Oncolytic Adenovirus Complexes Coated with Lipids and Calcium

(c) Cytotoxicity assay: cell viability was determined using MTT assay after the indicated treatments (160 VPs/cell, 1 d = 1 day, 10 d = 10 days) for 9...
1 downloads 0 Views 9MB Size
Download PDF
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen,† Pei Gao,† Sujing Yuan,‡ Rongxin Li,† Aimin Ni,‡ Liang Chu,‡ Li Ding,† Ying Sun,*,† Xin-Yuan Liu,*,‡ and Yourong Duan*,† †

State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200032, China ‡ State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China S Supporting Information *

ABSTRACT: Oncolytic adenovirus (OncoAd) is a promising therapeutic agent for treating cancer. However, the therapeutic potential of OncoAd is hindered by hepatic sequestration and the host immune response in vivo. Here, we constructed a PEG/Lipids/calcium phosphate (CaP)-OncoAd (PLC-OncoAd) delivery system for ZD55-IL-24, an oncolytic adenovirus that carries the IL-24 gene. The negatively charged PLC-ZD55-IL-24 were disperse and resisted serum-induced aggregation. Compared to naked ZD55-IL-24, the systemic administration of PLC-ZD55-IL-24 in BALB/c mice resulted in reduced liver sequestration and systemic toxicity and evaded the innate immune response. In addition, masking the surface of OncoAd protected it from neutralization by pre-existing neutralizing antibody. PLC-OncoAd achieved efficient targeted delivery in Huh-7bearing nude mice, and intravenous administration of a high dose of PLCZD55-IL-24 increased therapeutic efficacy without inducing toxicity. The developed PLC-OncoAd delivery system represents a promising improvement for oncolytic adenovirus-based cancer gene therapy in vivo. KEYWORDS: systemic administration, cancer gene therapy, oncolytic adenovirus, calcium phosphate (CaP), preexisting immunity, liver sequestration fibers.10 Replacing an Ad5 fiber knob by Ad3 can lead to resistance against neutralization by an Ad5-induced antibody.11 A chimeric Ad5/Ad48 system reduced liver tropism after systemic administration.12 However, the removal or exchange of virulence factors often limits replication in target tissues,13 and serotype switching is difficult due to the multiple surfaceexposed capsid proteins that contain neutralizing epitopes.14 The fiber-modified Ads were observed to delay viral uptake, possibly impairing infectivity.15 Consequently, alternative strategies to solve these issues are urgently needed. The second strategy is to construct a hybrid vector system combining viral and nonviral carriers that can overcome some of the challenges that are associated with genetic engineering strategies.1 Recent approaches for the modification of Ad have focused on the use of cationic polymers or lipids, such as polyethylenimine,16 poly-

I

n recent decades, oncolytic adenovirus (OncoAd) has been extensively explored for cancer gene therapy. The advantages of using OncoAd in cancer gene therapy include not only cancer cell-specific replication, the infection of neighboring cancer cells and the destruction of infected cells1 but also the high expression of inserted therapeutic genes, leading to potent antitumor efficacy.2,3 In addition, OncoAd can infect both dividing and nondividing cells, and high viral titers can be achieved. Several human clinical trials have reported the successful use of OncoAd in local cancer gene therapy.4,5 However, the efficacy of intravenously administering OncoAd is compromised by nonspecific sequestration in the liver,6,7 preexisting antiadenovirus immunity and the innate immune response.8,9 To overcome these problems, there is a need to redesign OncoAd to achieve efficient antitumor effects. To tackle these problems, two main strategies have been employed. First, genetic engineering strategies have been extensively used, including switching serotypes, modifying fibers with heterologous peptide and the use of deknobing © 2016 American Chemical Society

Received: September 12, 2016 Accepted: November 23, 2016 Published: November 23, 2016 11548

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

www.acsnano.org

Article

ACS Nano arginine-grafted bioreducible polymer,18 chitosan19 and 1, 2-dioleoyl-3-trimethylammonium-propane chloride salt (DOTAP).20 The cationic moieties in the polymers or lipids can form hybrids with the negatively charged Ad, thereby protecting the Ad from pre-existing neutralizing antibodies and facilitating its interaction with the cell membrane, thus increasing in vitro transfection efficiency. However, the cationic polymer/liposome-based strategy faces other problems such as toxicity,21 low tissue specificity and short in vivo circulation time due to nonspecific interactions with the negatively charged cell membrane,22 as well as incompatibility with negatively charged macromolecules that are present in the physiological environment.23 These problems prompted us to explore other approaches for the systemic administration of oncolytic adenovirus for use in cancer gene therapy. Calcium phosphate (CaP), a highly biocompatible inorganic biomaterial,24 has been reported to readily form a precipitate with adenovirus, thereby enhancing adenovirus-mediated gene transfer. 25 Moreover, amorphous CaP can be rapidly synthesized by mixing aqueous solutions of calcium and phosphate ions. CaP, when endocytosed by cells, is rapidly dissolved under the acidic pH conditions that prevail in the endosome, causing efficient endosomal escape.26 However, CaP precipitates are difficult to control and tend to form bulky agglomerates,27 which adversely affects systemic administration. It is critical to prepare a stable CaP nanocomplex for the in vivo delivery of OncoAd. Phospholipids are the main component of cell membranes and are widely used to prepare drug carriers. Anionic phospholipids can combine with CaP through electrostatic interactions.28 In this study, we developed an oncolytic adenovirus delivery system (Scheme 1) for ZD55-IL-24, an oncolytic adenovirus L-lysine,

17

RESULTS AND DISCUSSION Preparation and Characterization of PLC-ZD55-IL-24. In this study, a negatively charged systemic delivery system was designed (Scheme 1). CaP and ZD55-IL-24 were coprecipitated in a calcium-rich medium; ZD55-IL-24 induced the nucleation of calcium phosphate on its surface to produce an electron dense biomineral layer (Figure 1Ab). However, the use of simple CaP precipitates led to bulky agglomerates of ZD55IL-24. Dioleoylphosphatydic acid (DOPA), an amphiphilic phospholipid, is known to strongly interact with cations at the interface;29 thus, this molecule was used to stabilize CaP/ ZD55-IL-24. DOPA formed lipid bilayer spheres around CaP/ ZD55-IL-24 and dispersed evenly (Figure 1Ac). The DOPA-toCaP/ZD55-IL-24 ratio was optimized based on the change in size produced (Figure S1). PEGylation is a commonly used approach for improving the efficiency of nanoparticle delivery to target tissues.30 The outer mPEG2000 could form a hydrophilic protective layer around the DOPA/CaP/ZD55IL-24 complexes that inhibited the size increase (Figure 1Ad), which could facilitate longer circulation times after intravenous administration. The mPEG2000-DPPE was synthesized, and the structure was confirmed by 1H NMR (Figure S2). Furthermore, the PEG/Lipids/CaP showed no apparent cytotoxicity to L929 cells or normal human liver cells (L02, QSG-7701), even at a high concentration (100 μg/mL) (Figure S3). The hydrodynamic diameter, polydispersity index (PDI) and surface charge of the naked ZD55-IL-24 and the PLC-ZD55-IL24 were characterized by dynamic light scattering (DLS) (Figure 1B, C). The mean size of PLC-ZD55-IL-24 increased from 112 nm (naked ZD55-IL-24) to 121 nm, and the PDI was 0.12 (Table 1). A Nanosight (NTA)−3D plot assay confirmed the dispersibility of PLC-ZD55-IL-24 (Figure S4). However, the mean size of PLC-ZD55-IL-24 was larger than that shown in TEM image. The DLS result represented a hydrodynamic size (hydrated state) that corresponds to the core and the swollen corona of the nanoparticles, whereas TEM images depicted the actual size at the dried state of sample and the corona with low electronic density is not measured. PLCZD55-IL-24 was negatively charged in aqueous solution with a zeta potential of −10.1 mV (Figure 1B); thus, the system might reduce the formation of aggregates in the presence of negatively charged serum proteins during intravenous administration.31 Both parameters were beneficial for passive tumor targeting of the drug delivery through the enhanced permeability and retention (EPR) effect. To further evaluate the structure of PLC-ZD55-IL-24, a dotblot assay was performed to detect the viral surface protein using an adenovirus-specific antibody (anti-Hexon antibody). The anti-Hexon antibody detected the surface Hexon protein of the naked adenovirus, but detection of PLC-ZD55-IL-24 was negligible (Figure 1D). However, under denaturing conditions, PLC-ZD55-IL-24 was detected. These results indicated that PEG/Lipids/CaP shielded the surface of the naked adenovirus, which could inhibit the accessibility of the antibody to the virus surface. Additionally, the migration of PLC-ZD55-IL-24 was retarded (Figure 1E), indicating that the PLC-ZD55-IL-24 complex had a high encapsulation efficiency. These results suggested that negatively charged PLC-ZD55-IL-24 achieved efficient encapsulation at an appropriate scale ( 0.05.

Apoptosis In Vitro. ZD55-IL-24 is an oncolytic adenovirus with E1B (55kd)-deleted carrying IL-24 gene. The tumor selectivity of ZD55 was determined based on the deleted E1B55Kd, which mediates late viral RNA export.32 The inserted gene, IL-24, has been reported to have ubiquitous cancerspecific toxicity, with no harmful effects to normal cells.33 Our previous studies showed that ZD55-IL-24 exhibited selective replication and a high expression level of IL-24, in addition to exhibiting a specific cytotoxic effect on tumor cells by inducing caspase-dependent apoptosis.2,3 Ad-IL-24 has been reported to selectively inhibit cancer cell proliferation in HCC.34 To evaluate the kinetics of the cytotoxicity of PLC-ZD55-IL-24, a set of HCC cell lines (Huh-7, Hep3B and HepG2) and normal human liver cells (QSG-7701) were studied. To determine whether the structure of PLC-ZD55-IL-24 could influence the potency of ZD55-IL-24, we first examined the expression of IL-24 and the replication of PLC-ZD55-IL-24 in Huh-7 cells. PLC-ZD55-IL-24 effectively expressed IL-24 protein (Figure 3A), and the replication rate did not decrease

gation and prevented the formation of larger aggregates in the presence of negatively charged blood serum proteins.31 For the successful establishment of delivery systems with regard to therapeutic applications, the further improvement of biological activities and pharmacokinetics are major goals. And the storage stability is another important aspect. Adenoviral vectors, to maintain function, suspended in an aqueous medium require storage at temperatures close to −80 °C. Freezing and thawing process significantly reduced Adenovirus titers. The average size of PLC-ZD55-IL-24 did not change within 10 days at 4 °C (Figure 2Ba,b). After a 10 day-storage, the cytotoxicity of PLC-ZD55-IL-24 was scarcely decreased (Figure 2Bc), however, the cytotoxicity of ZD55-IL-24 was significantly decreased. Although the size increased after stored 10 days, PLC-ZD55-IL-24 partly improved the storage stability compared to ZD55-IL-24. To further extend the storage time, great efforts should be made to improve fabrication technique. PLC-ZD55-IL-24 Efficiently Inhibited Hepatocellular Carcinoma (HCC) Cell Proliferation and Induced 11551

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano

Figure 4. Biodistribution of PLC-OncoAd in nude mice bearing Huh-7 xenografts. (A) Viral genome copies in tumor (a), plasma (b), liver (c), spleen (d) and lung (e) were quantified using real time qPCR at the indicated time after intravenously injected with 1.5 × 1010 VPs ZD55-IL24 and PLC-ZD55-IL-24 (n = 3). (B). (a) Fluorescence images of excised tumors and organs after the indicated intravenous injection for 4 days. (HD: high dose =1.5 × 1010 VPs; LD: low dose =7.5 × 109 VPs) (n = 3). (b) Quantitative analysis of the mean fluorescence intensity of GFP in each group. Data are presented as the means ± SD (*P < 0.05, **P < 0.01, ***P < 0.001). (c) The tumor-to-liver ratio of GFP intensity (normalized to the LD ZD55-GFP group).

proportion of Annexin V-FITC+ cells to Huh-7 cells was increased after treatment with ZD55-IL-24 and PLC-ZD55-IL24 (Figure 3E). The proportion of apoptotic cells was significantly increased (35.6% for ZD55-IL-24 and 38.8% for PLC-ZD55-IL-24; Figure 3F), compared with PBS. However, no obvious nucleic fragmentation or Annexin V-FITC+ cells were observed in QSG-7701 cells (Figure S7). Both ZD55-IL24 and PLC-ZD55-IL-24 induced the activation of caspase 3 and caspase 9, leading to a decrease in pro-caspase 9 and procaspase 3 protein levels in Huh-7 cells; the specific cleavage of poly(ADP-ribose) polymerase (PARP) by caspase during apoptosis was detected (Figure 3G). On the basis of these results, we concluded that ZD55-IL-24, when encapsulated with PEG/Lipids/CaP, retained its replication and inserted gene expression capacities, thereby efficiently inhibiting HCC cell proliferation while sparing normal human liver cells in vitro. In

significantly (Figure 3B). PLC-ZD55-IL-24 and ZD55-IL-24 showed apparent and time-dependent cytotoxicity against HCC cell lines (Figure 3C). And PLC-ZD55-IL-24 caused no significant cytotoxicity in normal human liver cells (QSG7701), even at concentrations of up to 800 VPs/cell (Figure S6). These findings indicated that PLC-ZD55-IL-24 has tumorselective cytotoxicity effects. In addition, the PEG/Lipids/CaP did not exhibit cytotoxicity against HCC cell lines, which is consistent to the result in normal cell lines (Figure S3). Previous studies showed that ZD55-IL-24 selectively induces apoptosis in tumor cells but not in normal cells.2 On the basis of these observations, Hoechst staining and an Annexin V binding assay were performed to determine the capacity of PLC-ZD55-IL-24 to selectively induce apoptosis in HCC cells. Increased nucleic fragmentation was observed in ZD55-IL-24 and PLC-ZD55-IL-24-treated Huh-7 cells (Figure 3D). The 11552

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano

Figure 5. Systemic administration of PLC-ZD55-IL-24 exhibited prolonged circulation half-life, decreased hepatic sequestration and toxicity. HD (high dose = 1.5 × 1010 VPs) and LD (low dose = 7.5 × 109 VPs) of ZD55-IL-24 and PLC-ZD55-IL-24 were intravenously injected into BALB/c mice (n = 4). After 4 days, the serum and liver were harvested. (A) Circulation half-life. (Injection dose: 6.5 × 1011 VPs/kg, n = 3) (B) Mouse body weight change. (C) TEM images of hepatocyte from mice treated with PLC-ZD55-IL-24 or ZD55-IL-24. Nucleic membrane, cell membrane and viral particles are indicated by the yellow, blue and red arrow, respectively. Scale bar: 100 nm. (D) Liver sections stained with IL-24. Magnification = 400-fold. (E) A comparison of the number of viral genome copies in the liver. *P < 0.05, ***P < 0.01 versus the corresponding dose in the PLC-ZD55-IL-24-treated group. #P < 0.01 versus the LD PLC-ZD55-IL-24-treated group. (F) Serum ALT (a) and AST (b) levels. *P < 0.05, ***P < 0.01, NS indicates P > 0.05 versus the PBS group. (G) H&E staining of liver sections in each group. Upper panel, magnification = 200-fold. All data are presented as the means ± SD.

addition, PLC-ZD55-IL-24 induced caspase-dependent apoptosis in Huh-7 cells. In Vivo Biodistribution of PLC-OncoAd Resulted in Efficient Tumor Target Delivery. To better understand the targeting efficacy, nonspecificity toward tissues and corresponding toxicity, a thorough biodistribution of PLC-OncoAd was performed. The existence of ZD55-IL24 in different tissues was detected by Real-time quantitative PCR (qPCR) using primers targeting the adenoviral E3 gene. The PLC-ZD55-IL-24-treated mice exhibited more virus accumulation in tumors than those treated with ZD55-IL-24 (Figure 4Aa), although there was no

significant difference between the two groups at early time point (6 h). In PLC-ZD55-IL-24 treated mice, the blood circulation time was prolonged (Figure 4Ab), and the OncoAd sequestration by the liver and spleen was significantly reduced compared to those in the naked ZD55-IL-24 treated group (Figure 4Ac,d). Additionally, there were no significant difference in the uptake between ZD55-IL-24 and PLCZD55-IL-24 in Huh-7 cells (Figure S8). Therefore, the prolonged circulation time of PLC-ZD55-IL-24 could contribute the tumor target delivery of OncoAd. Our combined data suggested that PLC-ZD55-IL-24 improved the biodistribution 11553

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano

the Ad, which limits the systemic administration of Ad5-based adenoviruses because of the resulting severe hepatic toxicity and systemic toxicity.39,40 Therefore, adenovirus surface engineering is applied to introduce an artificial shell on the virus surface to develop a “stealth” cover. The PEG/Lipids/CaP coated ZD55-IL-24 inhibited the interaction between Hexon and the anti-Hexon antibody (Figure 1D) and could provide a physical barrier for infection of hepatocytes by adenoviruses. Furthermore, PEG2000 was designed to shield the surface (Scheme 1) from phagocytosis (Figure 4Ac,d) and prolong the circulation time. As shown in Figure 5A, systemic administration of PLC-ZD55-IL-24 yielded a 3.1-fold increase in the blood circulation half-life (P < 0.05) and achieved 2.7-fold increase in area under the curve (AUC) compared to naked ZD55-IL-24. The blood circulation half-life of naked OncoAd was less than 2 min, which is consistent with previous studies.41 The prolonged circulation time properties of PLC-ZD55-IL-24 may exhibit protection from hepatic phagocytosis and relative toxicity. To investigate liver sequestration and toxicity, serial doses of PLC-ZD55-IL-24 were intravenously injected in BALB/c mice. The HD ZD55-IL-24 treated mice showed significant body weight loss (Figure 5B), whereas no body weight loss was observed in PLC-ZD55-IL-24-treated mice; this finding indicated that ZD55-IL-24 encapsulated in PEG/Lipids/CaP exhibits decreased systemic toxicity when injected intravenously. The number of adenoviral particles decreased (Figure 5C) and subsequently the expression of IL-24 was also obviously reduced (Figure 5D) in hepatocyte after treated with PLC-ZD55-IL-24. Further, viral DNA copy numbers (E3 gene) in the liver of PLC-ZD55-IL-24-treated mice were significantly lower than corresponding dose of HD and LD naked ZD55-IL-24-treated mice (Figure 5E); this finding is consistent with the results of a previous biodistribution assay (Figure 4B). Together, these data suggested that PLC-ZD55IL-24 attenuates the hepatic nonspecific sequestration and prolongs the circulation half-life of ZD55-IL-24. Hepatic damage results in increased serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST). In our experiment, serum ALT and AST levels were significantly increased in the ZD55-IL-24-treated group (Figure 5Fa and b). The highest serum levels of ALT and AST were observed in the HD ZD55-IL-24-treated mice. This result confirmed that the hepatotoxicity of naked adenovirus is dosedependent after systemic injection,42 thus limiting the use of high doses of OncoAd. In contrast, the systemic administration of PLC-ZD55-IL-24 did not significantly increase ALT and AST levels in serum (Figure 5Fa,b). H&E staining of liver sections obtained from the PLC-ZD55-IL-24-treated mice showed no obvious pathological signs of hepatotoxicity; in contrast, the ZD55-IL-24-treated mice exhibited inflammatory cell infiltration and spotty necrosis, and this was especially true of the HD ZD55-IL-24-treated mice (Figure 5G). These data demonstrate that the systemic delivery of PLC-ZD55-IL-24 significantly reduced the hepatic toxicity of ZD55-IL-24, even at high doses. Physical masking of the Ad surface can inhibit the interaction between the Hexon protein and the anti-Hexon antibody (Figure 1D).43 Furthermore, PEG2000 acted as a shield on the surface of OncoAd to prolong circulation half-life (Figure 5A) and minimize sequestration in the liver (Figure 5C,D,E). Nevertheless, increased liver accumulation of ZD55-IL-24 was observed in HD PLC-ZD55-IL-24-treated mice compared with

of ZD55-IL-24, prolonged the circulation time, which could target more efficiently to tumors. The fast increased viral genome copy numbers in tumors occurred at 48 h in both groups after intravenous injection mainly due to the replication of the OncoAd, which could enhance the antitumor efficacy. Particle aggregates in the presence of the negatively charged serum are prone to cause emboli in lung capillaries,35 which might lead to OncoAd accumulation in lung. PLC-ZD55-IL-24 resisted the serum-induced aggregation in vitro (Figure 2A). We also found that the accumulation of ZD55-IL-24 in the lung was significantly reduced in PLC-ZD55-IL-24 treated group (Figure 4Ae) compared to naked ZD55-IL-24, which suggested that ZD55-IL-24 coated with PEG/Lipids/CaP might prevent the formation of larger aggregates in vivo. The viral genome was decreased at latter time point in the liver, spleen and lung, which may due to the clearance of adenovirus by the mononuclear phagocytic system. Relatively fewer viral copy numbers were observed in the kidney, heart and brain (Figure S9). In addition, a fluorescence imaging system was utilized to monitor GFP intensity in tissues to confirm the targeting delivery capacity of OncoAd. Nude mice bearing Huh-7 subcutaneous tumors were treated with PBS, high dose (HD) ZD55-GFP, low dose (LD) ZD55-GFP, HD PLC-ZD55-GFP, or LD PLC-ZD55-GFP. After 4 days, the heart, liver, spleen, lung, kidney and tumor tissues were harvested and immediately imaged (Figure 4Ba), and the threshold of fluorescence emission was set to the same level to ensure the comparability. GFP expression was not observed in PBS-treated mice. Mice treated with naked LD and HD ZD55-GFP produced moderate and strong GFP signals in liver tissue, whereas LD and HD PLC-ZD55-GFP-treated mice livers exhibited negligible and mild GFP signals, respectively. In marked contrast, LD and HD PLC-ZD55-GFP-treated mice elicited moderate to strong GFP signals in tumor tissues, which were significantly higher than the signals at the corresponding doses in naked ZD55-GFP treated mice (Figure 4Bb). The enhancement of GFP expression in the tumors indicated that the PLC-ZD55-GFP enhanced the accumulation of ZD55-GFP and that ZD55-GFP proliferated in the tumor tissues. Moreover, the tumor-to-liver fluorescence intensity ratio (an important safety indicator and therapeutic index) was used to confirm the targeting delivery capacity of PLC-ZD55-GFP. The tumor-to-liver ratio in mice that were injected with PLC-ZD55-GFP was increased 560.2fold (HD) and 601.5-fold (LD) compared with those that were treated with LD ZD55-GFP (Figure 4Bc). GFP was not detectable in most other tissues. These results demonstrated that the systemic administration of the PLC-OncoAd complex could reduce sequestration, prolong the circulation time and achieve efficient tumor-target delivery in vivo. Systemic Administration of PLC-ZD55-IL-24 Exhibited Reduced Hepatic Sequestration and Toxicity. Adenoviruses are typically coated variety of serum proteins (including antibodies, complement, coagulation factors et al.) that facilitate their recognition by splenic macrophages and hepatic Kuppfer cells.1,36 Liver tropism is one of the major limitations of Ad5 after intravascular administration, due to the predominantly hepatocytic transduction in vivo.37 Serial studies demonstrated that Factor X play an important role in mediating hepatocytic transduction, and blockade Ad5 Hexon binding to Factor X blocks liver gene transfer in vivo.6,38 These can result in increased hepatocyte transduction and Kupffer cell uptake of 11554

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano

Figure 6. PLC-OncoAd elicited a reduced innate immune response and protected Ad from neutralizing antibodies. (A). (a) Serum IL-6 levels at the indicated level of systemic administration (n = 4) and (b) IL-6 levels in the medium of RAW264.7 macrophage cells for the indicated treatments. (B) Neutralization assay in vitro. Ad-GFP and PLC-Ad-GFP were incubated with serial dilutions of mouse serum containing a high titer of neutralizing antibodies (nAb); Huh-7 cells were then infected at 200 VPs/cell. At 48 h postinfection, the cells were observed under fluorescence microscopy. Scale bar: 100 μm. (C) Quantitative analysis of the average GFP fluorescence intensity as measured using flow cytometry. Data are presented as the means ± SD of three independent experiments. #P < 0.01 versus the PBS group, ***P < 0.01 versus the corresponding serum dilution in the Ad-GFP-treated group. (D) Ad5 specific IgG titer in pre-existing immunity mice before systemic administration was detected by ELISA assay. (E) Viral genome copy numbers in tumors in the absence or presence of anti-Ad5 pre-existing immunity. C57BL/6 mice bearing Hepa1−6 tumors were intravenously injected with 1.5 × 1010 VPs ZD55-IL-24 and PLC-ZD55-IL-24. After 12 h, tumor was harvested (n = 4). **P < 0.01, NS indicates P > 0.05.

ZD55-IL-24 with PEG/Lipids/CaP enabled it to evade the Adinduced innate response, possibly because of reduced Ad uptake by Kupffer cells caused by the shielding of the Ad surface from the immune system. Pre-existing neutralizing antibodies have severe adverse impacts on Ad5-based cancer gene therapy because they can inactivate adenovirus and reduce the expression of inserted genes. A neutralization assay was performed to evaluate the ability of PLC-OncoAd to evade neutralization by pre-existing neutralizing antibodies in vitro. In this context, Ad-GFP (a nonreplicating adenovirus) and PLC-Ad-GFP were incubated with serum containing a high titer of neutralizing antibodies. GFP expression in PLC-Ad-GFP-treated Huh7 cells was significantly higher than in cells that were treated with the corresponding serum dilution of naked Ad-GFP (Figure 6B); naked Ad was neutralized at all serum concentrations. Similarly, when applied to a flow cytometry assay, significantly higher average GFP fluorescence intensities were observed in PLC-AdGFP-treated cells than in Ad-GFP-treated cells (Figure 6C).

LD PLC-ZD55-IL-24-treated mice, although no concomitant significant increase was seen in the serum levels of ALT and AST. PLC-OncoAd Exhibited Reduced Innate Immune Response and Protected Ad from Neutralizing Antibodies. Another major barrier to the systemic administration of Ad5-based adenoviruses is the host immune response to inactive foreign pathogens, including the innate and adaptive immune responses. The severity of the acute liver toxicity that arises from inflammation is dependent on the injected viral dose.44 IL-6 is a major inflammatory cytokine induced by the systemic delivery of Ad. The systemic administration of ZD55IL-24 significantly increased serum IL-6 levels (Figure 6Aa), but the administration of PEG/Lipids/CaP and PLC-ZD55-IL24 did not. In the in vitro assay, the levels of IL-6 in the RAW264.7 medium were significantly increased in the ZD55IL-24-treated group; in contrast, the levels of IL-6 in the medium were not significantly increased in the PLC-ZD55-IL24-treated group. These results suggest that encapsulating 11555

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano

Figure 7. Antitumor efficacy of PLC-ZD55-IL-24 in vivo. (A) Growth curve of subcutaneous tumors. PBS, HD ZD55-IL-24, LD ZD55-IL-24, HD PLC-ZD55-IL-24 and LD PLC-ZD55-IL-24 were intravenously injected into Huh-7 tumor-bearing nude mice four times every other day (LD: low dose = 7.5 × 109 VPs; HD: high dose = 1.5 × 1010 VPs) (n = 8). The arrows indicate the points of treatment. Tumor volume was measured every 3 days. (B) Body weight of the mice on day 24. Data are presented as the means ± SD *P < 0.05, ***P < 0.01, NS indicates P > 0.05 versus the PBS group. (C) Tumor sections were stained with H&E, Hexon, IL-24, PCNA and TUNEL. The three upper panels (H&E, Hexon, and IL-24) were magnified 100-fold, and the lower panel (PCNA and TUNEL) was magnified 200-fold.

low-dose (7.5 × 109 VPs) ZD55-IL-24 and PLC-ZD55-IL-24 were systemically administered every other day (four times in total). Both HD and LD PLC-ZD55-IL-24-treated mice exhibited significant antitumor activity compared with the PBS group (Figure 7A); this was especially true of the HD PLC-ZD55-IL-24-treated mice. The percentage of tumor growth inhibition resulting from LD PLC-ZD55-IL-24 was 37.4% compared with the PBS group; this percentage increased to 54.62% for the HD PLC-ZD55-IL-24-treated group. Although tumor volumes in the HD and LD ZD55-IL-24treated mice were small on average compared with those in the PBS groups, the differences were not significant. Further, the relative tumor volume reduction was positively correlated with the inserted gene (IL-24) expression (Figure S12, P < 0.05, r = 0.76). Animal body weight loss is considered an indicator of cancer cachexia. Compared with the HD and LD PLC-ZD55IL-24-treated mice, body weight loss was observed in the ZD55-IL-24 (HD/LD)- and PBS-treated mice (Figure 7B). These results suggested that an increased therapeutic dose of PLC-ZD55-IL-24 not only enhanced antitumor efficiency in vivo but also might improve prognosis. Naked ZD55-IL-24 induced few reductions in tumor volume; no significant difference was observed between the HD/LD ZD55-IL-24 and PBS groups, even though ZD55-IL-24 exhibited positive tumor cell killing effects in vitro (Figure 3C). These results demonstrated that naked OncoAd was quickly cleared from circulation (Figure 4Ab, Figure 5A) by the immune system and liver sequestration after intravenous injection7 (Figure 4Ac, d and e, Figure 5C,E). Such clearance reduced tumor targeting delivery (Figure 4Aa, and Ba) and

These results implied that PEG/Lipids/CaP protected the OncoAd from serum neutralization in vitro. Further, we tested whether the PLC-ZD55-IL-24 can evade anti-Ad immunity and subsequently maintain the efficacy of tumor targeting delivery in mice with pre-existing immunity. Pre-existing immunity C57BL/6 mice bearing Hepa1−6 xenografts were intravenously injected with 1.5 × 1010 VPs PLC-ZD55-IL-24 or ZD55-IL-24. After 12 h, tumor was harvested and the viral copies were quantified by real time qPCR. ZD55-GFP coated with PEG/ Lipids/CaP did not influence the transfection in Hepa1−6 cells (Figure S10). Before systemic administration, anti-Ad5 IgG levels did not show significant difference between ZD55-IL-24 and PLC-ZD55-IL-24 treated group (Figure 6D). The preexisting anti-Ad5 immunity significantly reduced the viral genome copy numbers in tumor in ZD55-IL-24-treated group, while in the PLC-ZD55-IL-24-treated group elicited effectively delivery regardless of pre-existing immunity (Figure 6E). These results indicated that PLC-ZD55-IL-24 efficiently evaded the pre-existing immunity in vivo and achieve tumor target delivery. The Systemic Administration of PLC-ZD55-IL-24 Enhanced Antitumor Efficacy In Vivo. The antitumor efficacy of OncoAd in intravenous delivery is dictated by early capacity of tumor target delivery and subsequent gene transfer. Systemic administration of PLC-ZD55-IL-24 exhibited an effective tumor target delivery (Figure 4A), and the subsequent expression level of IL-24 in tumors was significantly increased compared to naked ZD55-IL-24 (Figure S11). The antitumor efficacy of PLC-ZD55-IL-24 in vivo was verified on nude mice bearing Huh-7 xenograft tumors. When the tumor volumes reached 100−120 mm3, PBS, high-dose (1.5 × 1010 VPs) and 11556

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano

calculated from optical density measurements at 260 nm (OD260), and one absorbency unit was equal to 1012 VPs/mL. Synthesis and Characterization of mPEG2000-DPPE. DPPE (20 mg, Avanti Polar Lipids, Alabaster, AL, USA) and mPEG2000-COOH (57 mg, Shanghai Yare Biotech, Shanghai, China) were dissolved in 4 mL of ethanol. After the mixture was stirred at 40 °C, 1-Ethyl-3-(3(dimethylamino)propyl) carbodiimide hydrochloride (EDC·HCl) (22 mg) and n-Hydroxysuccinimide (NHS) (13 mg) were added to the solution. The reagents were allowed to react for 4 h at room temperature, and the solution was subsequently dialyzed (molecular weight cutoff: 1000 Da) against distilled water for 24 h. After drying under a vacuum, mPEG2000-DPPE was obtained as a white powder. The chemical structure of mPEG2000-DPPE was confirmed by nuclear magnetic resonance (NMR) spectroscopy. 1H NMR spectra were measured using a Bruker Avance 400 (400 MHz) spectrometer; deuterated chloroform (CDCl3) was used as the solvent. Preparation and Characterization of PLC-ZD55-IL-24. Scheme 1 shows the preparation of PEG/Lipids/CaP encapsulated in ZD55-IL-24. Briefly, 12.5 mM CaCl2 incubated with an aqueous solution of ZD55-IL-24 (containing 1011 viral particles), followed by the dropwise titration of phosphate-buffered saline (containing 2.5 mM PO42−). DOPA (Avanti Polar Lipids, Alabaster, AL, USA) or DOTAP (Avanti Polar Lipids, Alabaster, AL, USA), cholesterol (Sinopharm, Beijing, China), and DPPE-mPEG2000 were dissolved in 2 mL of TCM at a 4:1:0.4 molar ratio; the resulting solution was dried under a vacuum for 2 h, resulting in a dry lipid film. The film was hydrated while gently vortexing with 500 μL of CaP/ZD55-IL-24 or ZD55-IL-24, which was resuspended in Tris-HCL (Sigma-Aldrich, USA) buffer (10 mM, pH 7.4). The suspension was stored at 4 °C. The DOPA-to-CaP/ZD55-IL-24 ratio was optimized by measuring changes in size. The average size, zeta potential and polydispersity index (PDI) of naked OncoAd, DOTAP- OncoAd, and PLC- OncoAd, were determined by dynamic light scattering (DLS) (Malvern Zetasizer nano ZS, UK) measurement. Size distribution of PLC-ZD55-IL-24 was measured using a Nanosight (NTA)−3D Plot (Malvern Nanosight LM10, UK). The morphology and internal structure of the naked OncoAd, and PLC- OncoAd, were characterized by transmission electron microscopy (TEM) (FEI Tecnai G2 Spirit TEM, USA) operating at 80 kV. ZD55IL-24 and PLC-ZD55-IL-24 were negatively stained with 2 wt % uranyl acetate solution in distilled water prior to TEM. Dot Blot. ZD55-IL-24 (2 × 1010 VPs), PLC-ZD55-IL-24 (2 × 1010 VPs), empty PEG/Lipids/CaP and denatured (by incubation in pH 6.0 Tris-HCl for 1 h) ZD55-IL-24 (2 × 1010 VPs/mL), PLC-ZD55-IL24 (2 × 1010 VPs) and empty PEG/Lipids/CaP were spotted onto a Hybond ECL nitrocellulose membrane (GE Healthcare, UK). After blocking in 1.5% BSA-TBS for 2 h, the blots were incubated with mouse antihexon antibody (Abcam, Cambridge, MA, UK) at 1:1000 dilutions. The membranes were then washed with TBS. HRP-linked antimouse IgG (Santa Cruz, CA, USA) at 1:2000 dilutions was used as the secondary antibody. Specific spots were detected using the ECL detection system (Pierce, Rockford, IL, USA). Gel-Retardation Assay. Fifteen microliters of ZD55-IL-24 (1 × 1011 VPs/mL) and PLC-ZD55-IL-24 (1 × 1011 VPs/mL) were loaded onto a 1% (w/v) agarose gel containing ethidium bromide; the samples were electrophoresed at 120 V for 20 min in 1 × TAE buffer at pH 8.0 [10.0 mM Tris/HCl (pH 7.6), 1% (v/v) acetic acid, and 1.0 mM EDTA (pH 8.0)], using PBS as a negative control. Viral DNA was visualized using a Tanon 2500R gel image analysis system (Tanon, Shanghai, China). Storage Stability Assay. PLC-ZD55-IL-24 and ZD55-IL-24 were stored at 4 °C in closed EP tubes without any other precautions and were periodically removed for routine analysis. The average size of the particles was determined in 0.9% NaCl by dynamic light scattering. Cancer cell killing efficiency was measured according to the 3-(4, 5dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay in Huh-7 cells. Serum-Induced Aggregation Assay. Aggregation was monitored by measuring turbidity.45 In belief, ZD55-IL-24, DOTAP-ZD55IL-24 and PLC-ZD55-IL-24 were mixed with 30% FBS (v/v) and

gene transfer (Figure S11), which consequently attenuated the antitumor effects in vivo. The Hexon immunohistochemistry results showed that viral particles were more abundant in the tumors of mice that were treated with PLC-ZD55-IL-24 than in those of mice that were treated with ZD55-IL-24 (Figure 7C). To verify expression and distribution in tumors of the inserted gene IL-24, immunohistochemistry was performed. IL-24 expression was clearly visible in the PLC-ZD55-IL-24-treated tumors. Tumors treated with ZD55-IL-24 exhibited lower levels and narrower region of IL24 expression. These results provided additional evidence that PLC-ZD55-IL-24 had an efficient targeting delivery capability when administered systemically. Moreover, tumors obtained from the PLC-ZD55-IL-24-treated mice exhibited larger necrotic areas than those harvested from PBS- and ZD55-IL24-treated mice. Proliferating cell nuclear antigen (PCNA) immunohistochemical analysis showed a dramatic decrease in tumor cell proliferation in the tumors of PLC-ZD55-IL-24treated mice. Furthermore, a TUNEL assay showed that an apparent increase in apoptotic cells was observed in the tumors that were harvested from PLC-ZD55-IL-24-treated mice (Figure 7C). These results demonstrate that the intravenous administration of PLC-ZD55-IL-24 effectively delivered ZD55IL-24 to the tumor and exhibiting antitumor efficacy because of the apoptosis induction and proliferation inhibition in tumor cell.

CONCLUSION A negatively (nearly neutral) charged PLC-ZD55-IL-24 complex was successfully constructed. Masking the surface of OncoAd shielded it from sequestration in liver, prolonged circulation time, and protected it from neutralization by preexisting neutralizing antibodies. After systemic administration, PLC-ZD55-IL-24 induced negligible hepatic toxicity and a negligible innate immune response. The efficient tumortargeting ability and antitumor effect were observed. Increasing the dose of PLC-ZD55-IL-24 improved the therapeutic efficacy and prognosis without inducing severe toxicity. These results indicate that PLC-OncoAd might be a safe and effective platform for improved delivery of OncoAd via systemic administration for cancer gene therapy. METHODS Cell Culture and Adenoviruses Generation. The following cell lines were obtained from the Cell Bank of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China). HEK293 cell is a human embryonic kidney cell line, transformed with Ad5 E1. Huh-7, Hep3B and HepG2 are the human hepatocellular carcinoma cell lines. Hepa1−6 is the mouse hepatoma cells. Additionally, QSG-7701, L02 normal human liver cell lines was employed. L-929 cells are mouse fibroblast cells and can be used for toxicity testing as a standard. All cell lines were cultured in Dulbecco’s Modified Eagle’s Medium or RPMI1640 (GIBCO BRL, Grand Island, NY, USA) with 10% fetal bovine serum (FBS) (GIBCO BRL, Grand Island, NY, USA), 50 U/mL penicillin and 50 μg/mL streptomycin at 37 °C in a humidified atmosphere with 5% CO2. The three recombinant adenoviruses (Ad-GFP, ZD55-GFP, ZD55IL-24) used in this study have been previously described.2,3 Briefly, Ad-GFP is a nonreplicating adenovirus vector carrying enhanced green fluorescence protein (GFP). ZD55-GFP is a conditionally replicating adenovirus with E1B (55kd)-deleted expressing enhanced green fluorescent protein (GFP). ZD55-IL-24 is also a conditionally replicating adenovirus with E1B (55kd)-deleted carrying IL-24. Adenovirus were propagated in HEK293 cells and purified by CsCl equilibrium centrifugation. The numbers of viral particles (VPs) were 11557

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano incubated at 37 °C. All samples contained a final viral particle concentration of 2 × 1010 VPs/mL. The absorbance of the complexes in the absence and presence of 30% (v/v) serum was measured at 500 nm, and a corresponding amount of serum alone was used as a reference. The absorbance was measured at 1 min, 30 min, 1 h, 4 h, 12 h, 16 h, 24 h and 30 h. A relative turbidity value of 1 indicated that the turbidity of the serum-incubated complexes was equal to the turbidity of a buffer-incubated sample. Cell Viability Assay. The cytotoxicity of PEG/Lipids/CaP was analyzed in L02, QSG-7701 and L-929 cell lines at various concentrations. Hepatocellular cancer cell lines (Huh-7, Hep3B, and HepG2) and normal human liver cells (QSG-7701) were used to evaluate the cytotoxicity of PLC-ZD55-IL-24. The studied groups were as follows: PEG/Lipids/CaP (1.25 μg/mL), ZD55-IL-24 and PLCZD55-IL-24 (160 VPs/cell for cancer cells; serially diluted VPs for QSG-7701, up to 800 VPs/cell). Briefly, cells were seeded at 4000 cells per well in 96-well plates in 10% FBS containing Dulbecco’s Modified Eagle’s Medium or RPMI1640; the indicated treatment followed. At the indicated time, 20 μL of 4 mg/mL MTT was added to each well, and the plates were then incubated at 37 °C for 4 h. After removal of the supernatant, the precipitate was dissolved in 150 μL of dimethyl sulfoxide (DMSO), and the absorbance was measured at 490 and 630 nm using a Microplate Spectrophotometer (BioTek Eon, Vermont, USA). Real Time qPCR Analysis. After cells, tissues or plasma were collected, DNA samples were extracted by QIAamp DNA mini kits (QIAGEN, Duesseldorf, Germany) or Cell/tissue genomic DNA Extraction Kit (Generay, Shanghai, China). Primers for Adenovirus E3 gene (5′TACCGGACTTACATCTACCAC3′ and 5′AACATAAGCGCTATGGAGAAC3′) were used. The Quantifect SYBR Green Kit was used to prepare the PCR reaction mixture. A standard curve was constructed using the following serial Ad plasmid concentrations: 1010, 109, 108, 107, 106, 105 and 104 copies/mL. Thermocycling parameters were optimized as 5 min at 95 °C, followed by 40 cycles of 95 °C (15 s), at 56 °C (15 s), 72. °C (20 s), melt curve: 65 to 95 °C, increment 0.5 °C for 5 s. Virus Proliferation Assay. Cells (Huh-7, Hepa1−6) were infected with ZD55-IL-24 or PLC-ZD55-IL-24 at 160 VPs/cell. After 8 h, the cells were washed three times with PBS and incubated with Dulbecco’s Modified Eagle’s Medium containing 10% FBS. Medium and cells were collected at this time point (considered the virus production baseline) and 48 h later. The virus was released by three freeze− thawing cycles and centrifuging to collect the supernatant. Virus production was determined using a standard plaque assay HEK293 cells. Virus proliferation is expressed as fold-multiplication (virus production (48 h)/baseline virus production). Hoechst Staining. Huh-7 and QSG-7701 cells were infected with ZD55-IL-24 or PLC -ZD55-IL-24 at 160 VPs/cell. Forty 8 h later, the cells were fixed with 4% paraformaldehyde (PFA) for 20 min, stained with Hoechst 33258 (Molecular Probes, Eugene, OR, USA) at 1 μg/ mL for 10 min, and examined with a fluorescence microscope. Annexin V Binding Assay. Huh-7 cells were infected with ZD55IL-24 or PLC-ZD55-IL-24 at 160 VPs/cell, and 48 h later, the cells were harvested and resuspended in 50 μL of binding buffer and stained with fluorescein isothiocyanate (FITC)-labeled annexin V and propidium iodide (PI) (Beyotime Biotech, Shanghai, China) according to the manufacturer’s instructions. A fluorescence-activated cell-sorting (FACS) assay was performed after staining. Western Blot. The Western blot was performed according to standard procedures. The primary antibody against IL-24 was purchased from Cell Signaling Technology. The primary antibody against human Adenovirus Hexon was obtained from Abcam plc (Cambridge, MA, UK). The primary antibody against pro-caspase 9, pro-caspase 3, PARP, β-Tubulin were obtained from Santa Cruz biotechnology (Santa Cruz, CA, USA). All of the secondary antibodies were purchased from Santa Cruz biotechnology. Animal Experiments. All animal experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at the Shanghai Institutes for Biological Sciences. BALB/c

nude mice, BALB/c mice and C57BL/6 were obtained from SLAC (Shanghai, China), raised in the SPF animal facility. Biodistribution. Huh-7 cells (2 × 106) were subcutaneously injected into the lower right back of 4- to 5-week-old female nude mouse. When the tumor size reached approximately 300 mm3, the mice were treated with ZD55-IL-24 (1.5 × 1010VPs), PLC-ZD55-IL24(1.5 × 1010VPs) and PBS via tail vein injection. Mice were sacrificed, and heart, liver, spleen, lung, kidney and brain were harvested after 6, 12, 36, 96 h, tumors were harvested after 6, 12, 36, 48 h. Blood was collected after 10 min, 15 min, 30 min, 45 min, 1 h, 12 h, 24 h and 36 h. DNA samples were extracted and followed by real time qPCR analysis to qualify the viral genome (E3 gene). To confirm the targeting delivery capacity of OncoAd, a fluorescence imaging system was used to monitor GFP intensity in tissues. Nude mice bearing Huh-7 subcutaneous tumors were intravenously injected with a low dose (7.5 × 109 VPs), or high dose (1.5 × 1010 VPs) of ZD55-GFP and PLC-ZD55-GFP, four times every other day, PBS as a control. The mice were sacrificed, and the tissues were harvested 4 days after the final treatment followed by imaging with a fluorescence imaging system (LB 983, Berthold Technologies Gmbh & Co.KG). The WinLight 32 software (Berthold) was used for quantity analysis. The threshold of fluorescence emission was set to the same level to ensure the comparability. Assessment of Liver Sequestration, Toxicity and Circulation Half-Life. Six-week-old female BALB/c mice were intravenously injected with low-dose (7.5 × 109 VPs) and high-dose (1.5 × 1010 VPs) ZD55-IL-24 and PLC-ZD55-IL-24. Four days after the injection, body weight was measured. Serum was collected and centrifuged at 3000 rpm for 10 min, and serum samples were analyzed using an Automatic Biochemistry Analyzer (Roche, Module p800) to determine ALT and AST levels. The liver was collected and processed for hematoxylin and eosin staining, immunohistochemical staining (IL-24) and viral genome copy measurement (E3 gene) using an absolute realtime qPCR. Separate cohort of mice were intravenously injected with a dose of 6.5 × 1011 VPs/kg ZD55-IL-24 and PLC-ZD55-IL-24. Blood was collected (50 μL) after 1 min, 5 min, 15 min, 30 min, 45 min. The blood volume for each mouse was calculated on the assumption that mice contain a blood volume of 7.3% body weight (1.46 mL/20 g). DNA samples were extracted. Viral copy number (E3 gene) was qualified by real-time qPCR. Mice were sacrificed at 48 h after intravenous injection, and the liver was harvested for TEM image. Mice treated with PBS served as negative control. Evaluation of the Innate and Adaptive Immune Response. For evaluating the innate immune response, Interleukin 6 (IL-6) was determined both in medium of murine RAW264.7 macrophage cells and in serum of BALB/c mice. Murine RAW264.7 macrophage cells were seeded on 6-well plate at a density of 5 × 105/well. After 24 h, the cells were infected with PBS, PEG/Lipids/CaP (10 μg/mL), ZD55-IL-24 (1000 VPs/cell) and PLC-ZD55-IL-24 (1000 VPs/cell) in FBS free DMEM. After 6 h, 10% FBS containing Dulbecco’s Modified Eagle’s Medium was added. The supernatant from the infected cells was collected and analyzed for the concentration of IL-6 using an enzyme linked immuno-sorbent assay (ELISA) kit (Roche, Basel, Switzerland). Serum levels of IL-6 were measured after the intravenous injection of PBS, PEG/Lipids/CaP (300 μg), ZD55-IL-24 (1.5 × 1010 VPs) and PLC-ZD55-IL-24 (1.5 × 1010 VPs) into BALB/c mice (6 weeks, female). After 6 h, the serum was collected and the IL6 levels were quantified using an enzyme linked immuno-sorbent assay (ELISA) kit (Roche, Basel, Switzerland). Neutralization assay was performed to evaluating the evasion of the pre-existing neutralizing antibodies both in vitro and in vivo. First, Antiadenovirus antiserum was prepared as follows. The BALB/c mice were treated with twice 1.5 × 1010 VPs intravenous injections of ZD55-IL-24. The second injection of each vector was administered 14 days after the first injection. Blood was collected from the ZD55-IL-24 immunized mice. The serum was heat-inactivated for 45 min at 56 °C and stored at −80 °C. Then neutralization assay was performed. Huh7 cells were plated in 6-well plates at a density of 2 × 105/well. After 24 h, Ad-GFP and PLC-Ad-GFP was added to the cells after incubation with antiadenovirus antiserum for 1 h at 37 °C at 200VPs/ 11558

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano cell. The serum was diluted to 1/256 by 1/2 serial dilutions. Samples were incubated with cells at 37 °C and 5%CO2. After 48 h, the cells were observed under fluorescence microscopy, and were harvested and resuspended in PBS followed by a fluorescence-activated cell-sorting (FACS) assay. To evaluate the protection of PLC-ZD55-IL-24 against pre-existing neutralizing antibodies in vivo, an active anti-Ad5 immunity animal model was established.46 C57BL/6 mice (6-week-old, female) with pre-existing anti-Ad5 immunity were generated by intravenous injection of 1010 VPs of Ad5 empty vector. Two days after the preexisting immunity, Hepa1−6 cells (5 × 106) were subcutaneously injected into the lower right back of the pre-existing immunity mice. Mice bearing Hepa1−6 which not be injected with Ad empty vector were as control. Anti-Ad5 IgG in mice serum was detected by mouse IgG ELISA kit (mlbio, Shanghai, China).When the tumor volumes reached 100−120 mm3, 1.5 × 1010 VPs ZD55-IL-24 and PLC-ZD55IL-24 were systemically administered. After 12 h, the viral genome (E3 gene) in tumors was quantified by real time qPCR. Assessment of the Antitumor Efficacy. Once the subcutaneous Huh-7 tumor xenograft size reached a volume of 90−110 mm3, the mice were randomized into five groups (PBS, low dose ZD55-IL-24, high dose ZD55-IL-24, low dose PLC-ZD55-IL-24 and high dose PLC-ZD55-IL-24; n = 8 per group). The mice were intravenously injected with phosphate buffer saline (PBS), a low dose (7.5 × 109 VPs), or a high dose (1.5 × 1010 VPs) of ZD55-IL-24 and PLC-ZD55IL-24 four times every other day. Tumor size (volume = 0.523 × length × width2) and body weight were measured every 3 days. At the end of treatment, the mice body weight with the tumor tissue weight subtracted was measured. The percentage of tumor growth inhibition was calculated, and taken tumor weight as index. The formula is as follows: (the average tumor weight of controls − the average tumor weight of treatments)/ the average tumor weight of controls × 100%. Relative tumor volume was calculated by the individual tumor volume related to the values at the initial tumor volume. The correlation between the reduction in relative tumor volume to the genetic targeting (mRNA levels of IL-24) was evaluated at the end point using Quantitative RT-PCR. Immunohistochemical and Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay. Tumor tissues were harvested from mice 4 days after the final intravenous injection, fixed in 4% paraformaldehyde (PFA) for histological and immunohistochemical examination. Tumor sections were stained with hematoxylin and eosin (H&E). The tumor sections were further stained incubated with an anti-Hexon antibody (Abcam, Cambridge, MA, UK), an antiproliferating cell nuclear antigen antibody (Abcam, Cambridge, MA, UK), and an anti-IL-24 antibody (Cell Signaling Technology, Danvers, MA, USA). After overnight incubation with the primary antibodies at 4 °C, tumor sections were treated with biotinylated secondary antibody. The antibody complex was detected using an ABC Kit (Vector Laboratories, Burlingame, CA, USA). Apoptotic cells in the tumor tissue sections were detected using a TUNEL assay (In Situ Cell Death Detection Kit, Fluorescein, Roche, Basel, Switzerland). The staining was performed according to the manufacturer’s recommendations. Statistical Analysis. All quantitative data are expressed as the means ± standard deviation. Comparisons between two groups were performed using Student’s t-test. Comparisons between multiple groups were performed by single-factor analysis of variance (ANOVA) (GraphPad Software, San Diego, CA). Differences were considered significant at P < 0.05.

AUTHOR INFORMATION Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. *E-mail: [email protected]. ORCID

Yourong Duan: 0000-0002-3781-7845 Notes

The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (No. 81472841, No. 81572999, No. 81502692), the State Key Laboratory of Oncogenes and Related Genes (No. 91-14-01, No.91-15-08), the Shanghai Municipal Health and Family Planning Commission Foundation (No. 201440015), the Science and Technology Commission foundation of Shanghai (No.14JC1492500). We thank the staff at the Cell Center and animal core facility of the Institute of Biochemistry and Cell Biology for their assistance with the flow cytometry assays and animal experiments. We thank Lanying Sun for help with the cell culture. REFERENCES (1) Russell, S. J.; Peng, K. W.; Bell, J. C. Oncolytic Virotherapy. Nat. Biotechnol. 2012, 30, 658−670. (2) Zhao, L.; Gu, J.; Dong, A.; Zhang, Y.; Zhong, L.; He, L.; Wang, Y.; Zhang, J.; Zhang, Z.; Huiwang, J.; Qian, Q.; Qian, C.; Liu, X. Potent Antitumor Activity of Oncolytic Adenovirus Expressing Mda7/Il-24 for Colorectal Cancer. Hum. Gene Ther. 2005, 16, 845−858. (3) Liu, X. Y.; Gu, J. F. Targeting Gene-Virotherapy of Cancer. Cell Res. 2006, 16, 25−30. (4) Makower, D.; Rozenblit, A.; Kaufman, H.; Edelman, M.; Lane, M. E.; Zwiebel, J.; Haynes, H.; Wadler, S. Phase II Clinical Trial of Intralesional Administration of the Oncolytic Adenovirus Onyx-015 in Patients with Hepatobiliary Tumors with Correlative P53 Studies. Clin. Cancer Res. 2003, 9, 693−702. (5) Pol, J.; Bloy, N.; Obrist, F.; Eggermont, A.; Galon, J.; Cremer, I.; Erbs, P.; Limacher, J. M.; Preville, X.; Zitvogel, L.; Kroemer, G.; Galluzzi, L. Trial Watch:: Oncolytic Viruses for Cancer Therapy. Oncoimmunology 2014, 3, e28694. (6) Waddington, S. N.; McVey, J. H.; Bhella, D.; Parker, A. L.; Barker, K.; Atoda, H.; Pink, R.; Buckley, S. M.; Greig, J. A.; Denby, L.; Custers, J.; Morita, T.; Francischetti, I. M.; Monteiro, R. Q.; Barouch, D. H.; van Rooijen, N.; Napoli, C.; Havenga, M. J.; Nicklin, S. A.; Baker, A. H. Adenovirus Serotype 5 Hexon Mediates Liver Gene Transfer. Cell 2008, 132, 397−409. (7) Shayakhmetov, D. M.; Gaggar, A.; Ni, S.; Li, Z. Y.; Lieber, A. Adenovirus Binding to Blood Factors Results in Liver Cell Infection and Hepatotoxicity. J. Virol. 2005, 79, 7478−7491. (8) Appledorn, D. M.; McBride, A.; Seregin, S.; Scott, J. M.; Schuldt, N.; Kiang, A.; Godbehere, S.; Amalfitano, A. Complex Interactions with Several Arms of the Complement System Dictate Innate and Humoral Immunity to Adenoviral Vectors. Gene Ther. 2008, 15, 1606−1617. (9) Hendrickx, R.; Stichling, N.; Koelen, J.; Kuryk, L.; Lipiec, A.; Greber, U. F. Innate Immunity to Adenovirus. Hum. Gene Ther. 2014, 25, 265−284. (10) Miest, T. S.; Cattaneo, R. New Viruses for Cancer Therapy: Meeting Clinical Needs. Nat. Rev. Microbiol. 2014, 12, 23−34. (11) Sarkioja, M.; Pesonen, S.; Raki, M.; Hakkarainen, T.; Salo, J.; Ahonen, M. T.; Kanerva, A.; Hemminki, A. Changing the Adenovirus Fiber for Retaining Gene Delivery Efficacy in the Presence of Neutralizing Antibodies. Gene Ther. 2008, 15, 921−929. (12) Xu, W.; Zhang, Z.; Yang, Y.; Hu, Z.; Wang, C. H.; Morgan, M.; Wu, Y.; Hutten, R.; Xiao, X.; Stock, S.; Guise, T.; Prabhakar, B. S.;

ASSOCIATED CONTENT S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acsnano.6b06182. Figures S1−S12 (PDF) 11559

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560

Article

ACS Nano Brendler, C.; Seth, P. Ad5/48 Hexon Oncolytic Virus Expressing Stgfbetariifc Produces Reduced Hepatic and Systemic Toxicities and Inhibits Prostate Cancer Bone Metastases. Mol. Ther. 2014, 22, 1504− 1517. (13) Haralambieva, I.; Iankov, I.; Hasegawa, K.; Harvey, M.; Russell, S. J.; Peng, K. W. Engineering Oncolytic Measles Virus to Circumvent the Intracellular Innate Immune Response. Mol. Ther. 2007, 15, 588− 597. (14) Kaufmann, J. K.; Nettelbeck, D. M. Virus Chimeras for Gene Therapy, Vaccination, and Oncolysis: Adenoviruses and Beyond. Trends Mol. Med. 2012, 18, 365−376. (15) Magnusson, M. K.; Hong, S. S.; Henning, P.; Boulanger, P.; Lindholm, L. Genetic Retargeting of Adenovirus Vectors: Functionality of Targeting Ligands and Their Influence on Virus Viability. J. Gene Med. 2002, 4, 356−370. (16) Han, J.; Zhao, D.; Zhong, Z.; Zhang, Z.; Gong, T.; Sun, X. Combination of Adenovirus and Cross-Linked Low Molecular Weight Pei Improves Efficiency of Gene Transduction. Nanotechnology 2010, 21, 105106. (17) Park, J. W.; Mok, H.; Park, T. G. Physical Adsorption of Peg Grafted and Blocked Poly-L-Lysine Copolymers on Adenovirus Surface for Enhanced Gene Transduction. J. Controlled Release 2010, 142, 238−244. (18) Kim, P. H.; Kim, T. I.; Yockman, J. W.; Kim, S. W.; Yun, C. O. The Effect of Surface Modification of Adenovirus with an ArginineGrafted Bioreducible Polymer on Transduction Efficiency and Immunogenicity in Cancer Gene Therapy. Biomaterials 2010, 31, 1865−1874. (19) Park, Y.; Kang, E.; Kwon, O. J.; Hwang, T.; Park, H.; Lee, J. M.; Kim, J. H.; Yun, C. O. Ionically Crosslinked Ad/Chitosan Nanocomplexes Processed by Electrospinning for Targeted Cancer Gene Therapy. J. Controlled Release 2010, 148, 75−82. (20) Singh, R.; Al-Jamal, K. T.; Lacerda, L.; Kostarelos, K. Nanoengineering Artificial Lipid Envelopes around Adenovirus by Self-Assembly. ACS Nano 2008, 2, 1040−1050. (21) Jones, C. F.; Campbell, R. A.; Brooks, A. E.; Assemi, S.; Tadjiki, S.; Thiagarajan, G.; Mulcock, C.; Weyrich, A. S.; Brooks, B. D.; Ghandehari, H.; Grainger, D. W. Cationic Pamam Dendrimers Aggressively Initiate Blood Clot Formation. ACS Nano 2012, 6, 9900−9910. (22) Verma, A.; Stellacci, F. Effect of Surface Properties on Nanoparticle-Cell Interactions. Small 2010, 6, 12−21. (23) Ishida, T.; Harashima, H.; Kiwada, H. Liposome Clearance. Biosci. Rep. 2002, 22, 197−224. (24) LeGeros, R. Z. Calcium Phosphate-Based Osteoinductive Materials. Chem. Rev. 2008, 108, 4742−4753. (25) Fasbender, A.; Lee, J. H.; Walters, R. W.; Moninger, T. O.; Zabner, J.; Welsh, M. J. Incorporation of Adenovirus in Calcium Phosphate Precipitates Enhances Gene Transfer to Airway Epithelia in Vitro and in Vivo. J. Clin. Invest. 1998, 102, 184−193. (26) Maitra, A. Calcium Phosphate Nanoparticles: SecondGeneration Nonviral Vectors in Gene Therapy. Expert Rev. Mol. Diagn. 2005, 5, 893−905. (27) Xu, G.; Aksay, I. A.; Groves, J. T. Continuous Crystalline Carbonate Apatite Thin Films. A Biomimetic Approach. J. Am. Chem. Soc. 2001, 123, 2196−2203. (28) Li, J.; Yang, Y.; Huang, L. Calcium Phosphate Nanoparticles with an Asymmetric Lipid Bilayer Coating for Sirna Delivery to the Tumor. J. Controlled Release 2012, 158, 108−114. (29) Cotmore, J. M.; Nichols, G., Jr.; Wuthier, R. E. PhospholipidCalcium Phosphate Complex: Enhanced Calcium Migration in the Presence of Phosphate. Science 1971, 172, 1339−1341. (30) Suk, J. S.; Xu, Q.; Kim, N.; Hanes, J.; Ensign, L. M. Pegylation as a Strategy for Improving Nanoparticle-Based Drug and Gene Delivery. Adv. Drug Delivery Rev. 2016, 99, 28−51. (31) Chen, K.; Xu, J.; Luft, J. C.; Tian, S.; Raval, J. S.; DeSimone, J. M. Design of Asymmetric Particles Containing a Charged Interior and a Neutral Surface Charge: Comparative Study on in Vivo Circulation of Polyelectrolyte Microgels. J. Am. Chem. Soc. 2014, 136, 9947−9952.

(32) O’Shea, C. C.; Johnson, L.; Bagus, B.; Choi, S.; Nicholas, C.; Shen, A.; Boyle, L.; Pandey, K.; Soria, C.; Kunich, J.; Shen, Y.; Habets, G.; Ginzinger, D.; McCormick, F. Late Viral Rna Export, Rather Than P53 Inactivation, Determines Onyx-015 Tumor Selectivity. Cancer Cell 2004, 6, 611−623. (33) Dash, R.; Bhutia, S. K.; Azab, B.; Su, Z. Z.; Quinn, B. A.; Kegelmen, T. P.; Das, S. K.; Kim, K.; Lee, S. G.; Park, M. A.; Yacoub, A.; Rahmani, M.; Emdad, L.; Dmitriev, I. P.; Wang, X. Y.; Sarkar, D.; Grant, S.; Dent, P.; Curiel, D. T.; Fisher, P. B. Mda-7/Il-24: A Unique Member of the Il-10 Gene Family Promoting Cancer-Targeted Toxicity. Cytokine Growth Factor Rev. 2010, 21, 381−391. (34) Wang, C. J.; Zhang, H.; Chen, K.; Zheng, J. W.; Xiao, C. W.; Ji, W. W.; Yu, Y.; Hu, H. Y.; Li, Y.; Xue, X. B. Ad.Mda-7 (Il-24) Selectively Induces Apoptosis in Hepatocellular Carcinoma Cell Lines, Suppresses Metastasis, and Enhances the Effect of Doxorubicin on Xenograft Tumors. Oncol. Res. 2010, 18, 561−574. (35) Li, S. D.; Huang, L. Pharmacokinetics and Biodistribution of Nanoparticles. Mol. Pharmaceutics 2008, 5, 496−504. (36) Underhill, D. M.; Ozinsky, A. Phagocytosis of Microbes: Complexity in Action. Annu. Rev. Immunol. 2002, 20, 825−852. (37) Jaffe, H. A.; Danel, C.; Longenecker, G.; Metzger, M.; Setoguchi, Y.; Rosenfeld, M. A.; Gant, T. W.; Thorgeirsson, S. S.; Stratford-Perricaudet, L. D.; Perricaudet, M.; Pavirani, A.; Lecocq, J.P.; Crystal, R. G. Adenovirus-Mediated in Vivo Gene Transfer and Expression in Normal Rat Liver. Nat. Genet. 1992, 1, 372−378. (38) Alba, R.; Bradshaw, A. C.; Parker, A. L.; Bhella, D.; Waddington, S. N.; Nicklin, S. A.; van Rooijen, N.; Custers, J.; Goudsmit, J.; Barouch, D. H.; McVey, J. H.; Baker, A. H. Identification of Coagulation Factor (F)X Binding Sites on the Adenovirus Serotype 5 Hexon: Effect of Mutagenesis on Fx Interactions and Gene Transfer. Blood 2009, 114, 965−971. (39) Lieber, A.; He, C. Y.; Meuse, L.; Schowalter, D.; Kirillova, I.; Winther, B.; Kay, M. A. The Role of Kupffer Cell Activation and Viral Gene Expression in Early Liver Toxicity after Infusion of Recombinant Adenovirus Vectors. J. Virol. 1997, 71, 8798−8807. (40) Doronin, K.; Flatt, J. W.; Di Paolo, N. C.; Khare, R.; Kalyuzhniy, O.; Acchione, M.; Sumida, J. P.; Ohto, U.; Shimizu, T.; AkashiTakamura, S.; Miyake, K.; MacDonald, J. W.; Bammler, T. K.; Beyer, R. P.; Farin, F. M.; Stewart, P. L.; Shayakhmetov, D. M. Coagulation Factor X Activates Innate Immunity to Human Species C Adenovirus. Science 2012, 338, 795−798. (41) Alemany, R.; Suzuki, K.; Curiel, D. T. Blood Clearance Rates of Adenovirus Type 5 in Mice. J. Gen. Virol. 2000, 81, 2605−2609. (42) Reid, T.; Warren, R.; Kirn, D. Intravascular Adenoviral Agents in Cancer Patients: Lessons from Clinical Trials. Cancer Gene Ther. 2002, 9, 979−986. (43) Wang, X.; Sun, C.; Li, P.; Wu, T.; Zhou, H.; Yang, D.; Liu, Y.; Ma, X.; Song, Z.; Nian, Q.; Feng, L.; Qin, C.; Chen, L.; Tang, R. Vaccine Engineering with Dual-Functional Mineral Shell: A Promising Strategy to Overcome Preexisting Immunity. Adv. Mater. 2016, 28, 694−700. (44) Brunetti-Pierri, N.; Palmer, D. J.; Beaudet, A. L.; Carey, K. D.; Finegold, M.; Ng, P. Acute Toxicity after High-Dose Systemic Injection of Helper-Dependent Adenoviral Vectors into Nonhuman Primates. Hum. Gene Ther. 2004, 15, 35−46. (45) Zhang, Y.; Anchordoquy, T. J. The Role of Lipid Charge Density in the Serum Stability of Cationic Lipid/DNA Complexes. Biochim. Biophys. Acta, Biomembr. 2004, 1663, 143−157. (46) Roberts, D. M.; Nanda, A.; Havenga, M. J.; Abbink, P.; Lynch, D. M.; Ewald, B. A.; Liu, J.; Thorner, A. R.; Swanson, P. E.; Gorgone, D. A.; Lifton, M. A.; Lemckert, A. A.; Holterman, L.; Chen, B.; Dilraj, A.; Carville, A.; Mansfield, K. G.; Goudsmit, J.; Barouch, D. H. HexonChimaeric Adenovirus Serotype 5 Vectors Circumvent Pre-Existing Anti-Vector Immunity. Nature 2006, 441, 239−243.

11560

DOI: 10.1021/acsnano.6b06182 ACS Nano 2016, 10, 11548−11560