using stroke-prone spontaneously hypertensive rats (SHRSP), we showed that oral administration of adenosineone of the nucleoside’s components and one of the bioactive compounds in rice branhas novel effects on lowering blood pressure (BP) and improving hyperlipidemia and hyperinsulinemia caused by the down-regulation of the hepatic mRNA adenosine A2B receptor.7,8 Other studies suggest that nucleosides can help prevent lifestyle-related diseases such as obesity and diabetes mellitus by decreasing the small intestine’s glucose absorption and by inhibiting the nucleosides on the mucosal enzymes that digest sucrose, maltose, and malto- and isomalto-oligosaccharides.9,10 Nevertheless, we still do not fully understand the mechanisms by which AMP exerts its beneficial effects on metabolic-related diseases; therefore, in this study we investigated the effects of AMP intake and its physiological effect on BP reduction and improvement of lipid and glucose metabolism in SHRSP, an animal model of hypertension-related disorders similar to human essential hypertension and dyslipidemia.
INTRODUCTION
The medical disorders that comprise metabolic-related disease, such as hypertension, dyslipidemia, glucose intolerance, and hyperinsulinemia, are associated with lifestyle-related diseases throughout the world.1 These diseases have become a significant problem in recent years, especially in developed countries. To treat and prevent these diseases, nutritionists and food technologists have been investigating physiologically active components derived from plants, animals, and microorganisms.2 Various active components have long been reported to have preventative or ameliorative effects on many diseases including metabolic-related diseases and cancer. Increasing knowledge of the link between diet and health has generated interest in the use of active compounds derived from food as functional food ingredients and nutraceuticals in therapeutic applications.3 Adenosine 5′-monophosphate (AMP), also known as a natural molecule of adenosine triphosphate metabolism, is an endogenous purine nucleotide found in all living organisms. Furthermore, AMP and certain related compounds may bind to bitter-responsive taste receptors or interfere with receptor-G protein coupling to serve as naturally occurring taste modifiers. 4 AMP has been approved by the U.S. Food and Drug Administration as a bitter blocker additive and flavor enhancer in some foods such as chewing gum, snack food, coffee, and soup. Recent studies have provided evidence that AMP plays a © 2011 American Chemical Society
Received: Revised: Accepted: Published: 13238
August 12, 2011 November 18, 2011 November 21, 2011 November 21, 2011 dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry
Article
Table 1. Polymerase Chain Reaction Primer Sequences genea
forward primer
reverse primer
Ef-1 Pparα Vlcad Aox1 Cpt1 Fasn Acaca G6pc Pck1 Prkaa1 Adipor2
GATGGCCCCAAATTCTTGAAG TGTGGCTGCTATAATTTGCTGTG GTGCTCAATGAAGGACAGACACA TTCGTGCAGCCAGATTGGT GGTGGAGCTCTTTGACTTTGAGAA GGCTCACACACCTACGTATTGG TTGTGGAAGTGGAAGGCACAG TTGTGCATTTGCTAGGAAGAGAAG GAGGACATTGCCTGGATGAAGTTT CGGGAAAATCCGCAGAGAG GTCTGGTTTTAGGCACTCCTTTG
GGACCATGTCAACAATTGCAG CTCCTGCAACTTCTCAATGTATCCT CACTGGTCCCACCAGCTCTT CGAACAAGGTCGACAGAGGTTAG GGCTAGAGAACTTGGAAGAAATATGG TGCTTAATGAAGAAGCATATGGCTT CCTTATTATTGTCCCAGACGTAAGC ATCTAAAGACCCAGGCATAACTGAAG TGGGTTGATGGCCCTTAAGT TGAGGGTGCCTGAAAAGCTT CCCTGCCCCCATGTCTTAA
a
Ef-1, eukaryotic elongation factor-1α1; Pparα, peroxisome proliferator-activated receptorα; Vlcad, very long chain acyl-CoA dehydrogenase; Aox1, acyl-CoA oxidase; Cpt1, carnitine palmitoyltransferase 1; Fasn, fatty acid synthase; Acaca, acetyl-CoA carboxylase α; G6pc, glucose-6-phosphatase, catalytic subunit; Pck1, phosphoenolpyruvate carboxykinase 1; Prkaa1, AMP-activated protein kinase, α1 catalytic subunit; Adipor2, adiponectin receptor 2.
■
measured by enzymatic colorimetric methods (Wako Pure Chemical Co.) according to the manufacturer’s protocol. Low-density lipoprotein (LDL)-cholesterol was calculated according to the Friedewald formula: (TC − HDL-cholesterol) − (1/5 × TG).12 Plasma insulin levels were measured with a rat insulin ELISA kit from Shibayagi Co. (Gunma, Japan). The nitric oxide (NO) level in the plasma was quantified by the Griess method [NO2/NO3 Assay kit-C II (Colorimetric) Dojindo, Kumamoto, Japan], as described previously. 11 Plasma adiponectin levels were measured with a rat adiponectin ELISA kit from Otsuka Co. (Tokyo, Japan). Total liver lipids were determined according to the Folch method.13 Liver TC and TG concentrations were determined with the same kit as used for plasma TC and TG, following the extraction of liver samples with methanol/ chloroform (1:2, v/v). Oral Glucose Tolerance Test (OGTT). OGTTs were conducted on 12-week-old SHRSP that had fasted for 16 h. Blood for glucose measurement was collected from the tail vein 30, 60, and 120 min before and after the rats were fed glucose (1.8 g/kg body weight) via a gastric tube. Plasma glucose and insulin levels were measured as described above. The analysis of the incremental area under the curve (iAUC) of the plasma glucose and insulin response was calculated on the basis of the Wolever and Jenkins method.14 RNA Preparation and Quantitative RT-PCR. Total RNA was isolated from the liver with a guanidine isothiocyanate based reagent, Isogen (Nippon Gene, Japan), according to the instruction manual. The wavelength ratio at 260 and 280 nm was measured and agarose gel electrophoresis performed to facilitate the quantitative and qualitative analysis of the isolated RNA. A total of 5 μg of RNA as template was used to synthesize the cDNA (cDNA). The RNA was denaturated with oligo-dT/random primers in 10 mmol/L deoxyribonucleotide (Amersham Biosciences, Tokyo, Japan) at 65 °C for 5 min. The RNA was then incubated in 50 mmol/L Tris-HCl buffer (pH 8.3); 0.1 mol/L DTT containing 50 units of SuperScript III reverse transcriptase (Invitrogen, Carlsberg, CA) and 20 units of RNaseOUT RNase inhibitor (Invitrogen) were added in 20 μL at 25 °C for 5 min, at 50 °C for 60 min, and at 70 °C for 15 min. Aliquots of the cDNA were used as a template for the subsequent quantitative RT-PCR with an Applied Biosystems 7300 Real Time PCR System (Foster City, CA) and a SYBR Premix Ex Taq (Takara Bio Inc., Shiga, Japan), according to the manufacturers' instructions. The relative gene expression levels were normalized by the amount of eukaryotic elongation factor-1α1 mRNA.15 Table 1 lists the genes that were amplified by cDNA specific primers. Western Blot Analysis. The rat livers were homogenized in a PBS buffer containing 1 mmol/L phenylmethanesulfonyl fluoride, inhibitors for proteinase (complete proteinase inhibitor cocktail, Roche Applied Science, Mannheim, Germany), and phosphatase (PhosSTOP phosphatase inhibitor cocktail, Roche Applied Science). Protein concentration was measured in the lysate with a protein assay
MATERIALS AND METHODS
Animal Experiments. Male SHRSP/Izumo strain (Japan SLC, Shizuoka, Japan) were used in these studies. The rats were housed in individual stainless steel cages in a controlled atmosphere (temperature, 23 ± 2 °C; humidity, 50 ± 10%; 12 h light−dark cycle). At the beginning of both studies, we categorized and used animals with the same body weight before administration of AMP. The experimental plan for the present study was approved by the Animal Research− Animal Care Committee of Tohoku University (no. 20-dounou-21). The entire experiment was conducted in accordance with the guidelines issued by this committee and the Japanese governmental legislation (2005). The same committee supervised the care and use of the rats used in the present study. BP Measurements. The systolic and diastolic BP were measured using the tail cuff method with a BP meter without warming (MK2000, Muromachi Kikai, Tokyo, Japan), as described previously. 11 At least six BP measurements have been performed for each rat. The average value of four consistent readings of the systolic BP was regarded as the individual systolic BP. Single Oral Dose of AMP. After a 1-week acclimatization period, the 13-week-old rats were divided into two groups: one group was the control and the other, the AMP group. The AMP used in this study was kindly provided from Yamasa Co. (Chiba, Japan). After the rats fasted for 16 h, an oral dose of AMP dissolved in distilled water was administered to the SHRSP (40 mg/kg body weight) and distilled water to the control group (1 mL) via a gastric tube. The BP was measured before the dose and 1, 2, 4, and 6 h after the administration; then blood was collected from the tail veins (300 μL) and the plasma separated for later analysis. One week later, the rats were given adenosine again by the same procedure and sacrificed 2 h after oral administration under light diethyl ether anesthesia. Blood from the abdominal aorta was collected, and the plasma was separated for later analysis; livers were dissected for later mRNA analysis. Chronic Administration of AMP. After a 1 week acclimatization period, 10-week-old SHRSP wrtr divided into three groups: the control group was fed an AIN 93 M diet, and the two others were fed AMP at 17.5 mg/kg (AMP1) and 87.5 mg/kg of diet (AMP2), respectively, for 3 weeks. The rats had free access to fresh food and drinking water during the experimental period. The food intake was recorded every day. The systolic and diastolic BP and body weight were measured every week during the experimental period. At the end of the experimental period, the rats were sacrificed under diethyl ether anesthesia after 16 h of fasting. Blood from the abdominal aorta was collected, and the plasma was immediately separated by centrifugation and stored at −20 °C until later analysis. Liver and epididymal fat were excised and weighed. Livers were frozen at −80 °C until later analysis. Analytical Procedures. Plasma levels of total cholesterol (TC), triglyceride (TG), high-density lipoprotein (HDL)-cholesterol, glucose, blood urea nitrogen (BUN), creatinine, and albumin were 13239
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry
Article
reagent (Bio-Rad, Hercules, CA). We then mixed 7.5 μg of protein with SDS gel loading buffer and resolved the mixture on a 10−20% SDS−polyacrylamide gel electrophoresis (Wako Pure Chemical Industries); subsequently, the proteins were transferred onto a polyvinylidene fluoride membrane (Millipore). The membrane was subjected to blocking for 1 h with Tris-buffered saline with Tween 20 (10 mmol/L Tris-HCl at pH 7.4, 150 mmol/L NaCl, and 0.1% Tween 20) containing 5% fat-free dried milk against antibodies anti-AMPKα1 (Millipore) and bovine serum albumin (Sigma, St. Louis, MO) against antibodies antiphospho-AMPKα (Thr172; Millipore). Immobilon Western Detection Reagent (Millipore) was used with a luminescent image analyzer LAS-4000 mini (Fujifilm, Tokyo, Japan). The relative expression levels of each protein were normalized according to the amount of α-tubulin detected by its antibody (Sigma). Data Analysis. Values have been presented as the mean ± SEM. Statistical analysis was performed by the repeated measurement of one-way analysis of variance followed by Fisher’s test. Probabilities of p < 0.05 and 0.01 were considered to indicate a significant difference among the means. For the single-dose experiment, the differences between group means were evaluated by Student’s t test (SPSS statistical package, version 11.0). Differences were considered to be significant at p < 0.05.
■
RESULTS Effect of Single Oral Dose of AMP on BP and Plasma Parameters. Thirteen-week-old male SHRSP were used in this study. Those rats having hypertension and a systolic BP of approximately 200 mm/Hg were used to investigate whether or not AMP showed antihypertensive activities after a single oral dose of AMP at 40 mg/kg body weight (Figure 1A). The systolic BP of the control group was almost constant for 6 h with slight decreases at 6 h after the administration of the AMP dose. After the administration of AMP to the SHRSP, a BP lowering effect was observed at 1, 2, and 4 h; after 4 h, the BP was similar in both groups of SHRSP. The maximum reduction of BP was approximately 30 mmHg after 1 h (p < 0.01) and 20 mmHg after 2 h (p < 0.01) as compared with the control group. Furthermore, we also investigated whether or not a single dose of AMP lowered blood glucose levels (Figure 1B). A single oral dose of AMP can reduce glucose levels at 1 h (p < 0.05) and 4 h (p < 0.01) after administration, respectively, as compared with the control group. There was no difference in plasma TC and TG among the groups after a single oral dose (data not shown). Effect of Chronic Administration of AMP on Body Weight and Daily Food Intake. At the end of the experimental period, dietary intake of AMP did not affect food intake, weight gain, final body weight, food efficiency ratio, or relative weight of organs such as the liver, kidney, heart, epididymial fat, and abdominal fat (data not shown). The intakes of both AMP groups were 0.34 ± 0.01 (AMP1) and 1.75 ± 0.01 mg/day (AMP2), respectively. Effect of Chronic Administration of AMP on BP and Plasma NO Levels. Intake of AMP in both groups affected the systolic and diastolic BP of the rats during the experimental period, shown in Figure 2A,B. The systolic BP in the AMP groups significantly decreased from the first week of the experiment until the end of the experiment as compared with the control group (p < 0.01). At the end of the experimental period, the mean systolic BP was 202.2 ± 4.4, 170.0 ± 3.7, and 176.4 ± 5.4 mmHg for the control, AMP1, and AMP2 groups, respectively. Intake of AMP significantly reduced diastolic BP in both groups starting in the first and second weeks of the experimental period compared with the control group; after this time period, the diastolic BP returned to a basal condition
Figure 1. Effect of a single AMP oral dose (40 mg/kg body weight) on systolic blood pressure (A) and plasma glucose (B) in rats. Values are expressed as the mean ± SEM, n = 4. (∗) p < 0.05 and (†) p < 0.01, significant difference when compared with the control group.
similar to that of the control group. Furthermore, both AMP groups had significantly higher plasma NO levels when compared with the control group (p < 0.05; Figure 2C). This result corresponds well with the hypotensive effect of AMP on the systolic and diastolic BP shown in Figure 2A,B. Effect of Chronic Administration of AMP on Plasma and Hepatic Lipid Parameters. Table 2 summarizes the plasma and hepatic lipid contents and the plasma parameters of kidney function measured in this study. At the end of the study, the AMP groups had significantly lower plasma TG levels (p < 0.05), BUN and albumin levels (p < 0.01), and hepatic TG and TC levels (p < 0.05) as compared with the control group (p < 0.05). Intake of AMP at the proportion of 87.5 mg/kg diet caused a significant increase in plasma HDL-cholesterol levels and a decrease in plasma creatinine levels (p < 0.05). Furthermore, there was no difference in the plasma TC, LDL-cholesterol, and hepatic total lipid contents among the groups. After 3 weeks, the AMP rats exhibited a significant reduction of plasma glucose (p < 0.01) and insulin levels (p < 0.05) as compared with the control rats (Table 3). Both AMP groups also showed significant increases in the levels of plasma adiponectin as compared with the control group (p < 0.05; Table 3). To determine whether or not AMP improves glucose tolerance, we performed OGTTs after 2 weeks of AMP intake at a dose of 1.8 g glucose/kg body weight. AMP significantly increased the glucose tolerance response during 2 h OGTTs 13240
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry
Article
Table 2. Plasma and Liver Biochemical Parameters of LongTerm AMP Administration in SHRSPa biochemical parameter total cholesterol (mmol/L) HDL-cholesterol (mmol/L) LDL-cholesterol (mmol/L) triglyceride (mmol/L) BUN (mmol/L) creatinine (μmol/L) albumin (μmol/L) total lipid (mg/g) total cholesterol (mg/g) triglyceride (mg/g)
control
AMP1
AMP2
Plasma 1.75 ± 0.11
1.75 ± 0.09
1.71 ± 0.05
0.77 ± 0.05
0.87 ± 0.03
0.92 ± 0.05*
0.81 ± 0.11
0.76 ± 0.12
0.66 ± 0.07
0.83 ± 0.06 4.76 ± 0.19 65.46 ± 3.29 0.57 ± 0.01 Liver 59.0 ± 2.1 9.3 ± 1.0 38.0 ± 3.1
0.63 ± 0.05* 4.03 ± 0.19† 59.28 ± 4.47 0.51 ± 0.02†
0.65 ± 0.05* 3.83 ± 0.13† 52.32 ± 47* 0.50 ± 0.01†
53.8 ± 1.7 6.6 ± 0.9* 25.6 ± 2.5*
53.8 ± 3.0 5.8 ± 0.8* 25.1 ± 2.6*
a
AMP1 (17.5 mg/kg diet); AMP2 (87.5 mg/kg diet); BUN, blood urea nitrogen. Values are the mean ± SEM, n = 5−6. (*) p < 0.05 and (†) p < 0.01, significant difference versus control group
Table 3. Effect of AMP on Plasma Glucose, Insulin, and Adiponectin Levelsa biochemical parameter
control
AMP1
AMP2
glucose (mmol/L) insulin (ng/mL) adiponectin (μg/mL)
9.87 ± 0.24 2.8 ± 0.2 8.5 ± 0.2
8.34 ± 0.33† 2.4 ± 0.1* 9.3 ± 0.3*
8.40 ± 0.36† 2.2 ± 0.1* 10.0 ± 0.3*
a
AMP1 (17.5 mg/kg diet); AMP2 (87.5 mg/kg diet). Values are expressed as means ± SEM, n = 5−6. (*) p < 0.05 and (†) p < 0.01, significant difference when compared with the control group.
acyl-CoA dehydrogenase (Vlcad), acyl-CoA oxidase (Aox1), and carnitine palmitoyltransferase (Cpt1), were significantly up-regulated in the AMP2 group (p < 0.05) and tended to be higher in the AMP1 group than in the control group. Intake of AMP for 3 weeks aided the up-regulation of the hepatic gene expression levels involved in fatty acid synthesis such as Fasn and Acaca. Corresponding with the plasma adiponectin level (Table 3), we found that the mRNA expression of adiponectin receptor 2 (Adipor2) was significantly higher in the AMP2 group and tended to be higher in the AMP1 group, although not significantly, than in the control group. There were no significant differences among the groups regarding the mRNA expression levels of glucose-6-phosphatase, catalytic subunit (G6pc), and phosphoenolpyruvate carboxykinase 1 (Pck1). Effect of a Single Oral Dose and Chronic Administration of AMP on the Hepatic mRNA and the Protein Level of AMPK. To gain further insight into these mechanisms, we used a Western blot analysis to analyze the mRNA expression levels of the AMP-activated protein kinase, α1 (AMPKα1) catalytic subunit (Prkaa1; Figure 5), and the protein level of AMPKα1 (Figure 6) in the liver. The rats given AMP exhibited a significantly higher mRNA expression level of Prkaa1 in both studies than in the control groups. Western blot analysis showed that the administration of AMP slightly reduced the protein level of AMPKα1 and increased the PAMPKα compared with the control group; furthermore, the PAMPKα1−AMPK ratio was significantly higher (p < 0.05) in both AMP groups than in the control group.
Figure 2. Effect of chronic AMP administration on systolic blood pressure (A), diastolic blood pressure (B), and plasma nitric oxide (C) in rats. Values are expressed as the mean ± SEM, n = 5−6. (∗) p < 0.05 and (†) p < 0.01, significant difference when compared with the control group.
compared with the control group (Figure 3A). The iUAC was significantly reduced in the AMP groups compared with the control group (Figure 3B). In addition, the AMP groups tended to have lower plasma insulin levels during OGTTs (Figure 4A) than the control group, whereas only the AMP2 group showed a significantly reduced iAUC for insulin (p < 0.05; Figure 4B). Effect of a Single Oral Dose and Chronic Administration of AMP on Hepatic Gene Expression Levels. We measured the hepatic mRNA levels in SHRSP given a single oral dose of AMP (see Table 4); these rats exhibited a significant up-regulation of the mRNA of peroxisome proliferator-activated receptor α (Pparα) and acetyl-CoA carboxylase α (Acaca) compared with the control group (p < 0.05). Table 5 shows the effect of chronic AMP administration on mRNA expression levels. The relative mRNA expression levels of Pparα and its target genes, such as very long chain 13241
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry
Article
Figure 3. Changes in plasma glucose (A) and iAUC (B) of the oral glucose tolerance test in rats. Values are expressed as the mean ± SEM, n = 5−6. (∗) p < 0.05 and (†)p < 0.01, significant difference when compared with the control group.
Figure 4. Changes in plasma insulin (A) and iAUC (B) of the oral glucose tolerance test in rats. Values are expressed as the mean ± SEM, n = 5−6. (∗) p < 0.05, significant difference when compared with the control group.
■
DISCUSSION The present study is the first to demonstrate that both a single dose and chronic administration of AMP improve hypertension, glucose, and lipid metabolism in SHRSP; therefore, AMP is suggested as an appropriate ingredient in functional foods. We also discovered that AMP plasma NO in addition to lowering BP and up-regulating hepatic gene expression is involved in β-oxidation, fatty acid synthesis, and adiponectin receptor; AMP administration further aids AMPK’s contribution to improving glucose and lipid metabolism. Our results confirm the findings of previous studies7−10 suggesting that nucleosides may be useful for the prevention of lifestyle-related diseases in an animal model. A single dose of AMP at 40 mg/kg lowers BP within 4 h after administration; AMP also has the capacity to decrease plasma glucose levels with a maximum reduction at 4 h after the dose (Figure 1). In view of the results that AMP causes a reduction of BP and plasma glucose level after a single oral dose, we did further studies to examine the detailed mechanism. We found that a chronic intake of AMP increased the plasma NO levels (Figure 2C), and these results correspond well with the BP-lowering activity in the SHRSP (Figure 2A,B). Our previous studies on adenosine administration7,8 also showed that the increase of plasma NO levels is one of the underlying mechanisms in the hypotensive effect in the SHRSP. The metabolism of AMP was preferentially degraded to adenosine with a concomitant appearance of inosine and hypoxanthine;16 thus, the degradation of AMP to adenosine may be one of the major reasons why AMP administration improves vasodilatation in the SHRSP. Previous studies report that
Table 4. Effects of a Single Oral AMP Dose on Hepatic mRNA Expression Levels Measured by Quantitative RTPCRa gene Pparα Fasn Acaca G6pc Pck
control 1.0 1.0 1.0 1.0 1.0
± ± ± ± ±
0.2 0.2 0.2 0.3 0.1
AMP 2.1 1.6 2.7 0.7 0.7
± ± ± ± ±
0.4* 0.5 0.8* 0.2 0.1
a
Expression of mRNA (fold). Values are expressed as the mean ± SEM, n = 4. (*) p < 0.05), significant difference when compared with the control group. Genes: Pparα, peroxisome proliferator-activated receptor α; Fasn, fatty acid synthase; Acaca, acetyl-CoA carboxylase α; G6pc, glucose-6-phosphatase, catalytic subunit; Pck1, phosphoenolpyruvate carboxykinase 1.
adiponectin can stimulate NO production in endothelial cells and may lead to a vasodilatation effect.17 From this viewpoint, our results suggest that an enhancement of plasma NO (Figure 2C) due to an increase in the plasma adiponectin level (Table 3) may prevent the development of hypertension in SHRSP. However, further investigation is required to elucidate the actual mechanism responsible for this phenomenon. Several studies have indicated that AMPK plays a key role in the regulation of glucose and lipid metabolism; it serves as a metabolic master switch in response to alterations in cellular energy metabolism.18,19 AMPK activation affects the stimulation of hepatic fatty acid oxidation, the inhibition of cholesterol 13242
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry
Article
Table 5. Hepatic mRNA Expression Levels after Chronic AMP Administration, Measured by Quantitative RT-PCRa gene Pparα Vlcad Aox1 Cpt1 Fasn Acaca Adipor2 G6pc Pck1
control 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0
± ± ± ± ± ± ± ± ±
0.2 0.3 0.1 0.1 0.1 0.2 0.1 0.4 0.1
AMP1 1.6 1.1 1.1 1.4 2.9 2.8 1.7 0.8 0.9
± ± ± ± ± ± ± ± ±
0.1 0.4 0.1 0.1 0.7* 0.6† 0.6 0.2 0.3
AMP2 1.8 3.2 1.7 2.0 3.8 9.0 3.2 0.7 1.0
± ± ± ± ± ± ± ± ±
0.3* 1.2* 0.3* 0.3† 0.6† 1.8† 0.5† 0.3 0.1
a
AMP1 (17.5 mg/kg diet); AMP2 (87.5 mg/kg diet). Expression of mRNA (fold). Values are expressed as the mean ± SEM, n = 4. (*) p < 0.05 and (†)p < 0.01), significant difference when compared with the control group. Genes: Pparα, peroxisome proliferator-activated receptor α; Vlcad, very long chain acyl-CoA dehydrogenase; Aox1, acyl-CoA oxidase; Cpt1, carnitine palmitoyltransferase 1; Fasn, fatty acid synthase; Acaca, acetyl-CoA carboxylase α; Adipor2, adiponectin receptor 2; G6pc, glucose-6-phosphatase, catalytic subunit; Pck1, phosphoenolpyruvate carboxykinase 1.
Figure 6. Effect of AMP administration on AMPKα1, P-AMPKα, and the ratio of P-AMPKα, according to the Western blot quantitative analysis. Each lane was loaded with 7.5 μg of proteins. Data have been normalized with α-tubulin. Values are expressed as the mean ± SEM, n = 4. (∗) p < 0.05, significant difference when compared with the control group.
of AMP reduced the protein content of AMPKα1 due to an increase in P-AMPKα (Figure 6). In this study, we showed that AMP administration enhanced plasma adiponectin levels and improved the plasma and hepatic lipid profile (Tables 3 and 2). The results of the OGTTs clearly showed that AMP administration inhibited the increase in plasma levels of glucose, insulin, and their iAUC (Figures 3 and 4). Taken together these results suggest that AMP contributes to improving the regulation of glucose and lipid metabolism in SHRSP. Next, we observed the up-regulation of the mRNA expression level of Pparα after both a single dose of AMP and chronic administration (AMP2 group). Chronic administration caused the up-regulation not only of the Pparα expression level but also of its target genes, such as Vlcad, Aox1, and Cpt1, which promote the β-oxidation system. Adipor1 and/or Adipor2 knockout mice showed that Adipor1 and Adipor2 act as the major receptors for adiponectin in vivo and play important roles in the regulation of glucose and lipid metabolism.22 The increase in the β-oxidation system due to the intake of AMP is caused by the activation of phosphorylation of AMPKα and by the enhanced plasma adiponectin level. Adiponectin, a hormone secreted by adipocytes, regulates energy homeostasis, glucose, and lipid metabolism. Previous
Figure 5. Effect of AMP administration on the mRNA level of AMPactivated protein kinase, α1 catalytic subunit (Prkaa1) in the liver after a single dose (40 mg/kg body weight) (A) and after chronic administration (B). Values are expressed as the mean ± SEM, n = 4. (∗) p < 0.05 and (†) p < 0.01, significant difference when compared with the control group.
and triglyceride synthesis, lipogenesis, adipocyte lipolysis, and the modulation of insulin secretion by pancreatic β-cells.20 In the liver, AMPK activation decreases the production of glucose, TC, and TG and enhances fatty acid oxidation.21 In this study, we found that the administration of AMP increased hepatic mRNA levels of Prkaa1a catalytic subunit of AMPKand its function in energy metabolism (Figure 5). Furthermore, doses 13243
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry studies demonstrated that the phosphorylation and activation of AMPK are stimulated by the adiponectin receptor in the liver and parallel the stimulation of phosphorylation of Acaca. Furthermore, adiponectin improves insulin sensitivity and decreases plasma glucose, effects mediated by increasing fatty acid oxidation in the liver.23,24 Adipor2 is predominantly expressed in the liver and is mainly involved in the activation of the Pparα pathway, which up-regulates the expression of a suite of genes that includes mitochondrial, peroxisomal, and microsomal fatty acid oxidation enzymes in the liver.25 A recent study has reported that the up-regulation of Adipor2 expression is attributable to an increase of PPARα expression in nonalcoholic steatohepatitis.26 Our results corroborated a previous report that the intake of AMP can increase the plasma adiponectin levels, corresponding with up-regulation of the mRNA expression levels of Adipor2 and also of Fasn and Acaca, genes involved in fatty acid synthesis in the liver (Table 5). We suggested that the enhancement of the mRNA Adipor2 level in the liver and the enhancement of plasma adiponectin may be a promising strategy to combat metabolic-related diseases characterized by insulin resistance and hyperglycemia. Taken together, these results provide a novel paradigm: AMP can increase plasma adiponectin levels and activate phosphorylation of AMPKα toward enhanced β-oxidation gene expression levels in the liver. In turn, this process of enhancing expression can suppress lipid accumulation in the liver and improve glucose and lipid metabolism in SHRSP. In summary, our results clearly indicated that intake of AMP is effective in reducing BP as well as improving the plasma parameter of kidney function. We propose that intakes of AMP increase the plasma adiponectin level, up-regulate the hepatic Prkaa1 mRNA expression, and increase the P-AMPKα level toward enhanced gene expression of β-oxidation in the liver. The up-regulation of these genes’ expression can suppress lipid accumulation in the liver and improve glucose and lipid metabolisms in SHRSP. These novel findings suggest AMP’s potential as a food ingredient to reduce the risk factors for metabolic-related diseases. Further studies are needed to elucidate the complete physiological effect of AMP in other animal models and confirm the detailed mechanism at the level of molecular biology.
■
■
ABBREVIATIONS USED
■
REFERENCES
Acaca, acetyl-CoA carboxylase α; Adipor2, adiponectin receptor 2; AMP, adenosine 5′-monophosphate; AMPK, AMP-activated protein kinase; Aox1, acyl-CoA oxidase; BP, blood pressure; BUN, blood urea nitrogen; cDNA, cDNA; Cpt1, carnitine palmitoyltransferase 1; Fasn, fatty acid synthase; G6pc, glucose6-phosphatase, catalytic subunit; iAUC, incremental area under the curve; NO, nitric oxide; OGTT, oral glucose tolerance test; Pck1, phosphoenolpyruvate carboxykinase 1; Prkaa1, protein kinase, AMP-activated, α 1 catalytic subunit; SHRSP, strokeprone spontaneously hypertensive; TC, total cholesterol; TG, triglyceride; Vlcad, very long chain acyl-CoA dehydrogenase.
(1) Bonora, E.; Kiechl, S.; Willeit, J.; Oberhollenzer, F.; Egger, E.; Targher, G.; Alberiche, M.; Bonadonna, R. C.; Muggeo, M. Prevalence of insulin resistance in metabolic disorders: the Bruneck Study. Diabetes 1998, 47, 1643−1649. (2) Yoshikawa, M.; Fujita, H.; Matoba, N.; Takenaka, Y.; Yamamoto, T.; Yamauchi, R.; Tsuruki, H.; Takahata, K. Bioactive peptides derived from food proteins preventing lifestyle-related diseases. Biofactors 2000, 12, 143−146. (3) Ohama, H.; Ikeda, H.; Moriyama, H. Health foods and foods with health claims in Japan. Toxicology 2006, 221, 95−111. (4) Ding, M.; Yuzo, N.; Robert, F. M. Blocking taste receptor activation of gustducin gustatory responses to bitter compounds. Proc. Natl. Acad. Sci. U.S.A. 1999, 96, 9903−9908. (5) Zhang, F.; Wang, S.; Luo, Y.; Ji, X.; Nemoto, E. M. When hypothermia meets hypotension and hyperglycemia: the diverse effects of adenosine 50-monophosphate on cerebral ischemia in rats. J. Cereb. Blood Flow Metab. 2009, 29, 1022−1034. (6) Swoap, S. J.; Rathvon, M.; Gutilla, M. AMP does not induce torpor. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 293, R468− R473. (7) Ardiansyah; Shirakawa, H.; Shimeno, T.; Koseki, T.; Shiono, Y.; Murayama, T.; Hatakeyama, E.; Komai, M. Adenosine, an identified active component from the Driselase-treated fraction of rice bran, is effective at improving metabolic syndrome in stroke-prone spontaneously hypertensive rats. J. Agric. Food Chem. 2009, 57, 2558−2564. (8) Ardiansyah; Shirakawa, H.; Sugita, Y.; Koseki,T.; Komai, M.Antimetabolic syndrome effects of adenosine ingestion in stroke-prone spontaneously hypertensive rats fed a high-fat diet, Br. J. Nutr. 2010, 104, 48−55. (9) Fukumori, Y.; Takeda, H.; Fujisawa, T.; Ushijima, K.; Onodera, S.; Shiomi, N. Blood glucose and insulin concentrations are reduced in human administered sucrose with inosine or adenosine. J. Nutr. 2000, 130, 1946−1949. (10) Fukumori, Y.; Maeda, N.; Takeda, H.; Onodera, S. Serum glucose and insulin response in rats administered with sucrose or starch containing adenosine, inosine or cytosine. Biosci., Biotechnol., Biochem. 2000, 64, 237−243. (11) Ardiansyah; Shirakawa, H.; Koseki, T.; Ohinata, K.; Hashizume, K.; Komai, M.Rice bran fractions improve blood pressure, lipid profile, and glucose metabolism in stroke-prone spontaneously hypertensive ratsJ. Agric. Food. Chem. 2006, 54, 1914. (12) Friedewald, W. T.; Levy, R. I.; Fredrickson, D. S. Estimation of the concentration of low-density lipoprotein cholesterol in plasma without use of the preparative ultracentrifuge. Clin. Chem. 1972, 18, 499−502. (13) Folch., J.; Lees, M.; Stanley, G. H. S. A simple method for the isolation and purification of total lipid from animal tissues. J. Biol. Chem. 1957, 226, 497−509. (14) Wolever, T. M.; Jenkins, D. J. The use of the glycemic index in predicting the blood glucose response to mixed meals. Am. J. Clin. Nutr. 1986, 43, 167−172. (15) Shirakawa, H.; Ohsaki, Y.; Minegishi, Y.; Takumi, N.; Ohinata, K.; Furukawa, Y.; Mizutani, T.; Komai, M. Vitamin K deficiency
AUTHOR INFORMATION
Corresponding Author *Postal address: Laboratory of Nutrition, Graduate School of Agricultural Science, Tohoku University, 1-1 Tsutsumidori Amamiyamachi, Aobaku, Sendai 981-8555, Japan. E-mail:
[email protected] or
[email protected]. Fax: +8122-717-8813. Funding We gratefully acknowledge the support for this research, especially the Grant for the City Area Program from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.
■
Article
ACKNOWLEDGMENTS
We profoundly thank Yamasa Co. for providing AMP for this study. 13244
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
Journal of Agricultural and Food Chemistry
Article
reduces testosterone production in the testis through down-regulation of the Cyp11a a cholesterol side chain cleavage enzyme in rats. Biochim. Biophys. Acta 2006, 1760, 1482−1488. (16) Torrecilla, A.; Marques, A. F. P.; Buscalioni, R. D.; Oliveira, J. M. A.; Texeira, N. A.; Atencia, E. A.; Günther Sillero, M. A.; Silero, A. Metabolic fate of AMP, IMP, GMP and XMP in the cytosol of rat brain: an experimental and theoretical analysis. J. Neurochem. 2001, 76, 1291−1307. (17) Chen, H.; Montagnani, M.; Funahashi, T.; Shimomura, I.; Quon, M. J. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J. Biol. Chem. 2003, 278, 45021−45026. (18) Hardie, D. G.; Carling, D. The AMP-activated protein kinase − fuel gauge of the mammalian cell? Eur. J. Biochem. 1997, 246, 257− 273. (19) Hardie, D. G.; Carling, D.; Carlson, M. The AMP-activated/ SNF1 protein kinase subfamily: metabolic sensor of the eukaryotic cell? Annu. Rev. Biochem. 1998, 67, 821−855. (20) Winder, W. W.; Hardie, D. G. AMP-activated protein kinase, a metabolic master switch: possible roles in type 2 diabetes. Endocrinol. Metab. 1999, 40, E1−E10. (21) Misra, P. AMP activated protein kinase: a next generation target for total metabolic control. Expert Opin. Ther. Targets 2008, 12, 91− 100. (22) Yamauchi, T.; Nio, Y.; Maki, T.; Kobayashi, M.; Takazawa, T.; Iwabu, M.; Okada-Iwabu, M.; Kawamoto, S.; Kubota, N.; Kubota, T.; Ito, Y.; Kamon, J.; Tsucida, A.; Kumagai, K.; Kozono, H.; Hada, Y.; Ogata, H.; Tokuyama, K.; Tsunoda, M.; Ide, T.; Murakami, K.; Awazawa, M.; Takamoto, I.; Froquel, P.; Hara, K.; Tobe, K.; Nagai, R.; Ueki, K.; Kadowaki, T. Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nat. Med. 2007, 13, 332−339. (23) Yamauchi, T.; Kamon, J.; Waki, H.; Terauchi, Y.; Kubota, N.; Hara, K.; Mori, Y.; Ide, T.; Murakami, K.; Tsuboyama-Kasaoka, N.; Ezaki, O.; Akanuma, Y.; Gavrilova, O.; Vinson, C.; Reitman, M. L.; Kagechika, H.; Shudo, K.; Yoda, M.; Nakano, Y.; Tobe, K.; Nagai, R.; Kimura, S.; Tomita, M.; Froquel, P.; Kadowaki, T. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat. Med. 2001, 7, 941−946. (24) Yamauchi, T.; Kamon, J.; Minokoshi, Y.; Ito, Y.; Waki, H.; Uchida, S.; Yamashita, S.; Noda, M.; Kita, S.; Ueki, K.; Eto, K.; Akanuma, Y.; Froquel, P.; Foufelle, F.; Ferre, P.; Carling, D.; Kimura, S.; Naigai, R.; Kahn, B. B.; Kadowaki, T. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat. Med. 2002, 8, 1288−1295. (25) Kadowaki, T.; Yamauchi, T. Adiponectin and adiponectin receptors. Endocr. Rev. 2005, 26, 439−451. (26) Tomita, K.; Oike, Y.; Teratani, T.; Taguchi, T.; Noguchi, M.; Suzuki, T.; Mizutani, A.; Yokohama, H.; Irie, R.; Sumitomo, H.; Takayanagi, A.; Miyashita, K.; Akao, M.; Tabata, M.; Tamiya, G.; Ohkura, T.; Hibi, T. Hepatic AdipoR2 signaling plays a protective role against progression of nonalcoholic steatohepatitis in mice. Hepatology 2008, 48, 458−473.
13245
dx.doi.org/10.1021/jf203237c | J. Agric.Food Chem. 2011, 59, 13238−13245
