of 26 ACS Paragon Plus Environment ACS Chemical Biology 1 2 3 4 5

Letter is published by the ChemoproteomicsAmerican Chemical Society. 1155 Enabled Covalent Sixteenth Street N.W., Washington, DC 20036 Ligand Screening Published by American Chemical Society. Reveals ALDH3A1 Copyright © American Subscriber access provided by University Chemical Society. of Sussex Library However, no copyright

as a Lung Cancer Therapyis published Target by the American Chemical

Jessica L. Society. Counihan, 1155 Sixteenth Street N.W., Amanda L. Wiggenhorn, Washington, DC 20036 by American Kimberly E.Published Anderson, Society. and Daniel Chemical K. Nomura Copyright © American

Subscriber access provided by University Chemical Society. of Sussex Library However, no copyright

ACS Chem. Biol., Just Accepted Manuscript • DOI: 10.1021/ acschembio.8b00381 • Publication is published by the Chemical Date (Web):American 13 Jul 2018 Society. 1155

DownloadedSixteenth from http:// Street N.W., Washington, 20036 pubs.acs.org on July 14,DC 2018

Published by American Chemical Society. Copyright © American Subscriber access provided by University Chemical Society. of Sussex Library However, no copyright

Just Accepted

published by the “Just Accepted” is manuscripts have been p American Chemical online prior to technical editing, formatting Society. 1155 Street N.W., as a serv Society providesSixteenth “Just Accepted” Washington, DC 20036 of scientific material asbysoon as possible Published American Chemical Society. full in PDF format accompanied by an H Copyright © American peer reviewed, but should not be Subscriber access provided by University consid Chemical Society.

of Sussex Library However, no copyright

Digital Object Identifier (DOI®). “Just Acc the “Just Accepted” Web site may not in published by theedited and fo a manuscript is istechnically American Chemical site and published as1155 an ASAP article. Society. Sixteenth N.W., graphics to the manuscript textStreet and/or Washington, DC 20036 ethical guidelines that apply to the journ Published by American Chemical from Society.the use of in consequences arising Copyright © American

Subscriber access provided by University Chemical Society. of Sussex Library However, no copyright

competitive isoTOP-ABPP to map ligandable hotspots targeted by covalent ligands that impaired lung cancer pathogenicity

Page 2 of 26 ACS Chemical Biology N

N3

N

N

N

N

1. mix 2. enrichment 3. digestion 4. elution

B

B

control

N

N

1 2 3 4 5

N

S

S

N N

N

N N

S

N

N3

protein 2 TTC*SVTI protein 1 STWC*YWP control

N

B

N

LC-MS/MS

control

ligand

ligand light/heavy: 1 not inhibited

N N

B

light/heavy: 10 inhibited

B

target identification of lead covalent ligands

covalent ligand-treated

O O N H

DKM 3-42 O

N H

EN40

impaired cancer pathogenicity in ALDH3A1-positive lung cancer cells

ALDH3A1

O

N

O

Cys 244 ALDH3A1

ACS Paragon Plus Environment N

O

Cys 244 ALDH3A1

ACS Chemical Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 3 of 26

Manuscript in preparation as a Letter to ACS Chemical Biology

Chemoproteomics-Enabled Covalent Ligand Screening Reveals ALDH3A1 as a Lung Cancer Therapy Target

Jessica L. Counihan1,#, Amanda L. Wiggenhorn2,#, Kimberly E. Anderson1, and Daniel K. Nomura 1,2,3*

1

Departments of Nutritional Sciences and Toxicology, 2Chemistry, and 3Molecular and

Cell Biology, 127 Morgan Hall, University of California, Berkeley, Berkeley, CA 94720 *correspondence to [email protected] # authors contributed equally

ACS Paragon Plus Environment

1

Page 4 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Chemical Biology

Abstract Chemical genetics is a powerful approach for identifying therapeutically active small-molecules, but identifying the mechanisms of action underlying hit compounds remains challenging. Chemoproteomic platforms have arisen to tackle this challenge and enable rapid mechanistic deconvolution of small-molecule screening hits. Here, we have screened a cysteine-reactive covalent ligand library to identify hit compounds that impair cell survival and proliferation in non-small cell lung carcinoma cells, but not in primary human bronchial epithelial cells. Through this screen, we identified a covalent ligand hit, DKM 3-42 which impaired both in situ and in vivo lung cancer pathogenicity. We used activity-based protein profiling to discover that the primary target of DKM 3-42 was the catalytic cysteine in aldehyde dehydrogenase 3A1 (ALDH3A1). We performed further chemoproteomics-enabled covalent ligand screening directly against ALDH3A1, and identified a more potent and selective lead covalent ligand, EN40, which inhibits ALDH3A1 activity and impairs lung cancer pathogenicity. We show here that ALDH3A1 represents a potentially novel therapeutic target for lung cancers that express ALDH3A1 and put forth two selective ALDH3A1 inhibitors. Overall, we show the utility of combining chemical genetics screening of covalent ligand libraries with chemoproteomic approaches to rapidly identify anti-cancer leads and targets.


2


Page 5 of 26

Main Text Phenotypic screens with small-molecule libraries are useful approaches for identifying new therapeutic hits, but identifying the mechanisms of action underlying these compounds remains challenging 1. Chemoproteomic platforms have arisen to tackle this challenge and enable rapid mechanistic deconvolution of small-molecule screening hits 2,3. These approaches are particularly useful with covalently-acting smallmolecules where covalent ligands can be competed against broad reactivity-based probes to facilitate rapid target identification using activity-based protein profiling (ABPP) chemoproteomic platforms, without the need to incorporate photoaffinity and enrichment handles into the lead compound structure 4–7. While this method is inferential, an advantage of ABPP is that the specific site of modification of the covalent ligand hit can be mapped directly from complex proteomes 4,5,8. In recent years, ABPP platforms using reactivity-based chemical probes have led to the expansion in our understanding of proteome-wide ligandable sites and discovery of covalent ligand discovery against these sites for potential drug discovery applications 4–7. These platforms have also been successfully used in combination with phenotypic or biochemical screening efforts to rapidly discover new therapeutic agents, targets, and ligandable hotspots 6,8–11. Here, we have coupled the phenotypic screening of a cysteine-reactive covalent ligand library with ABPP-based chemoproteomic approaches to rapidly identify hit compounds and targets that impair lung cancer pathogenicity (Fig. 1A). To discover novel anti-cancer compounds and targets for lung adenocarcinomas, we screened our fragment-based cysteine-reactive covalent ligand library in A549 lung cancer cells to identify compounds that impaired A549 serum-containing proliferation or serum-free survival (Fig. 1B; Table S1). We then counter-screened any hits that impaired A549 survival and proliferation by >80 % in BEAS2B primary human bronchial epithelial cells to identify compounds that showed 5 were deemed targets of DKM 3-42. The primary target of DKM 3-42 was identified as the catalytic cysteine of aldehyde dehydrogenase 3A1 (ALDH3A1), cysteine 244 (C244) (Fig. 2A; Table S2). We observed many other ALDH enzymes in the isoTOP-ABPP data but none of these enzymes showed >5 ratios, indicating that DKM 3-42 had preferred reactivity with ALDH3A1 compared to other ALDH enzymes. We confirmed this interaction of DKM 342 with ALDH3A1 using gel-based ABPP approaches, where we show competition of DKM 3-42 against IA-rhodamine labeling of pure human ALDH3A1 protein with an 50 % inhibitory concentration (IC50) of 50 µM (Fig. 2A). These data showing competition of DKM 3-42 against IA-rhodamine labeling are consistent with our isoTOP-ABPP data


4


Page 7 of 26

showing ALDH3A1 as the primary target when competing DKM 3-42 against IA-alkyne labeling in A549 complex proteomes. We also tested DKM 3-42 against ALDH enzymes, ALDH1A3 and ALDH6A1, and show no significant binding to these enzymes by gelbased ABPP methods up to 100 µM (Fig. S1). We also show that DKM 3-42 does not show any observable competition against lysine-reactive probe labeling of A549 proteomes using a previously described NHS-ester-alkyne probe (Fig. S1) 13. Consistent with targeting the catalytic site of the enzyme, DKM 3-42 inhibits ALDH3A1 activity with pure protein (Fig. 2B). We also show that DKM 3-42 inhibits total aldehyde dehydrogenase activity in A549 cell lysate, indicating that ALDH3A1 is the primary aldehyde dehydrogenase enzyme with the benzaldehyde substrate used in this assay (Fig. 2B). We further genetically validated the importance of ALDH3A1 showing that ALDH3A1 knockdown recapitulates the effects observed with DKM 3-42, including inhibition of total A549 cell lysate aldehyde dehydrogenase activity, reduced cell survival and proliferation, and impaired in vivo tumor xenograft growth in A549 cells (Fig. 2C-2F). While DKM 3-42 showed promising data both in cells and in vivo, the chemical scaffold was not ideal for optimization and medicinal chemistry efforts. To identify alternate chemical scaffolds that may serve as better ALDH3A1 inhibitors, we purchased additional cysteine-reactive covalent ligands and screened this library directly against pure human ALDH3A1 protein using gel-based ABPP methods (Fig. 3A). In this screen, we competed 106 cysteine-reactive covalent ligands against iodoacetamide (IA)rhodamine labeling of ALDH3A1, and then subjected to SDS/PAGE and analysis of ingel fluorescence. From this screen, we identified EN40 as the top hit (Fig. 3B). Using gel-based ABPP, we further confirmed that EN40 competed against IA-rhodamine labeling of ALDH3A1 with better potency compared to DKM 3-42, with an IC50 of 2 µM (Fig. 3C). We also tested EN40 against ALDH enzymes, ALDH1A3 and ALDH6A1, and


5

Page 8 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


show no significant binding to these enzymes by gel-based ABPP methods up to 100 µM (Fig. S2). EN40 also did not show any observable competition against lysine-reactive probe labeling of A549 proteomes (Fig. S2). We further showed that EN40 also inhibits ALDH3A1 activity and impairs A549 cell survival (Fig. 3D, 3E). We performed isoTOPABPP analysis of EN40 on A549 proteomes and showed that C244 of ALDH3A1 was targeted selectively, with C13 of RPLP0 as an off-target (Fig. 3F; Table S2). Daily treatment with EN40 also exerted strong anti-tumorigenic effects in established A549 tumor xenografts (Fig. 3G) and showed good tolerability with no body weight loss in mice (Fig. 3H). We next performed ex vivo isoTOP-ABPP analysis on the tumors from these mice that received daily and repeated EN40 treatments and showed that C244 on ALDH3A1 was the primary site targeted by EN40 in vivo in the tumors with an isotopically light to heavy ratio of 5, confirming relatively selective target occupancy and engagement (Fig. 3I). We note that the ex vivo selectivity of EN40 in tumors appears to be less than that observed in vitro in A549 proteomes. While we have not done detailed pharmacokinetic studies with EN40, we attribute this reduced selectivity to daily and repeated treatment of EN40 in vivo in mice. Investigating dose-response, time-course of target engagement, and the turnover rates of ALDH3A1 may aid in optimizing dosing regimens to improve selectivity. We next wanted to understand whether ALDH3A1 inhibition would more broadly affect lung cancer cell survival across multiple lung cancer cell lines and what parameters would dictate sensitivity to ALDH3A1 inhibitors. We profiled ALDH3A1 expression across BEAS2B primary human bronchial epithelial cells, A549 lung adenocarcinoma cells, and 5 other lung cancer cell lines and found that ALDH3A1 expression was high in A549, NCI-H460, and NCI-H332 cells, but was not expressed in BEAS2B, Calu6, NCI-H23, and NCI-H661 cells (Fig. 4A). Consistent with this expression profile, we observed serum-free survival impairments with EN40 treatment in


6


Page 9 of 26

the lung cancer cell lines expressing ALDH3A1, but not in the cell lines that do not express ALDH3A1 (Fig. 4B). These results indicate that ALDH3A1 expression may serve as an indicator of responsiveness to ALDH3A1 inhibitors in impairing lung cancer pathogenicity. These data showing that only ALDH3A1-positive lung cancer cell lines respond to EN40 further support the specificity of EN40 as an ALDH3A1 inhibitor in cancer cells. We also tested a negative control compound EN A, an analog of EN40 which did not bind to ALDH3A1 by gel-based ABPP analysis against pure ALDH3A1 protein. We show that EN A does not exhibit cell survival impairments in A549 cells (Fig. S3). To further confirm on-target activity of DKM 3-42 and EN40, we stably overexpressed ALDH3A1 in A549 lung cancer cells and showed that the anti-survival effects conferred by DKM 3-42 and EN40 were significantly attenuated by ALDH3A1 overexpression (Fig. 4C-4E). Overall, we showed here that ALDH3A1 may represent a novel lung cancer therapeutic target and that ALDH3A1 inhibitors impair lung cancer pathogenicity in cells that express high levels of ALDH3A1. We put forth two scaffolds for selective and in vivo active ALDH3A1 inhibitors, DKM 3-42 and EN40, which were identified by coupling phenotypic screening of cysteine-reactive covalent ligands with chemoproteomics and through direct covalent ligand screening against ALDH3A1, respectively. ALDH3A1 has been previously reported to play important roles in cancer chemoresistance 14–17. This enzyme has also been shown to be overexpressed in subsets of various types of cancers, including lung cancers, hepatocellular carcinomas, gastric cancers, and prostate cancers 18–21. Previous studies have reported selective ALDH3A1 inhibitors, which confer sensitivity to chemotherapy agents such as oxazaphosphorine drugs 14,22, but have not shown their direct efficacy as single therapy agents. While our study shows that ALDH3A1 inhibition is a promising therapeutic strategy for impairing lung cancer pathogenicity for those cancer cells that express high levels of ALDH3A1, we do not yet


7

Page 10 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


understand the mechanism underlying our observed effects. While ALDH3A1, like other aldehyde dehydrogenase enzymes, acts on aldehyde substrates, the physiological substrates of ALDH3A1 in cancer cells is poorly understood. Our data, with both ALDH3A1 inhibitors and ALDH3A1 knockdown, show that, at least in A549 cells, ALDH3A1 represents the predominant aldehyde dehydrogenase activity, at least with the artificial benzaldehyde substrate. This activity may be influenced by other aldehyde substrates, depending on the substrate specificity of each ALDH enzyme. Future metabolomics endeavors aimed at uncovering the various aldehyde substrates of ALDH3A1 will likely reveal important mechanistic insights into how ALDH3A1 drives cancer pathogenicity in certain subsets of cancers. Taken more broadly, we show how the phenotypic screening of covalent ligand libraries can be coupled with ABPP-based chemoproteomic platforms to rapidly identify anti-cancer lead compounds, targets, and ligandable hotspots. We also demonstrate how higher-throughput ABPP approaches with covalent ligands against specific protein targets can rapidly yield new inhibitor scaffolds for future therapeutic development.

Methods Chemicals. Synthesis and characterization of covalent ligand libraries were either described previously 6,7,11, or purchased from Enamine LLC (compounds starting with “EN”), or described in Supporting Methods. IA-alkyne (N-hex-5-ynyl-2-iodo-acetamide) was purchased from Chess GmbH (product number 3187) and IA-rhodamine (tetramethylrhodamine-5-iodoacetamide dihydrochloride) was purchased from Thermo Fisher Scientific (catalog number T6006).

Cell Culture


8


Page 11 of 26

All cells were maintained at 37°C with 5% CO2, and all medium contained 10% FBS and 1% glutamine. A549 cells (ATCC) were cultured in F12K medium. NCI-H322 (SigmaAldrich), NCI-H460 (ATCC), NCI-H23 (ATCC), and NCI-H661 cells (ATCC) were cultured in RPMI medium. Calu-6 cells (ATCC) were cultured in EMEM medium. HEK293T/17 cells (ATCC) were cultured in DMEM medium. Finally, BEAS2B cells (ATCC) were cultured in flasks in BEBM media with all BEGM additives except gentamycin-amphotericin B mix (Lonza/Clonetics Corporation; Kit CC-3170).

Cellular Phenotype Studies

Cell survival and proliferation studies were performed as described previously 6,23. Briefly, cells were seeded at 2 x 104 and 4 x 104 cells/well, respectively, in serumcontaining or serum-free media in 96-well plates overnight. Cells were treated with DMSO vehicle- or compound-containing media for 24 or 48 h before fixation and staining with 10% formalin and Hoechst 33342 (Invitrogen) according to manufacturer’s protocol.

Gel-Based ABPP analysis Gel-based ABPP analyses were performed as previously described 23. Recombinant active ALDH3A1 and other ALDH pure human proteins were purchased from Sigma Aldrich. Pure protein (0.1-0.3 µg) were pre-treated with DMSO or a covalent ligand compound for 30 min at 37°C in 50 µL, and were then treated with IA-rhodamine (100 nM final concentration). The proteins were incubated for 60 min at room temperature. The samples were then separated by SDS/PAGE and scanned using a ChemiDoc MP (Bio-Rad Laboratories, Inc.), and gels were analyzed for their in-gel fluorescence.


9

Page 12 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For gel-based ABPP in A549 lysate, lysate (50 µg) was preincubated with DMSO or a covalent ligand (50 µM final concentration) for 30 min at 37°C in 50 µL. Lysate was then labeled with for one hour at room temperature with a lysine-reactive NHS-esteralkyne probe (100 µM). Following alkyne probe labeling, 25 µM rhodamine-azide, 1 mM TCEP, 100 mM tris(benzyltriazoylmethyl)amine, and 1 mM Cu(II)SO4 were added and incubated for 1 hr at room temperature, followed by SDS/PAGE and in-gel fluorescence analysis. Silver staining was done with Thermo Scientific Pierce Silver Stain Kit according to manufacturer’s protocol.

isoTOP-ABPP analysis IsoTOP-ABPP analyses were performed as previously described 4,6–8. A549 cell lysates were preincubated with DMSO vehicle or DKM 3-42 (50 µM) or EN40 (50 µM) for 30 min at 37°C and then labeled with IA-alkyne (100 µM) for 1 h at RT. The lysates were subsequently treated with isotopically light (control) or heavy (treated) TEV-biotin (100 µM), and click chemistry was performed. Probe-modified peptides were subsequently enriched, eluted, and analyzed by LC-MS/MS by Multidimensional Protein Identification Technology (MudPIT) as previously described 4,6,8,24. Peptides were searched with a static modification for cysteine carboxyaminomethylation (+57.02146) and up to two differential modifications for either the light or heavy TEV tags (+464.28596 or +470.29977, respectively). Peptides were required to have at least one tryptic end and to contain the TEV modification. ProLUCID data were filtered through DTASelect to achieve a peptide false-positive rate below 1%.

ALDH3A1 Activity Assays The ALDH3A1 activity assay methods were adapted from an assay previously published 25

. The ALDH activity was found with a spectrometer (VERSAmax, Molecular Devices)


10


Page 13 of 26

by detecting the NADPH production at 340 nm at 25°C. Recombinant active pure ALDH3A1 protein (Sigma-Aldrich, 0.325 µg per well) and either DMSO (control) or inhibitor (100 µM final concentration) were combined in a 96-well plate in sodium pyrophosphate buffer (100 mM, pH 8.0) with 150 µL final volume and pre-incubated for 15 min at 25°C. A549 lysate (50 µg per well) and shALDH3A1 or shControl lysates (100 µg per well) were treated with either DMSO (control) or inhibitor (1 mM and 100 µM final concentration) in a 96-well plate sodium in pyrophosphate buffer (100 mM, pH 8.0) with 100 µL final volume, and pre-incubated for 15 min at 25°C. NADP+ (2.5 mM) and benzaldehyde (5 mM) were subsequently added to initiate the reaction and absorbance at 340 nm was detected every 12 s for 1 h. The slope of a linear portion (between 0.8 min and 5 min) was used with an NADPH standard curve to calculate enzyme activity.

Gene Expression by qPCR RNA was extracted from cells with Trizol. Replicates were normalized by concentration and converted to cDNA. qPCR was performed according to the manufacturer’s protocol for Fisher Maxima SYBR Green with 10 µM primer concentrations. Primers were purchased from Sigma-Aldrich.

Knockdown of ALDH3A1 in A549 Cells Stable ALDH3A1 knockdown was achieved by using two independent short-hairpin oligonucleotides to knock down the expression of ALDH3A1 in lentiviral plasmids in the pLKO.1 backbone continuing shRNA (Sigma-Aldrich) against human ALDH3A1, and were transfected into HEK293T/17 cells using Lipofectamine 2000. Lentivirus was collected from filtered cultured medium and used to infect the target A549 cells with polybrene. Target cells were selected over 3 days with 1 µg/mL puromycin. Knockdown was confirmed by qPCR.


11

Page 14 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


shRNA oligonucleotides used to knockdown ALDH3A1 were: shALDH3A1-1: GATCCCGGTGTCCAGCAGTTGCTTGAAATCTCGAGATTTCAAGCAACTGCTGGACA TTTTTTG shALDH3A1-2: GATCCCGGAGATACTCAGGGCGTTGTTAACTCGAGTTAACAACGCCCTGAGTATCT TTTTTTG The target sequence for the control shRNA targeting GFP was GCAAGCTGACCCTGAAGTTCAT.

Overexpression of ALDH3A1 in A549 Cells Stable ALDH3A1 overexpression was achieved by subcloning the ALDH3A1 gene from human cDNA into a pLenti CMV puro vector (Cyagen Biosciences), and were transfected into HEK293T/17 cells using Lipofectamine 2000. Lentivirus was collected from filtered cultured medium and used to infect the target A549 cells with polybrene. Target cells were selected over 3 days with 1 µg/mL puromycin. Overexpression was confirmed by qPCR.

Tumor Xenograft Studies All experimental studies were approved by the Animal Care and Use Committee of the University of California, Berkeley. Human tumor xenografts were established by subcutaneously injecting cancer cells into the flank of C.B17 severe combined immunodeficiency (SCID) mice (6-8 weeks old; Taconic Farms). Briefly, cells were washed twice with PBS, trypsinized, and harvested in serum-containing medium. The harvested cells were then washed with serum-free medium, resuspended, and injected (2,000,000 cells). Tumors were measured every 7 days by caliper measurements. For


12


Page 15 of 26

the small-molecule studies, once tumors were established, the mice were exposed by intraperitoneal (ip) injection with either vehicle (18:1:1 PBS/ethanol/PEG40) or 50 mg/kg of DKM 3-42 or EN40 once per day, every day for the duration of the study.

Western Blots Vinculin antibody was obtained through Abcam. ALDH3A1 antibody was obtained from OriGene. Cells were lysed in CST lysis buffer containing 20 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM pyrophosphate, 50 mM NaF, 5 mM β-glycero-phosphate, 1 mM Na3VO4, 50 nM calyculin A (EMD Millipore), and protease inhibitors (Roche). Lysate was incubated on a rotator at 4°C for 30 min, and insoluble residue was subsequently removed with a centrifugation at 14,000 rpm for 10 min. Protein samples were normalized to a single concentration between 1 and 2 mg/mL. Proteins were separated by SDS/PAGE and transferred to nitrocellulose membranes with the iBlot system (Invitrogen). Blots were blocked with 5% BSA in Trisbuffered saline containing Tween 20 (TBST) solution for 1 h at RT and then washed with TBST. The blots were probed overnight at 4°C with primary antibodies diluted in 5% BSA in TBST according to manufacturer’s instructions. Following washes with TBST, the blots were incubated in the dark for 1 h at RT with secondary antibodies (Rockland). Blots were visualized using a ChemiDoc MP (Bio-Rad Laboratories, Inc.).

Supporting Information The Supporting Information is available free of charge via the internet at http://pubs.acs.org. Supporting Methods Figures S1-S3 and descriptions of Tables S1-S2


13

Page 16 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Structures of cysteine-reactive covalent ligands screened in phenotypic and gelbased ABPP experiments (XLSX) IsoTOP-ABPP data for DKM 3-42 and EN40 in A549 lung cancer cells (XLSX)

Acknowledgements We thank the members of the Nomura Research Group for critical reading of the manuscript. This work was supported by grants from the National Institutes of Health (R01CA172667), American Cancer Society Research Scholar Award (RSG14-242-01TBE), National Science Foundation Graduate Research Fellowship (Fellow ID 2015182321), and the Novartis-Berkeley Center for Proteomics and Chemistry Technologies.


14


Page 17 of 26

References (1) Smukste, I.; Stockwell, B. R. Advances in Chemical Genetics. Annu. Rev. Genomics Hum. Genet. 2005, 6, 261–286. (2) Moellering, R. E.; Cravatt, B. F. How Chemoproteomics Can Enable Drug Discovery and Development. Chem. Biol. 2012, 19, 11–22. (3) Counihan, J. L.; Ford, B.; Nomura, D. K. Mapping Proteome-Wide Interactions of Reactive Chemicals Using Chemoproteomic Platforms. Curr. Opin. Chem. Biol. 2015, 30, 68–76. (4) Backus, K. M.; Correia, B. E.; Lum, K. M.; Forli, S.; Horning, B. D.; GonzálezPáez, G. E.; Chatterjee, S.; Lanning, B. R.; Teijaro, J. R.; Olson, A. J.; et al. ProteomeWide Covalent Ligand Discovery in Native Biological Systems. Nature 2016, 534, 570– 574. (5) Hacker, S. M.; Backus, K. M.; Lazear, M. R.; Forli, S.; Correia, B. E.; Cravatt, B. F. Global Profiling of Lysine Reactivity and Ligandability in the Human Proteome. Nat. Chem. 2017, 9, 1181-1190. (6) Grossman, E. A.; Ward, C. C.; Spradlin, J. N.; Bateman, L. A.; Huffman, T. R.; Miyamoto, D. K.; Kleinman, J. I.; Nomura, D. K. Covalent Ligand Discovery against Druggable Hotspots Targeted by Anti-Cancer Natural Products. Cell Chem. Biol. 2017, 24, 1368-1376.e4. (7) Bateman, L. A.; Nguyen, T. B.; Roberts, A. M.; Miyamoto, D. K.; Ku, W.-M.; Huffman, T. R.; Petri, Y.; Heslin, M. J.; Contreras, C. M.; Skibola, C. F.; et al. Chemoproteomics-Enabled Covalent Ligand Screen Reveals a Cysteine Hotspot in Reticulon 4 That Impairs ER Morphology and Cancer Pathogenicity. Chem. Commun. Camb. Engl. 2017, 53, 7234–7237. (8) Weerapana, E.; Wang, C.; Simon, G. M.; Richter, F.; Khare, S.; Dillon, M. B. D.; Bachovchin, D. A.; Mowen, K.; Baker, D.; Cravatt, B. F. Quantitative Reactivity Profiling Predicts Functional Cysteines in Proteomes. Nature 2010, 468, 790–795. (9) Hunerdosse, D. M.; Morris, P. J.; Miyamoto, D. K.; Fisher, K. J.; Bateman, L. A.; Ghazaleh, J. R.; Zhong, S.; Nomura, D. K. Chemical Genetics Screening Reveals KIAA1363 as a Cytokine-Lowering Target. ACS Chem. Biol. 2014, 9, 2905–2913. (10) Roberts, L. S.; Yan, P.; Bateman, L. A.; Nomura, D. K. Mapping Novel Metabolic Nodes Targeted by Anti-Cancer Drugs That Impair Triple-Negative Breast Cancer Pathogenicity. ACS Chem. Biol. 2017, 12, 1133–1140. (11) Roberts, A. M.; Miyamoto, D. K.; Huffman, T. R.; Bateman, L. A.; Ives, A. N.; Akopian, D.; Heslin, M. J.; Contreras, C. M.; Rape, M.; Skibola, C. F.; et al. Chemoproteomic Screening of Covalent Ligands Reveals UBA5 As a Novel Pancreatic Cancer Target. ACS Chem. Biol. 2017, 12, 899–904. (12) Anderson, K. E.; To, M.; Olzmann, J. A.; Nomura, D. K. ChemoproteomicsEnabled Covalent Ligand Screening Reveals a Thioredoxin-Caspase 3 Interaction Disruptor That Impairs Breast Cancer Pathogenicity. ACS Chem. Biol. 2017, 12, 2522– 2528. (13) Ward, C. C.; Kleinman, J. I.; Nomura, D. K. NHS-Esters As Versatile ReactivityBased Probes for Mapping Proteome-Wide Ligandable Hotspots. ACS Chem. Biol. 2017, 12, 1478–1483. (14) Parajuli, B.; Georgiadis, T. M.; Fishel, M. L.; Hurley, T. D. Development of Selective Inhibitors for Human Aldehyde Dehydrogenase 3A1 (ALDH3A1) for the Enhancement of Cyclophosphamide Cytotoxicity. Chembiochem Eur. J. Chem. Biol. 2014, 15, 701–712. (15) Voulgaridou, G.-P.; Kiziridou, M.; Mantso, T.; Chlichlia, K.; Galanis, A.; Koukourakis, M. I.; Franco, R.; Panayiotidis, M. I.; Pappa, A. Aldehyde Dehydrogenase


15

Page 18 of 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


3A1 Promotes Multi-Modality Resistance and Alters Gene Expression Profile in Human Breast Adenocarcinoma MCF-7 Cells. Int. J. Biochem. Cell Biol. 2016, 77, 120–128. (16) Kim, J.; Shin, J. H.; Chen, C.-H.; Cruz, L.; Farnebo, L.; Yang, J.; Borges, P.; Kang, G.; Mochly-Rosen, D.; Sunwoo, J. B. Targeting Aldehyde Dehydrogenase Activity in Head and Neck Squamous Cell Carcinoma with a Novel Small Molecule Inhibitor. Oncotarget 2017, 8, 52345–52356. (17) Moreb, J. S.; Mohuczy, D.; Muhoczy, D.; Ostmark, B.; Zucali, J. R. RNAiMediated Knockdown of Aldehyde Dehydrogenase Class-1A1 and Class-3A1 Is Specific and Reveals That Each Contributes Equally to the Resistance against 4Hydroperoxycyclophosphamide. Cancer Chemother. Pharmacol. 2007, 59, 127–136. (18) Ucar, D.; Cogle, C. R.; Zucali, J. R.; Ostmark, B.; Scott, E. W.; Zori, R.; Gray, B. A.; Moreb, J. S. Aldehyde Dehydrogenase Activity as a Functional Marker for Lung Cancer. Chem. Biol. Interact. 2009, 178, 48–55. (19) Wu, D.; Mou, Y.-P.; Chen, K.; Cai, J.-Q.; Zhou, Y.-C.; Pan, Y.; Xu, X.-W.; Zhou, W.; Gao, J.-Q.; Chen, D.-W.; et al. Aldehyde Dehydrogenase 3A1 Is Robustly Upregulated in Gastric Cancer Stem-like Cells and Associated with Tumorigenesis. Int. J. Oncol. 2016, 49, 611–622. (20) Calderaro, J.; Nault, J.-C.; Bioulac-Sage, P.; Laurent, A.; Blanc, J.-F.; Decaens, T.; Zucman-Rossi, J. ALDH3A1 Is Overexpressed in a Subset of Hepatocellular Carcinoma Characterised by Activation of the Wnt/ß-Catenin Pathway. Virchows Arch. Int. J. Pathol. 2014, 464, 53–60. (21) Yan, J.; De Melo, J.; Cutz, J.-C.; Aziz, T.; Tang, D. Aldehyde Dehydrogenase 3A1 Associates with Prostate Tumorigenesis. Br. J. Cancer 2014, 110, 2593–2603. (22) Parajuli, B.; Fishel, M. L.; Hurley, T. D. Selective ALDH3A1 Inhibition by Benzimidazole Analogues Increase Mafosfamide Sensitivity in Cancer Cells. J. Med. Chem. 2014, 57, 449–461. (23) Louie, S. M.; Grossman, E. A.; Crawford, L. A.; Ding, L.; Camarda, R.; Huffman, T. R.; Miyamoto, D. K.; Goga, A.; Weerapana, E.; Nomura, D. K. GSTP1 Is a Driver of Triple-Negative Breast Cancer Cell Metabolism and Pathogenicity. Cell Chem. Biol. 2016, 23, 567-578. (24) Wang, C.; Weerapana, E.; Blewett, M. M.; Cravatt, B. F. A Chemoproteomic Platform to Quantitatively Map Targets of Lipid-Derived Electrophiles. Nat. Methods 2014, 11, 79–85. (25) Pappa, A.; Estey, T.; Manzer, R.; Brown, D.; Vasiliou, V. Human Aldehyde Dehydrogenase 3A1 (ALDH3A1): Biochemical Characterization and Immunohistochemical Localization in the Cornea. Biochem. J. 2003, 376, 615–623.


16


Page 19 of 26

Figure Legends Figure 1. Cysteine-reactive covalent ligand screen to identify lead compounds that impair lung cancer pathogenicity. (A) Schematic of workflow for the study. We screened our library of cysteine-reactive covalent ligands (examples shown) in A549 lung cancer cells to identify ligands that impair lung cancer cell survival or proliferation. Upon identifying hits, we used the competitive isoTOP-ABPP platforms to map the ligandable hotspots targeted by the hit compound in A549 proteomes. (B) Cysteinereactive covalent ligands were screened in A549 lung cancer cells for impairments in serum-free survival or serum-containing proliferation at 50 µM for 48 h compared to DMSO vehicle-treated controls, assessed by Hoechst stain. (C) Hits that impaired A549 survival or proliferation by >75% were counterscreened against BEAS2B primary human bronchial epithelial cells (50 µM) for survival and proliferation for 48 h compared to DMSO vehicle-treated controls, assessed by Hoechst stain. (D) Structure of hit compound DKM 3-42 that impaired survival and proliferation by >75% in A549 cells but

of 26 ACS Paragon Plus Environment ACS Chemical Biology 1 2 3 4 5

Recommend Documents