Optimization of Vinyl Sulfone Derivatives as Potent Nuclear Factor

Subscriber access provided by YORK UNIV

Article

Optimization of Vinyl Sulfone Derivatives as Potent Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Activators for Parkinson’s Disease Therapy Ji Won Choi, Siwon Kim, Jong-Hyun Park, Hyeon Jeong Kim, Su Jeong Shin, Jin Woo Kim, Seo Yeon Woo, Changho Lee, Sang Moon Han, Jaeick Lee, Ae Nim Pae, Gyoonhee Han, and Ki Duk Park J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.8b01527 • Publication Date (Web): 12 Dec 2018 Downloaded from http://pubs.acs.org on December 13, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Optimization of Vinyl Sulfone Derivatives as Potent Nuclear Factor Erythroid 2-Related Factor 2 (Nrf2) Activators for Parkinson’s Disease Therapy

Ji Won Choia,1, Siwon Kima,b,1, Jong-Hyun Parka, Hyeon Jeong Kima,c, Su Jeong Shina, Jin Woo Kima, Seo Yeon Wooa, Changho Leed, Sang Moon Hane, Jaeick Leee, Ae Nim Paea,b,f, Gyoonhee Hanc and Ki Duk Parka,b,f,*

aConvergence

Research Center for Diagnosis, Treatment & Care System of Dementia, Korea

Institute of Science & Technology (KIST), Seoul, bDivision of Bio-Med Science & Technology, KIST School, Korea University of Science and Technology, Seoul, cDepartment of Biotechnology, Yonsei University, Seoul, dDivision of Functional Food Research, Korea Food Research Institute, Jeollabuk-do,

eDoping

Control Center, KIST, Seoul, fKHU-KIST

Department of Converging Science and Technology, Kyung Hee University, Seoul, Republic of Korea

1 These

authors contributed equally to this work.

Address correspondence to: Ki Duk Park, Ph.D., aConvergence Research Center for Diagnosis, Treatment & Care System of Dementia, Korea Institute of Science & Technology, 5 Hwarangro, 14-gil, Seongbuk-gu, Seoul 136-791, South Korea; Email: [email protected].

1 ACS Paragon Plus Environment

Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT We previously developed a novel series of vinyl sulfones as nuclear factor E2-related factor 2 (Nrf2) activators with therapeutic potential for Parkinson’s disease (PD). However, the previously developed lead compound (1) exhibited undesirable drug-like properties. Here we optimized vinyl sulfones by introducing nitrogen heterocycles to improve drug-like properties. Among the synthesized compounds, 17e was the most promising drug candidate with good drug-like properties. 17e showed superior effects on Nrf2 activation in cell-based assays compared to compound 1 (17e: EC50 = 346 nM; 1: EC50 = 530 nM). 17e was further confirmed to induce expression of Nrf2-dependent antioxidant enzymes at both mRNA and protein levels. In a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced mouse model of PD, 17e significantly attenuated loss of tyrosine hydroxylase (TH)-immunopositive dopaminergic (DAergic) neurons, suppressed microglial activation, and alleviated PD-associated motor dysfunction. Thus, 17e is a novel Nrf2 activator with excellent drug-like properties and represents a potential therapeutic candidate for PD.


Page 2 of 74

Page 3 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


INTRODUCTION PD is the second most common neurodegenerative disorder after Alzheimer’s disease and mainly affects the motor system. The incidence of PD is about 1%-4% of populations over 60 years of age, and main clinical features often include tremors, rigidity, posture instability, akinesia, and cognitive impairment.1,2 The major pathophysiology of PD is loss of DAergic neurons in the substantia nigra pars compacta (SNpc).3,4 Hence, most treatment strategies focus on increasing dopamine levels, typically using L-3,4-dihydroxyphenylalanine (L-DOPA) as a precursor, to alleviate symptoms. However, L-DOPA only ameliorates motor symptoms for a short period of time and can cause side effects, such as L-DOPA-induced dyskinesia, when taken for long periods.5-7 Therefore, it is important to develop new therapies that prevent the death of DAergic neurons in PD-affected brain areas and increase dopamine levels.3,8,9 Unfortunately, the exact mechanism of DAergic neuronal cell death in PD patients remains unclear, but many recent studies have shown that oxidative stress plays an important role.10-12 Oxidative stress is caused by an imbalance in the production of reactive oxygen species and cellular antioxdant defense systems.13-16 Thus, upregulation of endogenous antioxidant defense genes is an attractive strategy for the treatment of various brain diseases associated with oxidative stress, including Alzheimer’s disease, PD, and epilepsy.17-20 The Kelch-like ECH-associated protein 1 (Keap1)-Nrf2 system is the main signaling pathway involved cellular defense against oxidative stress. Nrf2 is a transcription factor that regulates oxidative stress by inducing expression of antioxidant enzyme genes, such as heme oxygenase1 (HO-1), NAD(P)H quinone oxidoreductase 1, glutamate-cysteine ligase (GCL), and several members of the glutathione S-transferase family.21,22 Under normal conditions, Nrf2 binding to the repressor protein Keap1 is maintained at low levels in the cytoplasm through Keap1dependent ubiquitination and proteasomal degradation. Under conditions of oxidative stress, 3 ACS Paragon Plus Environment


Page 4 of 74

Nrf2 is released from Keap1 and translocates into the nucleus, where it binds the promoter region of the antioxidant response element that is associated with expression of antioxidant genes.17-20 Therefore, targeting the Keap1-Nrf2 signaling pathway has been considered for the reduction or prevention of neuronal cell death, with Nrf2 activation representing a promising avenue for PD therapy. In our previous studies,23,24 we developed a series of neuroprotective vinyl sulfones which targeted the Keap1-Nrf2 signaling pathway. In particular, the lead compound (1) was found to exhibit the most potent Nrf2 activation and subsequent dose-dependent induction of Nrf2dependent antioxidant enzyme expression. Compound 1 also exhibited promising efficacy in the MPTP-induced PD mouse model but had poor drug-like properties, such as low solubility, metabolic stability, cytochrome P (CYP) inhibition, and human ether-a-go-go-related gene (hERG) safety .

OMe O S A O

Cl

Aqueous solubility

< 0.01 mg/mL

B

CYP inhibition (% of control activity)

5.4 (2C19), 88.1 (2D6), 100 (2C9), 41.7 (1A2), 42.3 (3A4)

Human microsomal stability (% remaining after 30 min)

20%

1 Nrf2 EC50 = 530 nM Low solublity, unfavorable drug-like properties

In the present study, we attempted to improve the drug-like properties of compound 1 by introducing nitrogen heterocycles because nitrogen heterocyles are among the most significant structural components of pharmaceuticals and 59% of unique small-molecule drugs in U.S. FDA approved drugs contain a nitrogen heterocycle.25,26 In addtion, recent studies suggested that a morpholine moiety seemed to improve drug-like properties of molecules.27,28 Herein, the design, synthesis, and biological evaluation of a series of vinyl sulfone derivatives with heterocycles is described. The in vitro absorption, distribution, metabolism, and 4 ACS Paragon Plus Environment

Page 5 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


excretion/toxicity (ADME/Tox) profiles of synthesized compounds as well as their ability to induce expression of various antioxidant enzyme genes was also evaluated. Furthermore, the selected compound was tested in an MPTP-induced PD mouse model to assess its ability to protect DAergic neurons from cytotoxic damage and attenuate PD-associated behavioral deficits.



Page 6 of 74

RESULTS AND DISCUSSION Chemical Synthesis We used our previously developed lead compound (1), which contained an α,β-unsaturated sulfone moiety, as our structural template and prepared various derivatives by introducing nitrogen heterocycles which are among the most significant structural components of pharmaceuticals.25,26 According to the synthetic methods, the synthesized derivatives were divided into three scaffolds: pyridinyl, morpholinyl, and piperazinyl vinyl sulfones. First, we substituted a pyridine group as a nitrogen heterocycle instead of the benzyl group in the ring B of the lead compound 1. Synthesis of the pyridinyl vinyl sulfones (5a-o, 6a-i, 7a-c, 8a-d, 11a-d, and 12) followed standard protocols (Schemes 1 and 2). Synthesis began with commercially available benzenethiols coupled with (diethoxyphosphoryl)methyl-4-methylbenzenesulfonate (2) in the presence of Cs2CO3 to give substituted sulfides (3 and 9). Oxidation of the substituted sulfides with a 2.2-equivalent of m-chloroperoxybenzoic acid at room temperature provided the desired sulfones (4 and 10). Horner-Emmons olefination reaction with commercially available formylpyridine gave the final compounds 5–8, 11, and 12. Second, we further introduced a morpholinyl group into ring A to improve microsomal stability while increasing solubility through the HCl salt form. The synthetic pathway used to prepare morpholinyl vinyl sulfones (17a-f, 18a-b, and 19a-f) is provided in Scheme 3. First, commercially available hydroxylbenzenethiols

were

coupled

with

(diethoxyphosphoryl)methyl-4-

methylbenzenesulfonate (2) in the presence of Cs2CO3 to give the sulfides (13). Oxidation of the sulfides with a 2.2-equivalent of m-chloroperoxybenzoic acid at room temperature provided the corresponding sulfones (14). The sulfones were coupled with 3-morpholinoprorpyl-4methylbenzene-sulfonate (15) in the presence of K2CO3 to incorporate a morpholine group in the sulfones (16). The final compounds (17–19) were synthesized using Horner-Emmons 6 ACS Paragon Plus Environment

Page 7 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


olefination reaction with commercially available formylpyridine. Preparation of the piperazinyl vinyl sulfones (23a and 23b) followed a standard protocol (Scheme 4). The intermediate (14c) was coupled with ethyl-2-bromoacetate in the presence of K2CO3 to give compound 20. The ester of 20 was converted to its free acid form (21) using stoichiometric amounts of NaOH. Coupling of 21 and 1-methylpiperazine using carbonyldiimidazole gave 22. The final compounds (23) were obtained in salt forms using Horner-Emmons olefination followed by addition of excess 4.0 M HCl.

Evaluation of the Synthesized Compounds for Nrf2 Activation To evaluate the Nrf2-activating ability of all the synthesized compounds, we assessed their ability to release Nrf2 from Keap1 and translocate Nrf2 into the nucleus using our previously reported cell-based assay system.29 The potency of Nrf2 activation is shown in Tables 1 and 2 as half maximal effective concentration (EC50) values. The optimization process was designed to improve potency and ADME/Tox profiles of lead compound 1. First, we introduced opyridine as a heterocycle into ring B of 1 (5a), but this reduced Nrf2 activation by 17-fold (1: EC50 = 0.53 μM; 5a: EC50 = 9.07 μM). However, addition of a Cl group to o-pyridine (5b, 5c, and 5e) enhanced the Nrf2 activation effect relative to 5a; 5e had its Cl group in the ortho position, as in 1, and induced the highest Nrf2 activity (5e: EC50 = 0.142 μM). Substitution with a F instead of Cl group in compound 5e resulted in a 6-fold reduction in Nrf2 activation (5d: EC50 = 0.877 μM). Next, we systematically placed a methoxy group at the 2-, 3-, and 4positions of ring A. In these three series of compounds, the 3-methoxy derivatives (5f-5j) were more Nrf2-active than the corresponding 2- and 4-methoxy derivatives (5a-5e and 5k-5o, respectively; 3-OMe > 2-OMe > 4-OMe). In our previous study, 2-methoxy compounds, including 1, were the most active; however, in the present study, 3-methoxy compounds in 7 ACS Paragon Plus Environment


which a pyridine ring was introduced as the ring B were more Nrf2-active. Next, we examined whether Nrf2 activation was improved by introduction of an o-pyridine versus a m- or p-pyridine. m-Pyridine derivatives (6) were generally less potent than o-pyridine derivatives (5) with respect to Nrf2 activation. On the other hand, while p-pyridine derivatives (7) showed a significant increase in Nrf2 activation, they were also more cytotoxic than both o- and m-pyridine derivatives (Table 3). In addition, conversion of the pyridine in ring B to a pyrimidine (8) had little effect on Nrf2 activation ability. Next, we prepared compounds 11 and 12 to investigate whether introduction of a pyridine group into ring A would enhance the potency of Nrf2 activation. Among this series, electron-withdrawing groups were inserted into the pyridine (11c and 12) and exerted significant Nrf2 activation effects (11c: EC50 = 0.124 μM; 12: EC50 = 0.202 μM). To improve the solubility and other drug-like properties of potent compounds, we synthesized the salt forms of each by adding morpholine or piperazine groups. Based on the abovedescribed results of Nrf2 activation efficacy and cell viability, we prepared a series of compounds in which the o-pyridine group was maintained in ring B and the morpholine or piperazine group was introduced into ring A instead of the methoxy group. Unlike the above results showing the highest Nrf2 activity when a methoxy group was introducded at 3-position of ring A (5, 3-OMe > 2-OMe > 4-OMe), the most potent Nrf2 activating effect was observed when the propylmorpholine group was introduced at the 4-position of ring A (17, 17e > 17c > 17b, Table 2). Among the compound 17, 17e and 17f included electron-withdrawing groups (F or Cl) on the pyridine exerted remarkable Nrf2 activation effects as compared to the other 17 series (17e: EC50 = 0.346 μM; 17f: EC50 = 0.246 μM). We further investigated whether replacement of the o-pyridine group of compound 17 by either m-pyridine (18) or benzene groups (19) affects the efficacy of Nrf2 activation. Compounds 18a and 18b exhibited 8 ACS Paragon Plus Environment

Page 8 of 74

Page 9 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


significantly lower activity than compound 17, and most of the compounds included benzene groups as ring B instead of o-pyridine group (19) showed no activity. Finally, based on the potency of morpholine compounds with 3’-F or 3’-Cl on o-pyridine (17e and 17f), we attempted to introduce a 4-piperazine group instead of 4-morpholine. Interestingly, the 4piperazinyl compound with 3’-Cl on o-pyridine (23b) had 3.7-times higher Nrf2 activation efficacy than that with a 3’-F (23a). Based on the ability of Nrf2 to translocate, compounds 5e, 5h, 5i, 5j, 5o, 6d, 6f, 8b, 11c, 11d, 12, 17e, 17f, and 23b were indentified as the most potent Nrf2 activators (Tables 1 and 2). Most of the synthesized compounds were not cytotoxic at 10 μM except compounds of series 7 containing p-pyridine on the right ring were cytotoxic. Among the compounds containing a 4morpholine or 4-piperazine, those with a 3’-Cl on o-pyridine (17f and 23b) showed lower cell viability than 17e and 23a which contained a 3’-F at 50 μM (Table 3). In our previous study,23 we compared Nrf2 activating efficacy among the synthesized compounds by determinig the ability to induce expression of HO-1, a major Nrf2-dependent gene, using a sandwich enzyme-linked immunosorbent assay (ELISA). To confirm the effects of the present class of molecules on Nrf2 activation, we also performed a ELISA assay for a positive control and the selected 15 compounds. We observed that the Nrf2 activation effect confirmed by ELISA analysis tended to be the same as in the Keap1-Nrf2 functional assay (Supporting Information, Table S1).

In vitro ADME/Tox Profiles of the Synthesized Compounds The drug-like properties of the synthesized compounds were examined through CYP inhibition and microsomal stability tests. The inhibitory effects of the all compounds on CYP enzymes (subtypes 2C19, 2D6, 2C9, 1A2, and 3A4) were tested to assess the possibility of drug-drug interactions. The results are expressed as the percentage of CYP activity remaining after 9 ACS Paragon Plus Environment


treatment with 10 μM of each compound (Table 3). The lead compound (1) from our previous study showed unfavorable safety as it blocked more than 50% of CYP 2C19, 1A2, and 3A4 activity. Introduction of an o-pyridine into ring B of compound 1 (5a-5o) significantly reduced CYP 1A2 and 3A4 inhibition (improved safety), but not 2C19 (Table 3). In addition, most of the small molecular size compounds containing a pyridine ring (5, 6, 7, 8, 11, and 12) also showed significnat inhibition of CYP 2C19, except for 6a, 8a, 8c, and 8d, which do not have the ability to activate Nrf2 (EC50 > 10 μM). However, the CYP 2C19 inhibition issue was addressed by introducing bulky groups, such as morpholine or piperazine, into ring A (17, 18, 19, and 23); these compounds also had good Nrf2 activation effects. The stability of each synthesized compound was determined from the percentage of parent compound remaining after a 30-min incubation with human liver microsomes (Table 3). The previous lead compound (1) showed was metabolically unstable, with only 20% of the parent compound remaining after incubation with human liver microsomes. Although inclusion of a pyridine group (5-8) did not produce a clear trend regarding microsomal stability, the most potent Nrf2-inducing compounds (5h: EC50 = 0.132 μM; 5j: EC50 = 0.098 μM; 6d: EC50 = 0.178 μM) exhibited unfavorable microsomal stabilities (9.6%, 22%, and 18%, respectively). In contrast, most compounds containing morpholine or piperazine groups (17-19 and 23) showed outstanding microsomal stability. Based on these results, compound 17e was selected for its excellent Nrf2-activation potency, safety, and stability for further ADME/Tox studies (Table 4). The plasma stability of 17e in both humans and rats was also excellent, with 98.2% and 90.2% of the parent compound remaining after a 30-min incubation, respectively (Table 4 and Table S2 in Supporting Information). In the hERG channel binding assay, 17e exerted low inhibitory effects against hERG, which produces an important cardiac ion channel subunit protein, 10 ACS Paragon Plus Environment

Page 10 of 74

Page 11 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


indicating that it is unlikely to cause human cardiotoxicity [half maximal inhibitory concentration (IC50): 112.1 μM, Table 4 and Figure S1 in Supporting Information]. To predict the blood-brain barrier permeability of 17e, we performed a parallel artificial membrane permeability assay-blood-brain barrier test using a commercial kit. In this test, permeability (Pe, cm/s) was divided into two classifications: central nervous system-positive (Pe > 10  106)

or -negative (Pe < 10  10-6). The permeability of 17e was found to be favorable for a central

nerve system (CNS) drug (Pe: 15.6  10-6, Table S3 in Supporting Information). Finally, the Ames test was used to test mutagenesis. The fold induction with 17e was lower than baseline in both TA98 and TA100 strains and did not induce reverse mutation (Table 4 and Figure S2 in Suporting Information). In addition, the physicochemical properties of 17e were confirmed to be compatible with beneficial drug-like properties (17e solubility: >30 mg/mL vs 1 solubility: 95% pure. High-resolution MS was performed with electron scatter ionization on a LTQ Orbitrap (Thermo Electron Corp.) instrument.

General Procedure for the Compounds. To a cooled anhydrous tetrahydrofuran (THF) solution (–78 °C) of phosphonate derivateves (4, 10, 16 and 22) was added 2M n-BuLi solution in cyclohexane (1.1 equiv). The reaction 16 ACS Paragon Plus Environment

Page 16 of 74

Page 17 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mixture was stirred at –78 °C (1 h) and then the desired substituted benzaldehyde (1.1 equiv) was added at –78 °C. The reaction mixture was stirred at room temperature (1 h) and then quenched with H2O (~ 50 mL). The reaction mixture was diluted with EtOAc (~ 200mL) and washed with H2O (2  ~ 200 mL) and brine (2  ~ 200 mL). The organic layer was dried with anhydrous Na2SO4 and concentrated in vacuo. The residue was purified by column chromatography on SiO2. In the final step, the production rates of the (E) and (Z)-isomers are changed according to the reaction temperature. At room temperature the (E)-isomer is predominantly formed and at very low temperatures (–78 °C) the (Z)-isomer is also formed. In our previous study,23 we observed that each isomer of vinyl sulfone showed a distinct Rf value difference on TLC, and thus could be separated by silica column chromatography. The major product of vinyl sulfone derivatives synthesized at room temperature is the (E)-isomer, which has a lower Rf value than the (Z)-isomer on TLC. The (E)-isomer showed a different J-value from the (Z)-isomer in the NMR spectrum ((E): J = 14-16 Hz, (Z): J = 8-10 Hz) and was confirmed when it was not overlapped with other aromatic peaks. Among the final compounds, the morpholinyl and the piperazinyl compounds (17–19 and 23), were prepared the salt forms by addition of 4.0M HCl to EtOAc solutions. Synthetic procedures for all intermediates were reported in the supporting information.

(E)-2’-(2-((2-Methoxyphenyl)sulfonyl)vinyl)pyridine (5a) Diethyl (((2-methoxyphenyl) sulfonyl)methyl)phosphonate (0.50 g, 1.55 mmol), 2.0M n-BuLi solution in cyclohexane (0.85 mL, 1.71 mmol) and 2-pyridinecarboxaldehyde (0.19 mL, 1.71 mmol) gave 0.34 g (83%) of 5a as a white solid; Rf = 0.45 (n-hexane/EtOAc 1/1); mp: 123– 124 °C; 1H NMR (400 MHz, CDCl3) δ 8.63 (d, J = 4.2 Hz, ArH), 8.02 (dd, J = 1.5, 7.8 Hz, ArH), 7.73 (td, J = 1.5, 7.6 Hz, ArH), 7.67 (s, (E)-isomeric 2H), 7.42–7.59 (m, ArH), 7.41 (d, 17 ACS Paragon Plus Environment


J = 7.7 Hz, ArH), 7.27–7.31 (m, ArH), 7.10 (t, J = 7.6 Hz, ArH), 7.01 (d, J = 8.4 Hz, ArH), 3.97 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 157.7, 151.6, 150.4, 141.6, 137.1, 135.7, 131.6, 129.9, 128.3, 125.4, 124.9, 120.8, 112.5, 56.4 (OCH3); HPLC purity: 12.1 min, 98.2%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2’-Chloro-6’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (5b) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 6-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.22 g (93%) of 5b as a white powder; Rf = 0.34 (n-hexane/EtOAc 1/1); mp: 104–105 °C; 1H NMR (400 MHz, DMSO-d6) δ 7.98 (t, J = 7.7 Hz, ArH), 7.88 (m, 2ArH), 7.57–7.75 (m, 2ArH, (E)-isomeric 2H), 7.29 (d, J = 8.3 Hz, ArH), 7.20 (t, J = 8.0 Hz, ArH), 3.94 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 157.7, 152.0, 151.0, 141.6, 140.5, 136.7, 132.6, 129.3, 127.7, 126.5, 125.2, 121.3, 114.0, 57.0 (OCH3); HPLC purity: 14.4 min, 95.8%; HRMS (M + H)+ (ESI+) 310.0295 [M + H]+ (calcd for C14H12ClNO3S+ 310.0299).

(E)-5’-Chloro-2’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (5c) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 5-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.16 g (68%) of 5c as a white powder; Rf = 0.40 (n-hexane/EtOAc 2/1); mp: 153–154 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.71 (d, J = 2.4 Hz, ArH), 8.06 (dd, J = 2.4, 8.4 Hz, ArH), 7.87–7.91 (m, 2ArH), 7.68–7.75 (m, ArH, (E)-isomeric 2H), 7.29 (d, J = 8.4 Hz, ArH), 7.19 (t, J = 7.5 Hz, ArH), 3.94 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 157.6, 149.9, 149.4, 141.0, 137.6, 136.7, 133.0, 131.9, 129.1, 127.9, 127.1, 121.2, 113.9, 56.9 18 ACS Paragon Plus Environment

Page 18 of 74

Page 19 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(OCH3); HPLC purity: 14.3 min, 99.0%; . HRMS (M + H)+ (ESI+) 310.0292 [M + H]+ (calcd for C14H12ClO3SH+ 310.0299).

(E)-3’-Fluoro-2’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (5d) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.46mL, 0.85 mmol) and 3-fluoropyridine-2-carboxaldehyde (0.11 g, 0.85 mmol) gave 0.17 g (77%) of 5d as a white powder; Rf = 0.23 (n-hexane/EtOAc 1/1); mp: 119–120 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.54 (d, J = 4.4 Hz, ArH), 7.86–7.91 (m, 2ArH), 7.67–7.76 (m, ArH, (E)-isomeric 2H), 7.59–7.64 (m, ArH), 7.31 (d, J = 8.4 Hz, ArH), 7.20 (t, J = 7.6 Hz, ArH), 3.95 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 158.0 (d, JC-F = 261.4 Hz), 157.1, 146.5 (d, JC-F = 4.8 Hz), 138.6 (d, JC-F = 10.9 Hz), 136.3, 133.5, 132.3 (d, JC-F = 4.3 Hz), 128.7, 127.8 (d, JC-F = 4.8 Hz), 127.0, 124.8 (d, JC-F = 18.9 Hz), 120.8, 113.4, 56.5 (OCH3); HPLC purity: 7.3 min, 99.1%;. HRMS (M + H)+ (ESI+) 294.0590 [M + H]+ (calcd for C14H12FNO3SH+ 294.0595).

(E)-3’-Chloro-2’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (5e) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 3-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.18 g (75%) of 5e as a pale yellow powder; Rf = 0.32 (n-hexane/EtOAc 1/1); mp: 113–114 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.62–8.63 (m, ArH), 8.08 (dd, J = 1.2, 8.2 Hz, ArH), 7.96 (d, , J = 14.8 Hz, (E)-isomeric H), 7.90 (dd, J = 1.5, 7.8 Hz, ArH), 7.74–7.76 (m, ArH), 7.70 (d, J = 14.9 Hz, (E)-isomeric H), 7.52–7.55 (m, ArH), 7.30 (d, J = 8.4 Hz, ArH), 7.20 (t, J = 7.6 Hz, ArH), 3.95 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 19 ACS Paragon Plus Environment


157.6, 149.2, 147.6, 138.9, 136.9, 136.6, 133.9, 132.6, 129.3, 127.5, 127.4, 121.3, 113.9, 57.0 (OCH3); HPLC purity: 10.9 min, 98.5%; HRMS (M + H)+ (ESI+) 310.0294 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-2’-(2-((3-Methoxyphenyl)sulfonyl)vinyl)pyridine (5f) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.30 g, 0.93 mmol), 2.0M n-BuLi solution in cyclohexane (0.51 mL, 1.02 mmol) and 2-pyridinecarboxaldehyde (0.11 mL, 1.02 mmol) gave 0.24 g (93%) of 5f as a brown oil; Rf = 0.26 (n-hexane/EtOAc 2/1); 1H NMR (400 MHz, CDCl3) δ 8.61 (d, J = 4.1 Hz, ArH), 7.72−7.76 (m, ArH), 7.64 (d, J = 14.9 Hz, (E)isomeric H), 7.54 (d, J = 7.7 Hz, ArH), 7.40−7.47 (m, 3ArH, (E)-isomeric H), 7.26−7.31 (m, ArH), 7.13 (m, ArH), 3.86 (s, OCH3);

13C

NMR (100 MHz, CDCl3) δ 160.1, 151.0, 150.3,

141.4, 140.5, 137.1, 131.8, 130.5, 125.5, 125.0, 120.2, 120.1, 112.2, 55.7 (OCH3); HPLC purity: 4.4 min, 97.3%; HRMS (M + H)+ (ESI+) 276.0685 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2’-Chloro-6’-(2-((3-methoxyphenyl)sulfonyl)vinyl)pyridine (5g) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 6-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.22 g (94%) of 5g as a white powder; Rf = 0.31 (n-hexane/EtOAc 2/1); mp: 101–103 °C; 1H NMR (400 MHz, DMSO-d6) δ 7.98 (t, J = 7.7 Hz, ArH), 7.84 (d, J = 7.5 Hz, ArH), 7.73 (d, J = 15.0 Hz, (E)-isomeric H), 7.67 (d, J = 15.1 Hz, (E)-isomeric H), 7.31−7.62(m, 5ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 160.2, 151.9, 151.0, 141.5, 141.5, 139.8, 133.2, 131.4, 126.5, 125.2, 120.6, 120.1, 112.7, 56.2 (OCH3); HPLC purity:


Page 20 of 74

Page 21 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


12.6 min, 99.8%; HRMS (M + H)+ (ESI+) 310.0296 [M + H]+ (calcd for C14H13ClNO3SH+ 310.0299).

(E)-5’-Chloro-2’-(2-((3-methoxyphenyl)sulfonyl)vinyl)pyridine (5h) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.29 g, 0.90 mmol), 2.0M n-BuLi solution in cyclohexane (0.50 mL, 0.99 mmol) and 5-chloropyridine-2-carboxaldehyde (0.14 g, 0.99 mmol) gave 0.22 g (78%) of 5h as a white powder, Rf = 0.40 (n-hexane/EtOAc 2/1); mp: 92–93 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.60 (dd, J = 1.0, 4.4 Hz, ArH), 8.07 (dd, J = 1.2, 8.2 Hz, ArH), 7.93 (d, J = 14.8 Hz, (E)-isomeric H), 7.80 (d, J = 14.8, (E)-isomeric H), 7.50–7.62 (m, 4ArH), 7.33 (m, ArH), 3.87 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 159.7, 148.6, 147.0, 140.7, 138.4, 135.0, 134.0, 132.2, 131.0, 127.0, 120.2, 119.6, 112.1, 55.8 (OCH3); HPLC purity: 15.9 min, 99.5%; HRMS (M + H)+ (ESI+) 310.0290 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-3’-Fluoro-2’-(2-((3-methoxyphenyl)sulfonyl)vinyl)pyridine (5i) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.70 g, 2.17 mmol), 2.0M n-BuLi solution in cyclohexane (1.20 mL, 2.39 mmol) and 3-fluoropyridine-2-carboxaldehyde (0.31 g, 2.39 mmol) gave 0.50 g (43%) of 5i as a white powder; Rf = 0.33 (n-hexane/EtOAc 2/1); mp: 113–114 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.51 (d, J = 4.4 Hz, ArH), 7.88 (t, J = 9.2 Hz, ArH), 7.76 (d, J = 15.2 Hz, (E)-isomeric H), 7.71 (d, J = 14.8 Hz, (E)-isomeric H), 7.49–7.63 (m, 4ArH), 7.31 (m, ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 159.7, 158.1 (d, JC-F = 261.8 Hz), 146.3 (d, JC-F = 4.7 Hz), 140.8, 138.5 (d, JC-F = 10.9 Hz), 132.8 (d, JC-F = 4.2 Hz), 132.7, 131.0, 127.9 (d, JC-F = 4.6 Hz), 124.8 (d, JC-F = 18.8 Hz), 120.2, 119.6, 112.1, 21 ACS Paragon Plus Environment


55.7 (OCH3); HPLC purity: 14.9 min, 99.7%; HRMS (M + H)+ (ESI+) 294.0590 [M + H]+ (calcd for C14H12FNO3SH+ 294.0595).

(E)-3’-Chloro-2’-(2-((3-methoxyphenyl)sulfonyl)vinyl)pyridine (5j) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 3-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.20 g (84%) of 5j as pale yellow powder; Rf = 0.28 (n-hexane/EtOAc 2/1); mp: 89–90 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.59–8.61 (m, ArH), 8.07 (dd, J = 1.2, 8.2 Hz, ArH), 7.93 (d, J = 14.8 Hz, (E)-isomeric H), 7.80 (d, J = 14.8 Hz, (E)-isomeric H), 7.50– 7.62 (m, 4ArH), 7.32–7.34 (m, ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 160.2, 149.1, 147.5, 141.2, 138.9, 135.5, 134.5, 132.7, 131.5, 127.5, 120.8, 120.1, 112.6, 56.3 (OCH3); HPLC purity: 11.3 min, 99.5%; HRMS (M + H)+ (ESI+) 310.0292 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-2’-(2-((4-Methoxyphenyl)sulfonyl)vinyl)pyridine (5k) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.55 mmol), 2.0M n-BuLi solution in cyclohexane (0.85 mL, 1.71 mmol) and 2-pyridinecarboxaldehyde (0.19 mL, 1.71 mmol) gave 0.36 g (85%) of 5k as a pale yellow solid; Rf = 0.45 (n-hexane/EtOAc 1/2); mp: 97–98 °C; 1H NMR (300 MHz, DMSO-d6) δ 8.61–8.62 (m, ArH), 7.86–7.92 (m, 3ArH), 7.78– 7.81 (m, ArH), 7.65 (d, J = 15.1 Hz, (E)-isomeric H), 7.60 (d, J = 15.1 Hz, (E)-isomeric H), 7.42–7.46 (m, ArH), 7.16–7.21 (m, 2ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 163.7, 151.2, 150.3, 139.5, 137.0, 132.4, 131.7, 130.1, 125.3, 124.9, 114.6, 55.7 (OCH3);


Page 22 of 74

Page 23 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


HPLC purity: 12.6 min, 99.0%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2’-Chloro-6’-(2-((4-methoxyphenyl)sulfonyl)vinyl)pyridine (5l) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 6-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.16 g (66%) of 5l as a white powder; Rf = 0.28 (n-hexane/EtOAc 2/1); mp: 118–120 °C; 1H NMR (400 MHz, DMSO-d6) δ 7.96 (t, J = 7.8 Hz, ArH), 7.89 (d, J = 8.9 Hz, 2ArH), 7.81 (d, J = 7.4 Hz, ArH), 7.64 (d, J = 15.1 Hz, (E)-isomeric H), 7.56−7.60 (m, ArH, (E)-isomeric H), 7.18 (d, J = 8.9 Hz, 2ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 164.0, 152.0, 151.0, 141.5, 138.6, 134.0, 131.6, 130.4, 126.3, 125.0, 115.5, 56.3 (OCH3); HPLC purity: 13.3 min, 98.0%; HRMS (M + H)+ (ESI+) 310.0296 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-5’-Chloro-2’-(2-((4-methoxyphenyl)sulfonyl)vinyl)pyridine (5m) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 5-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.14 g (58%) of 5m as a white solid; Rf = 0.40 (n-hexane/EtOAc 2/1); mp: 138.0–139.7 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.67 (d, J = 2.4 Hz, ArH), 8.05 (dd, J = 8.9 Hz, ArH), 7.85−7.89 (m, 3ArH), 7.67 (d, J = 15.1 Hz, (E)-isomeric H), 7.62 (d, J = 15.1 Hz, (E)-isomeric H), 7.18 (d, J = 8.9 Hz, ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 163.9, 149.9, 149.2, 139.1, 137.6, 133.3, 132.9, 131.7, 130.3, 126.8, 115.4, 56.3 (OCH3); HPLC purity: 11.7 min, 99.0%;. HRMS (M + H)+ (ESI+) 310.0293 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299). 23 ACS Paragon Plus Environment


(E)-3’-Fluoro-2’-(2-((4-methoxyphenyl)sulfonyl)vinyl)pyridine (5n) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.75 g, 2.33 mmol), 2.0M n-BuLi solution in cyclohexane (1.28 mL, 2.56 mmol) and 3-fluoropyridine-2-carboxaldehyde (0.32g, 2.56 mmol) gave 0.46 g (68%) of 5n as a pale yellow powder; Rf = 0.28 (n-hexane/EtOAc 1/1); mp: 84–85 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.50 (d, J = 4.4 Hz, ArH), 7.85−7.92 (m, 3ArH), 7.66 (s, (E)-isomeric 2H), 7.57−7.61 (m, ArH), 7.17−7.26 (m, 2ArH), 3.86 (s, OCH3); 13C

NMR (100 MHz, CDCl3) δ 163.8, 158.3 (d, JC-F = 263.8 Hz), 145.9 (d, JC-F = 5.0 Hz), 139.8

(d, JC-F = 11.2 Hz), 133.9 (d, JC-F = 4.4 Hz), 132.0, 131.5, 130.2, 126.5 (d, JC-F = 4.2 Hz), 124.1 (d, JC-F = 19.0 Hz), 114.7, 55.7 (OCH3); HPLC purity: 8.5 min, 98.9%; HRMS (M + H)+ (ESI+) 294.0588 [M + H]+ (calcd for C14H12FNO3SH+ 294.0595).

(E)-3’-Chloro-2’-(2-((4-methoxyphenyl)sulfonyl)vinyl)pyridine (5o) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.42 mL, 0.85 mmol) and 3-chloropyridine-2-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.14 g (58%) of 5o as a white powder; Rf = 0.24 (n-hexane/EtOAc 2/1); mp: 134–135 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.59 (d, J = 3.6 Hz, ArH), 8.06 (dd, J = 1.1, 8.2 Hz, ArH) 7.92 (d, J = 8.9 Hz, 2ArH), 7.87 (d, J = 14.8 Hz, (E)-isomeric H), 7.70 (d, J = 14.8 Hz, (E)-isomeric H), 7.50−7.53 (m, ArH), 7.18 (d, J = 8.9 Hz, 2ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d

6) δ 164.0, 149.0, 147.6, 138.9, 135.3, 134.3, 132.5, 131.3, 130.5,

127.4, 115.5, 56.4 (OCH3); HPLC purity: 12.2 min, 98.0%; HRMS (M + H)+ (ESI+) 310.0294 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).


Page 24 of 74

Page 25 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(E)-3’-(2-((2-Methoxyphenyl)sulfonyl)vinyl)pyridine (6a) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 3-pyridinecarboxaldehyde (0.09 g, 0.85 mmol) gave 0.22 g (97%) of 6a as a white solid; Rf = 0.25 (n-hexane/EtOAc 1/3); mp: 128– 129 °C; 1H NMR (400 MHz, CDCl3) δ 8.74 (d, J = 2.1 Hz, ArH), 8.63 (dd, J = 1.6, 4.8 Hz, ArH), 8.03 (dd, J = 4.7, 7.8 Hz, ArH), 7.81 (dd, J = 1.9, 7.9 Hz, ArH), 7.69 (d, J = 15.6 Hz, (E)-isomeric H), 7.59 (m, ArH), 7.35 (m, ArH), 7.23 (d, J = 15.6 Hz, (E)-isomeric H), 7.12 (t, J = 8.0 Hz, ArH), 7.03 (d, J = 8.3 Hz, ArH), 3.98 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 157.5, 151.7, 150.0, 139.7, 135.8, 134.9, 129.7, 129.4, 128.9, 128.3, 123.9, 121.0, 112.6, 56.5; HPLC purity: 4.4 min, 98.0%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2’-Methoxy-3’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (6b) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 2-methoxypyridine-3-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.17 g (72%) of 6b as a white powder; Rf = 0.26 (n-hexane/EtOAc 1/2); mp: 123–125 °C; 1H NMR (400 MHz, CDCl3) δ 8.02−8.13 (m, 2ArH), 7.74 (d, J = 15.5 Hz, (E)-isomeric H), 7.51−7.69 (m, ArH), 7.56 (td, J = 1.6, 7.6 Hz, ArH), 7.41 (d, J = 15.5 Hz, (E)-isomeric H), 7.10 (t, J = 7.6 Hz, ArH), 7.01 (d, J = 8.3 Hz, ArH), 6.74−6.95 (m, ArH), 4.03 (s, OCH3), 3.97 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 162.2, 157.5, 149.0, 139.5, 138.1, 135.5, 129.7, 129.6, 128.8, 120.8, 117.2, 116.6, 112.5, 56.3, 53.9; HPLC purity: 8.2 min, 97.1%; HRMS (M + H)+ (ESI+) 306.0786 [M + H]+ (calcd for C15H15NO4SH+ 306.0795).



(E)-2’-Chloro-3’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (6c) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 2-chloropyridine-3-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.16 g (68%) of 6c as a white powder; Rf = 0.25 (n-hexane/EtOAc 1/1); mp: 154–155 °C; 1H NMR (400 MHz, CDCl3) δ 8.40 (d, J = 1.2 Hz, ArH), 7.98−8.02 (m, ArH, (E)-isomeric H), 7.87 (dd, J = 1.7, 7.7 Hz, ArH), 7.59 (td, J = 1.6, 8.4 Hz, ArH), 7.30 (m, ArH), 7.08−7.16 (m, ArH, (E)-isomeric H), 7.02 (d, J = 8.4 Hz, ArH), 3.97 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 157.6, 151.5, 151.2, 138.0, 136.9, 136.0, 131.9, 130.0, 128.3, 127.7, 123.0, 121.0, 112.6, 56.4; HPLC purity: 5.4 min, 99.8%; HRMS (M + H)+ (ESI+) 310.0292 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-2’,6’-Dichloro-3’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyridine (6d) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 2,6-dichloropyridine-3-carboxaldehyde (0.16 g, 0.83 mmol) gave 0.25 g (94%) of 6d as a white solid; Rf = 0.45 (n-hexane/EtOAc 1/1); mp: 136–138 °C; 1H NMR (400 MHz, CDCl3) δ 8.26 (d, J = 5.3 Hz, ArH), 8.05 (dd, J = 1.5, 7.9 Hz, ArH), 7.82 (d, J = 15.8 Hz, (E)-isomeric H), 7.62 (m, ArH), 7.47 (d, J = 15.8 Hz, (E)isomeric H), 7.37 (d, J = 5.3 Hz, ArH), 7.13 (t, J = 7.6 Hz, ArH), 7.04 (d, J = 8.4 Hz, ArH), 3.98 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 157.6, 151.8, 149.5, 145.6, 136.8, 136.1, 134.3, 130.0, 127.6, 127.4, 124.7, 121.0, 112.5, 56.4; HPLC purity: 4.6 min, 99.0%; HRMS (M + H)+ (ESI+) 343.9906 [M + H]+ (calcd for C14H11Cl2NO3SH+ 343.9909).

(E)-3’-(2-((3-Methoxyphenyl)sulfonyl)vinyl)pyridine (6e) 26 ACS Paragon Plus Environment

Page 26 of 74

Page 27 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.55 mmol), 2.0M n-BuLi solution in cyclohexane (0.85 mL, 1.71 mmol) and 3-pyridinecarboxaldehyde (0.18 g, 1.71 mmol) gave 0.42 g (85%) of 6e as a pale yellow oil; Rf = 0.45 (n-hexane/EtOAc 1/3); mp: 52– 53 °C; 1H NMR (300 MHz, DMSO-d6) δ 8.91 (d, J = 1.8 Hz, ArH), 8.61 (d, J = 4.7 Hz, ArH), 8.18 (d, J = 8.1 Hz, ArH), 7.81 (d, J = 15.4 Hz, (E)-isomeric H), 7.71 (d, J = 15.4 Hz, (E)isomeric H), 7.59 (m, ArH), 7.45−7.51 (m, 2ArH), 7.41 (m, ArH), 7.31 (m, ArH), 3.85 (s, CH3); 13C NMR (100 MHz, CDCl3) δ 160.2, 151.8, 150.0, 141.3, 138.7, 134.8, 130.6, 129.6, 128.3, 123.9, 120.2, 120.0, 112.2, 55.8; HPLC purity: 11.2 min, 96.4%; HRMS (M + H)+ (ESI+) 276.0685 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2’-Chloro-3’-(2-((3-methoxyphenyl)sulfonyl)vinyl)pyridine (6f) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 2-chloropyridine-3-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.19 g (78%) of 6f as a pale yellow powder; Rf = 0.34 (n-hexane/EtOAc 1/1); mp: 101–103 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.49 (dd, J = 1.7, 4.7 Hz, ArH), 8.35 (dd, J = 1.7, 8.0 Hz, ArH), 7.88 (d, J = 15.4 Hz, (E)-isomeric H), 7.78 (d, J = 15.4 Hz, (E)isomeric H), 7.61 (t, J = 7.9 Hz, ArH), 7.51−7.54 (m, 2ArH), 7.41−7.44 (m, ArH), 7.33 (dd, J = 1.9, 8.0 Hz, ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 160.2, 152.2, 150.7, 141.4, 138.4, 136.2, 133.3, 131.6, 127.5, 124.2, 120.5, 119.9, 112.5, 56.3; HPLC purity: 5.0 min, 98.8%; HRMS (M + H)+ (ESI+) 310.0294 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-3’-(2-((4-Methoxyphenyl)sulfonyl)vinyl)pyridine (6g)



Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.30 g, 0.93 mmol), 2.0M n-BuLi solution in cyclohexane (0.51 mL, 1.02 mmol) and 3-pyridinecarboxaldehyde (0.11 g, 1.02 mmol) gave 0.23 g (89%) of 6g as a white powder; Rf = 0.26 (n-hexane/EtOAc 1/3); mp: 111– 112 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.90 (d, J = 1.7 Hz, ArH), 8.61 (dd, J = 1.4, 4.7 Hz, ArH), 8.16−8.18 (m, ArH), 7.85 (d, J = 8.9 Hz, 2ArH), 7.74 (d, J = 15.5 Hz, (E)-isomeric H), 7.65 (d, J = 15.5 Hz, (E)-isomeric H), 7.44−7.47 (m, ArH), 7.19 (d, J = 8.9 Hz, 2ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 163.8, 151.9, 150.7, 138.2, 135.7, 132.2, 131.2, 130.1, 129.0, 124.4, 115.4, 56.3; HPLC purity: 4.6 min, 99.7%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2’-Chloro-3’-(2-((4-methoxyphenyl)sulfonyl)vinyl)pyridine (6h) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 2-chloropyridine-3-carboxaldehyde (0.12 g, 0.85 mmol) gave 0.18 g (77%) of 6h as a white solid; Rf = 0.28 (n-hexane/EtOAc 1/1); mp: 146–148 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.46 (dd, J = 1.3, 4.4 Hz, ArH), 8.33 (m, ArH), 7.87 (d, J = 8.8 Hz, 2ArH), 7.81 (d, J = 15.4 Hz, (E)-isomeric H), 7.73 (d, J = 15.4 Hz, (E)isomeric H), 7.49–7.52 (m, ArH), 7.19 (d, J = 8.8 Hz, 2ArH), 3.87 (s, OCH3); 13C NMR (100 MHz, DMSO-d6) δ 164.0, 152.0, 150.7, 138.3, 134.9, 134.1, 131.5, 130.3, 127.6, 124.2, 115.5, 56.3; HPLC purity: 5.4 min, 99.2%; HRMS (M + H)+ (ESI+) 310.0293 [M + H]+ (calcd for C14H12ClNO3SH+ 310.0299).

(E)-2’-Chloro-5’-(2-((4-methoxyphenyl)sulfonyl)vinyl)pyridine (6i)


Page 28 of 74

Page 29 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.55 mmol), 2.0M n-BuLi solution in cyclohexane (0.85 mL, 1.71 mmol) and 2-fluoropyridine-5-carboxaldehyde (0.21 g, 1.71 mmol) gave 0.32 g (71%) of 6i as a white solid; Rf = 0.24 (n-hexane/EtOAc 3/1); mp: 124–125 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.62 (d, J = 1.8 Hz, ArH), 8.40 (td, J = 2.3, 8.3 Hz, ArH), 7.84 (d, J = 8.8 Hz, 2ArH), 7.71 (d, J = 15.6 Hz, (E)-isomeric H), 7.67 (d, J = 15.6 Hz, (E)-isomeric H), 7.28–7.30 (m, ArH), 7.19 (d, J = 8.8 Hz, 2ArH), 3.86 (s, OCH3);

13C

NMR (100 MHz, CDCl3) δ 164.5 (d, JC-F = 243.5 Hz), 163.9, 148.5 (d, JC-F = 15.6 Hz), 139.7 (d, JC-F = 8.7 Hz), 136.1, 131.4, 130.1, 130.0, 126.7 (d, JC-F = 4.8 Hz), 114.8, 110.3 (d, JC-F = 37.6 Hz), 55.8; HPLC purity: 4.9 min, 99.1%; HRMS (M + H)+ (ESI+) 294.0593 [M + H]+ (calcd for C14H12FNO3SH+ 294.0595).

(E)-4’-(2-((2-Methoxyphenyl)sulfonyl)vinyl)pyridine (7a) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 4-pyridinecarboxaldehyde (0.09 g, 0.85 mmol) gave 0.23 g (99%) of 7a as a pale grey solid; Rf = 0.20 (n-hexane/EtOAc 1/3); mp: 107– 108 °C; 1H NMR (400 MHz, CDCl3) δ 8.67 (d, J = 6.0 Hz, 2ArH), 8.02 (dd, J = 1.5, 7.8 Hz, ArH), 7.58–7.64 (m, 2ArH, (E)-isomeric H), 7.34 (d, J = 6.0 Hz, 2ArH), 7.31 (d, J = 15.6 Hz, (E)-isomeric H), 7.13 (t, J = 7.7 Hz, ArH), 7.03 (d, J = 8.3 Hz, ArH), 3.98 (s, OCH3);

13C

NMR (100 MHz, CDCl3) δ 157.6, 150.9, 140.3, 140.2, 136.0, 132.0, 129.9, 127.9, 122.2, 121.0, 112.6, 56.5; HPLC purity: 4.8 min, 98.8%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-4’-(2-((3-Methoxyphenyl)sulfonyl)vinyl)pyridine (7b) 29 ACS Paragon Plus Environment


Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 4-pyridinecarboxaldehyde (0.09 g, 0.85 mmol) gave 0.12 g (56%) of 7b as a black oil; Rf = 0.31 (n-hexane/EtOAc 1/1); 1H NMR (300 MHz, DMSO-d6) δ 8.66 (dd, J = 1.6, 4.5 Hz, ArH), 7.94 (d, J = 15.5 Hz, (E)-isomeric H), 7.58–7.71 (m, 4ArH, (E)-isomeric H), 7.49–7.53 (m, ArH), 7.41–7.43 (m, ArH), 7.30–7.34 (m, ArH), 3.86 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 160.2, 150.8, 140.9, 139.6, 139.3, 132.2, 130.7, 122.1, 120.3, 120.1, 112.4, 55.8; HPLC purity: 4.6 min, 99.0%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-4’-(2-((4-Methoxyphenyl)sulfonyl)vinyl)-3-fluorobenzene (7c) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.25 g, 0.77 mmol), 2.0M n-BuLi solution in cyclohexane (0.43 mL, 0.85 mmol) and 4-pyridinecarboxaldehyde (0.09 g, 0.85 mmol) gave 0.12 g (56%) of 7c as a orange solid; Rf = 0.32 (n-hexane/EtOAc 1/3); mp: 97– 99 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.65 (d, J = 4.8 Hz, 2ArH), 7.86–7.90 (m, 2ArH, (E)isomeric H), 7.70 (d, J = 4.9 Hz, 2ArH), 7.60 (d, J = 15.4 Hz, (E)-isomeric H), 7.20 (d, J = 8.4 Hz, 2ArH), 3.87 (s, OCH3);

13C

NMR (100 MHz, DMSO-d6) δ 163.9, 150.9, 140.2, 138.7,

133.9, 131.7, 130.3, 123.0, 115.5, 56.3; HPLC purity: 4.6 min, 98.7%; HRMS (M + H)+ (ESI+) 276.0687 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-5’-(2-((2-Methoxyphenyl)sulfonyl)vinyl)pyrimidine (8a) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.70 g, 2.17 mmol), 2.0M n-BuLi solution in cyclohexane (1.20 mL, 2.39 mmol) and pyrimidine-5-carboxaldehyde (0.26 g, 2.39 mmol) gave 0.43 g (72%) of 8a as a white powder; Rf = 0.24 (n-hexane/EtOAc 1/2); mp: 170– 30 ACS Paragon Plus Environment

Page 30 of 74

Page 31 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


171 °C; 1H NMR (400 MHz, CDCl3) δ 9.22 (s, ArH), 8.87 (s, 2ArH), 8.03 (dd, J = 1.6, 7.8 Hz, ArH), 7.65 (d, J = 15.7 Hz, (E)-isomeric H), 7.60–7.64 (m, ArH), 7.34 (d, J = 15.7 Hz, (E)isomeric H), 7.14 (t, J = 7.8 Hz, ArH), 7.05 (d, J = 8.3 Hz, ArH), 3.99 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 159.7, 157.4, 155.9, 136.0, 135.7, 131.3, 129.8, 127.6, 127.1, 121.0, 112.5, 56.4; HPLC purity: 4.3 min, 99.3%; HRMS (M + H)+ (ESI+) 277.0642 [M + H]+ (calcd for C13H12N2O3SH+ 277.0641).

(E)-4’,6’-Dichloro-5’-(2-((2-methoxyphenyl)sulfonyl)vinyl)pyrimidine (8b) Diethyl (((2-methoxyphenyl)sulfonyl)methyl)phosphonate (0.35 g, 1.03 mmol), 2.0M n-BuLi solution in cyclohexane (0.57 mL, 1.13 mmol) and 4,6-dichloropyrimidine-5-carboxaldehyde (0.20 g, 1.13 mmol) gave 0.21 g (68%) of 8b as a white powder; Rf = 0.34 (n-hexane/EtOAc 1/2); mp: 150–151 °C; 1H NMR (400 MHz, CDCl3) δ 8.73 (s, ArH), 8.04 (dd, J = 1.6, 7.8 Hz, ArH), 7.78 (d, J = 15.8 Hz, (E)-isomeric H), 7.61–7.65 (m, ArH), 7.55 (d, J = 15.8 Hz, (E)isomeric H), 7.15 (t, J = 7.6 Hz, ArH), 7.05 (d, J = 8.3 Hz, ArH), 3.98 (s,OCH3); 13C NMR (100 MHz, CDCl3) δ 161.2, 157.6, 157.2, 138.1, 136.3, 132.1, 130.1, 127.2, 126.1, 121.1, 112.5, 56.5 (OCH3); HPLC purity: 5.0 min, 98.3%; HRMS (M + H)+ (ESI+) 344.9867 [M + H]+ (calcd for C13H10Cl2N2O3SH+ 344.9862).

(E)-5’-(2-((3-Methoxyphenyl)sulfonyl)vinyl)pyrimidine (8c) Diethyl (((3-methoxyphenyl)sulfonyl)methyl)phosphonate (0.30 g, 0.93 mmol), 2.0M n-BuLi solution in cyclohexane (0.51 mL, 1.02 mmol) and pyrimidine-5-carboxaldehyde (0.11 g, 1.02 mmol) gave 0.10 g (37%) of 8c as a white powder; Rf = 0.46 (n-hexane/EtOAc 1/2); mp: 123– 125 °C; 1H NMR (400 MHz, CDCl3) δ 9.21 (s, ArH), 8.89 (s, 2ArH), 7.88 (d, J = 8.8 Hz, 31 ACS Paragon Plus Environment


2ArH), 7.58 (d, J = 15.6 Hz, (E)-isomeric H), 7.02–7.06 (m, 2ArH, (E)-isomeric H), 3.89 (OCH3); 13C NMR (100 MHz, CDCl3) δ 160.3, 159.9, 156.0, 140.7, 134.9, 131.6, 130.7, 126.7, 120.4, 120.1, 112.4, 55.8; HPLC purity: 4.5 min, 97.2%; HRMS (M + H)+ (ESI+) 277.0640 [M + H]+ (calcd for C13H12N2O3SH+ 277.0641).

(E)-5’-(2-((4-Methoxyphenyl)sulfonyl)vinyl)pyrimidine (8d) Diethyl (((4-methoxyphenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.55 mmol), 2.0M n-BuLi solution in cyclohexane (0.85 mL, 1.71 mmol) and pyrimidine-5-carboxaldehyde (0.18 mL, 1.71 mmol) gave 0.37 g (86%) of 8d as a white powder; Rf = 0.36 (n-hexane/EtOAc 1/2); mp: 194–195 °C; 1H NMR (400 MHz, CDCl3) δ 9.21 (s, ArH), 8.89 (s, 2ArH), 7.88 (d, J = 8.8 Hz, 2ArH), 7.58 (d, J = 15.6 Hz, (E)-isomeric H), 7.04 (m, 2ArH, (E)-isomeric H), 3.89 (OCH3); 13C

NMR (100 MHz, CDCl3) δ 164.1, 159.7, 155.9, 133.8, 132.3, 130.9, 130.3, 126.8, 114.9,

55.8; HPLC purity: 4.3 min, 99.3%; HRMS (M + H)+ (ESI+) 277.0640 [M + H]+ (calcd for C13H12N2O3SH+ 277.0641).

(E)-2-((2’-Methoxystyryl)sulfonyl)pyridine (11a) Diethyl ((pyridine-2-ylsulfonyl)methyl)phosphonate (0.30 g, 1.02 mmol), 2.0M n-BuLi solution in cyclohexane (0.56 mL, 1.12 mmol) and 2-methoxybenzaldehyde (0.15 g, 1.12 mmol) gave 0.22 g (75%) of 11a as a white powder; Rf = 0.40 (n-hexane/EtOAc 1/1); mp: 74–75 °C; 1H

NMR (400 MHz, DMSO-d6) δ 8.78 (d, J = 4.4 Hz, ArH), 7.12–8.19 (m, 2ArH), 7.90 (d, J

= 15.6 Hz, (E)-isomeric H), 7.72–7.78 (m, 2ArH), 7.54 (d, J = 15.6 Hz, (E)-isomeric H), 7.48 (m, ArH), 7.13 (d, J = 8.4 Hz, ArH), 7.01 (t, J = 7.5 Hz, ArH), 3.90 (s, OCH3); 13C NMR (100 MHz, CDCl3) δ 159.0, 158.9, 150.4, 141.1, 138.1, 132.7, 131.1, 126.9, 125.3, 121.9, 121.3, 32 ACS Paragon Plus Environment

Page 32 of 74

Page 33 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


120.8, 111.3, 55.5; HPLC purity: 4.6 min, 99.8%; HRMS (M + H)+ (ESI+) 276.0685 [M + H]+ (calcd for C14H13NO3SH+ 276.0689).

(E)-2-((2’-Fluorostyryl)sulfonyl)pyridine (11b) Diethyl ((pyridine-2-ylsulfonyl)methyl)phosphonate (0.30 g, 1.02 mmol), 2.0M n-BuLi solution in cyclohexane (0.56 mL, 1.12 mmol) and 2-fluorobenzaldehyde (0.14 g, 1.12 mmol) gave 0.25 g (92%) of 11b as a white powder; Rf = 0.30 (n-hexane/EtOAc 3/2); mp: 95–96 °C; 1H

NMR (400 MHz, DMSO-d6) δ 8.80 (d, J = 4.5 Hz, ArH), 8.15–8.21 (m, 2ArH), 7.95 (t, J

= 7.4 Hz, ArH), 7.78 (d, J = 15.5 Hz, (E)-isomeric H), 7.74–7.78 (m, ArH), 7.69 (d, J = 15.6 Hz, (E)-isomeric H), 7.56 (m, ArH), 7.28–7.38 (m, 2ArH);

13C

NMR (100 MHz, CDCl3) δ

161.6 (d, JC-F = 254.4 Hz), 158.4, 150.4, 138.3, 138.1 (d, JC-F = 2.0 Hz), 133.0 (d, JC-F = 8.9 Hz), 130.5 (d, JC-F = 2.5 Hz), 127.5 (d, JC-F = 8.6 Hz), 127.2, 124.7 (d, JC-F = 3.6 Hz), 120.0, 120.6 (d, JC-F = 11.4 Hz), 116.4 (d, JC-F = 21.4 Hz); HPLC purity: 11.2 min, 96.8%; HRMS (M + H)+ (ESI+) 264.0486 [M + H]+ (calcd for C13H10FNO2SH+ 264.0489).

(E)-2-((2’-Fluorostyryl)sulfonyl)-3-(trifluoromethyl)pyridine (11c) Diethyl (((3-(trifluoromethyl)pyridin-2-yl)sulfonyl)methyl)phosphonate (0.40 g, 1.11 mmol), 2.0M n-BuLi solution in cyclohexane (0.61 mL, 1.22 mmol) and 2-fluorobenzaldehyde (0.15 g, 1.12 mmol) gave 0.28 g (70%) of 11c as white powder; Rf = 0.39 (n-hexane/EtOAc 1/1); mp: 130–131 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.99 (d, J = 4.2 Hz, ArH), 8.57 (d, J = 7.0 Hz, ArH), 7.96–8.03 (m, 2ArH), 7.90 (d, J = 15.7 Hz, (E)-isomeric H), 7.74 (d, J = 15.7 Hz, (E)isomeric H), 7.56–7.62 (m, ArH), 7.32–7.40 (m, 2ArH); 13C NMR (100 MHz, DMSO-d6) δ 33 ACS Paragon Plus Environment


161.2 (d, JC-F = 251.3 Hz), 156.8, 152.7, 138.6 (q, JC-F = 5.4, 10.9 Hz), 136.1 (d, JC-F = 4.0 Hz), 134.2 (d, JC-F = 9.1 Hz), 130.6 (d, JC-F = 1.6 Hz), 129.2 (d, JC-F = 5.8 Hz), 128.4, 125.7 (d, JC-F = 3.4 Hz), 123.2 (q, JC-F = 35.2 Hz), 122.6 (q, JC-F = 272.1 Hz), 120.4 (q, JC-F = 43.6 Hz), 116.7 (d, JC-F = 21.3 Hz); HPLC purity: 16.4 min, 98.1%; HRMS (M + H)+ (ESI+) 332.0359 [M + H]+ (calcd for C14H9F4NO2SH+ 332.0363).

(E)-4-(2’-Fluorostyryl)sulfonyl)pyridine (11d) Diethyl ((pyridine-4-ylsulfonyl)methyl)phosphonate (0.30 g, 0.83 mmol), 2.0M n-BuLi solution in cyclohexane (0.46 mL, 0.91 mmol) and 2-fluorobenzaldehyde (0.12 g, 0.91 mmol) gave 0.23 g (71%) of 11d as a white powder; Rf = 0.35 (n-hexane/EtOAc 1/1); mp: 68–69 °C; 1H

NMR (400 MHz, DMSO-d6) δ 8.93 (d, J = 6.0 Hz, 2ArH), 7.88–7.93 (m, 3ArH), 7.80 (d, J

= 15.5 Hz, (E)-isomeric H), 7.73 (d, J = 15.5 Hz, (E)-isomeric H), 7.55–7.60 (m, ArH), 7.29– 7.38 (m, 2ArH); 13C NMR (100 MHz, CDCl3) δ 161.7 (d, JC-F = 254.6 Hz), 151.3, 148.7, 138.2, 133.4 (d, JC-F = 8.9 Hz), 130.7 (d, JC-F = 2.2 Hz), 128.6 (d, JC-F = 9.0 Hz), 124.8 (d, J = 3.5 Hz), 120.7, 120.1 (d, JC-F = 11.3 Hz), 116.5 (d, JC-F = 21.6 Hz); HPLC purity: 9.8 min, 97.5%; HRMS (M + H)+ (ESI+) 264.0484 [M + H]+ (calcd for C13H10FNO2SH+ 264.0489).

(E)-3’-Fluoro-2-(2-((3-trifluoromethyl)pyridin-2-yl)sulfonyl)vinyl)pyridine (12) Diethyl (((3-(trifluoromethyl)pyridin-2-yl)sulfonyl)methyl)phosphonate (0.30 g, 0.83 mmol), 2.0M n-BuLi solution in cyclohexane (0.46 mL, 0.91 mmol) and 3-fluoropyridine-2carboxaldehyde (0.11 g, 0.91 mmol) gave 0.26 g (75%) of 12 as a white powder; Rf = 0.40 (nhexane/EtOAc 1/1); mp: 126–127 °C; 1H NMR (400 MHz, DMSO-d6) δ 8.99 (d, J = 4.5 Hz, 34 ACS Paragon Plus Environment

Page 34 of 74

Page 35 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ArH), 8.58–8.60 (m, 2ArH), 7.90–8.03 (m, 2ArH, (E)-isomeric H), 7.79 (d, J = 15.2 Hz, (E)isomeric H), 7.64–7.68 (m, ArH); 13C NMR (75 MHz, DMSO-d6) δ 160.8 (d, JC-F = 261.9 Hz), 156.0, 152.3, 146.5 (d, JC-F = 4.7 Hz), 138.3, 138.2 (d, JC-F = 21.9 Hz), 134.1, 131.3 (d, JC-F = 4.1 Hz), 128.2 (d, JC-F = 4.7 Hz), 128.0, 127.5, 124.9 (d, JC-F = 18.8 Hz), 122.7 (d, JC-F = 35.2 Hz); HPLC purity: 13.3 min, 98.0%; HRMS (M + H)+ (ESI+) 333.0310 [M + H]+ (calcd for C13H8F4N2O2SH+ 333.0315).

(E)-4-(3-(4-((2-(Pyridin-2’-yl)vinyl)sulfonyl)phenoxy)propyl)morpholine hydrochloride (17a) Diethyl (((2-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (1.10 g, 2.66 mmol), 2.0M n-BuLi solution in cyclohexane (1.46 mL, 2.93 mmol), 2-pyridinecarboxaldehyde (0.31 g, 2.93 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.91 g (87%) of 17a as a white powder; Rf = 0.29 (CH2Cl2/MeOH 19/1); mp: 227–229 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.19 (s, HCl), 8.67 (d, J = 4.6 Hz, ArH), 7.89–7.98 (m, 3ArH), 7.70–7.74 (m, ArH, (E)-isomeric 2H), 7.49 (t, J = 5.0 Hz, ArH), 7.28 (d, J = 8.4 Hz, ArH), 7.21 (t, J = 7.6 Hz, ArH), 4.27 (t, J = 5.8 Hz, 2ArH), 3.95–4.05 (m, 2CH2), 3.80–3.86 (m, CH2), 3.41 (d, J = 12.2 Hz, CH2), 3.28 (s, CH2), 2.23–2.27 (m, CH2); 13C NMR (100 MHz, DMSO-d6) δ 157.0, 151.5, 150.3, 141.3, 136.9, 135.4, 131.8, 129.7, 128.1, 125.3, 124.8, 120.5, 113.1, 67.2, 67.0, 55.2, 53.7, 26.2; HPLC purity: 4.3 min, 98.2%; HRMS (M + H)+ (ESI+) 389.1523 [M + H]+ (calcd for C20H24N2O4SH+ 389.1530).

(E)-4-(3-(2-((2-(3’-Fluoropyridin-2’-yl)vinyl)sulfonyl)phenoxy)propyl) 35 ACS Paragon Plus Environment

morpholine


hydro chloride (17b) Diethyl (((2-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.70 g, 1.60 mmol), 2.0M n-BuLi solution in cyclohexane (0.88 mL, 1.76 mmol), 3-fluoropyridine-2carboxaldehyde (0.22 g, 1.76 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.64 g (98%) of 17b as a white powder; Rf = 0.31 (EtOAc/MeOH 9/1); mp: 86–88 °C; 1H NMR (400 MHz, CDCl3) δ 12.94 (s, HCl), 8.37 (d, J = 4.0 Hz, ArH), 7.91 (d, J = 7.7 Hz, ArH), 7.75 (d, J = 15.2 Hz, (E)-isomeric H), 7.64 (d, J = 15.2 Hz, (E)-isomeric H), 7.50 (t, J = 7.4 Hz, ArH), 7.43 (t, J = 9.2 Hz, ArH), 7.30–7.34 (m, ArH), 7.05 (t, J = 7.6 Hz, ArH), 6.90 (d, J = 8.3 Hz, ArH), 4.20–4.23 (m, 2CH2), 3.90 (d, J = 12.5 Hz, CH2), 3.33–3.43 (m, 2CH2), 2.92– 2.95 (m, CH2), 2.52 (s, CH2); 13C NMR (100 MHz, CDCl3) δ 158.6 (d, JC-F = 263.3 Hz), 156.7, 143.7, 138.3 (d, d, JC-F = 14.5 Hz), 136.7 (d, JC-F = 4.7 Hz), 136.5, 130.2, 129.9, 127.8 (d, JC-F = 5.1 Hz), 127.2, 121.6, 113.6, 67.2, 66.5, 63.7, 55.4, 52.3, 23.6; HPLC purity: 4.4 min, 97.5%; HRMS (M + H)+ (ESI+) 407.1430 [M + H]+ (calcd for C20H23FN2O4SH+ 407.1435).

(E)-4-(3-(3-((2-(3’-Fluoropyridin-2’-yl)vinyl)sulfonyl)phenoxy)propyl) morpholine (17c) Diethyl (((3-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.98 g, 2.27 mmol), 2.0M n-BuLi solution in cyclohexane (1.25 mL, 2.50 mmol), 3-fluoropyridine-2carboxaldehyde (0.31 g, 2.50 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.57 g (46%) of 17c as a pale yellow oil; salt is not formed because salt free 17c is oil form; Rf = 0.50 (EtOAc/MeOH 4/1); 1H NMR (400 MHz, CDCl3) δ 8.42 (d, J = 4.4 Hz, ArH), 7.91 (d, J = 15.0 Hz, (E)-isomeric H), 7.42–7.55 (m, 4ArH, (E)-isomeric H), 7.33–7.37 (m, ArH), 7.14 (dd, J = 2.1, 8.2 Hz, ArH), 4.08 (t, J = 6.3 Hz, CH2), 3.71–3.73 (m, 2CH2), 2.46– 2.54 (m, 3CH2), 1.95–2.02 (m, CH2); 13C NMR (100 MHz, CDCl3) δ 159.8, 158.4 (d, JC-F = 36 ACS Paragon Plus Environment

Page 36 of 74

Page 37 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


245.9 Hz), 145.9 (d, JC-F = 5.1 Hz), 141.1, 139.7 (d, JC-F = 44.8 Hz), 133.3 (d, JC-F = 4.4 Hz), 132.9, 130.5, 126.7 (d, JC-F = 4.4 Hz), 124.1 (d, JC-F = 18.9 Hz), 120.6, 120.1, 112.8, 66.9, 66.7, 55.3, 53.7, 26.2; HPLC purity: 4.3 min, 97.3%; HRMS (M + H)+ (ESI+) 407.1431 [M + H]+ (calcd for C20H23FN2O4SH+ 407.1435).

(E)-4-(3-(4-((2-(3’-Fluoropyridin-2’-yl)vinyl)sulfonyl)phenoxy)propyl)

morpholine

hydro chloride (17d) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.53 mmol), 2.0M n-BuLi solution in cyclohexane (0.84 mL, 1.68 mmol), 3-fluoropyridine-2carboxaldehyde (0.21 g, 1.68 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.57 g (92%) of 17d as a white powder; Rf = 0.35 (EtOAc/MeOH 4/1); mp: 218–219 °C; 1H

NMR (400 MHz, DMSO-d6) δ 11.19 (s, HCl), 8.63 (d, J = 4.3 Hz, ArH), 7.81–7.93 (m,

4ArH), 7.67 (d, J = 15.1 Hz, (E)-isomeric H), 7.61 (d, J = 15.1 Hz, (E)-isomeric H), 7.45–7.48 (m, ArH), 7.18 (d, J = 8.8 Hz, 2ArH), 4.19 (t, J = 5.9 Hz, CH2), 3.79–4.05 (m, 2CH2), 3.44 (d, J = 12.2 Hz, CH2), 3.05–3.26 (m, 2CH2), 2.20–2.26 (m, CH2); 13C NMR (100 MHz, DMSOd6) δ 162.9, 150.7, 149.9, 139.6, 138.8, 133.2, 132.1, 130.3, 126.1, 126.0, 115.9, 66.2, 63.6, 53.7, 51.5, 23.2; HPLC purity: 4.2 min, 98.3%; HRMS (M + H)+ (ESI+) 389.1526 [M + H]+ (calcd for C20H24N2O4SH+ 389.1530).

(E)-4-(3-(4-((2-(3’-Fluoropyridin-2’-yl)vinyl)sulfonyl)phenoxy)propyl)

morpholine

hydro chloride (17e) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.53 mmol), 37 ACS Paragon Plus Environment


2.0M n-BuLi solution in cyclohexane (0.84 mL, 1.68 mmol), 3-fluoropyridine-2carboxaldehyde (0.21 g, 1.68 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.57 g (92%) of 17e as a white powder; Rf = 0.35 (EtOAc/MeOH 4/1); mp: 229–230 °2; 1H

NMR (400 MHz, DMSO-d6) δ 10.98 (s, HCl), 8.50 (d, J = 3.8 Hz, ArH), 7.93 (d, J = 8.6

Hz, 2ArH), 7.85–7.90 (m, ArH), 7.67 (s, (E)-isomeric 2H), 7.58–7.62 (m, ArH), 7.19 (d, J = 8.7 Hz, 2ArH), 4.20 (t, J = 5.8 Hz, CH2), 3.95–3.98 (m, CH2), 3.77–3.83 (m, CH2), 3.43–3.47 (m, CH2), 3.24 (s, CH2), 3.03–3.11 (m, CH2), 2.20–3.24 (m, CH2); 13C NMR (75 MHz, MeODd4) δ 164.6, 160.2 (d, JC-F = 261.9 Hz), 147.5 (d, JC-F = 4.8 Hz), 140.0 (d, JC-F = 11.7 Hz), 134.3, 134.2 (d, JC-F = 4.9 Hz), 131.9, 131.4, 129.4 (d, JC-F = 5.1 Hz), 126.6 (d, JC-F = 19.2 Hz), 116.9, 66.8, 65.2, 56.1. 53.3, 24.6; HPLC purity: 4.4 min, 98.6%; HRMS (M + H)+ (ESI+) 407.1431 [M + H]+ (calcd for C20H23FN2O4SH+ 407.1435).

(E)-4-(3-(4-((2-(3’-Chloropyridin-2’-yl)vinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (17f) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.36 g, 0.83 mmol), 2.0M n-BuLi solution in cyclohexane (0.46 mL, 0.91 mmol), 3-chloropyridine-2carboxaldehyde (0.13 g, 0.91 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.35 g (98%) of 17f as a pale yellow powder; Rf = 0.31 (EtOAc/MeOH 9/1); mp: 210– 211 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.40 (s, HCl), 8.59 (dd, J = 1.3, 4.5 Hz, ArH), 8.06 (dd, J = 1.4, 8.2 Hz, ArH), 7.93 (d, J = 8.9 Hz, 2ArH ), 7.87 (d, J = 14.8 Hz, (E)-isomeric H), 7.70 (d, J = 14.8 Hz, (E)-isomeric H), 7.51–7.54 (m, ArH), 7.19 (d, J = 8.9 Hz, 2ArH), 4.20 (t, J = 6.0 Hz, CH2), 3.82–3.97 (m, 2CH2), 3.44 (d, J = 12.2 Hz, CH2), 3.21–3.26 (m, CH2), 3.02– 3.11 (m, CH2), 2.21–2.28 (m, CH2);

13C

NMR (75 MHz, DMSO-d6) δ 162.4, 148.5, 147.0,

138.3, 134.6, 133.8, 132.0, 131.0, 130.0, 126.9, 115.4, 65.6, 63.0, 53.1, 50.9, 22.6; HPLC purity: 38 ACS Paragon Plus Environment

Page 38 of 74

Page 39 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


4.4 min, 98.2%; HRMS (M + H)+ (ESI+) 423.1136 [M + H]+ (calcd for C20H23ClN2O4SH+ 423.1140).

(E)-4-(3-(4-((2-(2’-Chloropyridine-3’-yl)vinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (18a) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.43 mmol), 2-chloropyridine-3carboxaldehyde (0.34 g, 2.43 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.71 g (76%) of 18a as a pale pink powder; Rf = 0.35 (EtOAc/Acetone 4/1); mp: 221–223 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.09 (s, HCl), 8.48 (d, J = 4.7 Hz, ArH), 8.34 (d, J = 7.8 Hz, ArH), 7.88 (d, J = 8.6 Hz, 2ArH), 7.83 (d, J = 15.2 Hz, (E)-isomeric H), 7.73 (d, J = 15.4 Hz, (E)-isomeric H), 7.48–7.54 (m, ArH), 7.21 (d, J = 8.8 Hz, 2ArH), 4.21 (t, J = 5.9 Hz, CH2), 3.97 (d, J = 11.7 Hz, CH2), 3.82 (t, J = 11.9 Hz, CH2), 3.44–3.47 (m, CH2), 3.23–3.28 (m, CH2), 3.04–2.11 (m, CH2), 2.22–2.25 (m, CH2); 13C NMR (100 MHz, DMSO) δ 163.0, 152.0, 150.7, 138.3, 135.0, 134.1, 131.7, 130.4, 127.6, 124.3, 116.0, 66.2, 64.0, 53.7, 51.5, 23.2; HPLC purity: 4.0 min, 97.8%; HRMS (M + H)+ (ESI+) 423.1136 [M + H]+ (calcd for C20H23ClN2O4SH+ 423.1140).

(E)-4-(3-(4-((2-(6’-Fluoropyridine-3’-yl)vinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (18b) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.50 g, 1.14 mmol), 2.0M n-BuLi solution in cyclohexane (0.63 mL, 1.25 mmol), 6-fluoropyridine-339 ACS Paragon Plus Environment


carboxaldehyde (0.16 g, 1.25 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.42 g (79%) of 18b as a white powder; Rf = 0.35 (EtOAc/MeOH 99/1); mp: 187–188 °C; 1H

NMR (400 MHz, DMSO-d6) δ 10.97 (s, HCl), 8.61 (s, ArH), 8.38–8.42 (m, ArH), 7.85 (d,

J = 8.8 Hz, 2ArH), 7.72 (d, J = 15.5 Hz, (E)-isomeric H), 7.67 (d, J = 15.6 Hz, (E)-isomeric H), 7.28–7.30 (m, ArH), 7.19 (d, J = 8.8 Hz, 2ArH), 4.19 (t, J = 5.8 Hz, CH2), 3.96 (d, J = 12.3 Hz, CH2), 3.79 (t, J = 12.0 Hz, CH2), 3.2 (s, CH2), 3.03–3.11 (m, CH2), 2.21 (s, CH2), 2.22–2.25 (m, CH2); 13C NMR (75 MHz, MeOD-d4) δ 165.9 (d, JC-F = 240.9 Hz), 164.2, 149.8 (d, JC-F = 15.1 Hz), 142.0 (d, JC-F = 8.9 Hz), 137.8, 133.7, 131.7, 131.2, 128.8 (d, JC-F = 4.7 Hz), 116.4, 111.3 (d, JC-F = 37.7 Hz), 66.6, 65.1, 55.9, 53.3, 24.7; HPLC purity: 4.4 min, 97.1%; HRMS (M + H)+ (ESI+) 407.1433 [M + H]+ (calcd for C20H23FN2O4SH+ 407.1435).

(E)-4-(3-(4-((2’-Chlorostyrylvinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (19a) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.42 mmol), 2-chlorobenzaldehyde (0.34 g, 2.42 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.71 g (72%) of 19a as a white powder; Rf = 0.38 (EtOAc/MeOH 19/1); mp: 242–243 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.30 (s, HCl), 7.82–7.92 (m, 3ArH, (E)-isomeric H), 7.72 (d, J = 15.4 Hz, (E)isomeric H), 7.58 (dd, J = 1.2, 8.0 Hz, ArH), 7.48 (td, J =1.6, 7.4 Hz, ArH), 7.18–7.42 (m, 2ArH), 4.20 (t, J = 6.0 Hz, CH2), 3.97 (d, J = 10.7 Hz, CH2), 3.80–3.97 (m, CH2), 3.45 (d, J = 12.1 Hz, CH2), 3.22–3.25 (m, CH2), 3.03–3.10 (m, CH2), 2.22–2.26 (m, CH2); 13C NMR (75 MHz, DMSO-d6) δ 162.3, 135.4, 134.0, 132.5, 131.7, 130.6, 130.1, 130.0, 129.7, 128.8, 127.8, 115.4, 65.7, 63.1, 53.2, 51.0, 22.7; HPLC purity: 4.5 min, 97.8%; HRMS (M + H)+ (ESI+) 40 ACS Paragon Plus Environment

Page 40 of 74

Page 41 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


422.1181 [M + H]+ (calcd for C21H24ClNO4SH+ 422.1187).

(E)-4-(3-(4-((3’-Chlorostyrylvinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (19b) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.42 mmol), 3-chlorobenzaldehyde (0.34 g, 2.42 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.91 g (89%) of 19b as a white powder; Rf = 0.35 (EtOAc/MeOH 19/1); mp: 225–227 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.13 (s, HCl), 7.84–7.89 (m, 2ArH, (E)-isomeric H), 7.68–7.73 (m, 2ArH), 7.58 (d, J = 15.4 Hz, (E)-isomeric H), 7.43–7.52 (m, 2ArH), 7.19 (d, J = 8.8 Hz, 2ArH), 4.20 (t, J = 5.8 Hz, CH2), 3.95 (d, J = 11.7 Hz, CH2), 3.81 (t, J = 11.8 Hz, CH2), 3.45 (d, J = 11.9 Hz, CH2), 3.24 (s, CH2), 3.03–3.11 (m, CH2), 2.21–2.25 (m, CH2); 13C NMR (75 MHz, DMSOd6) δ 162.2, 139.2, 134.7, 133.8, 132.1, 130.7, 130.5, 130.4, 129.6, 128.2, 127.7, 115.3, 65.7, 63.1, 53.2, 51.0, 22.7; HPLC purity: 4.3 min, 98.9%; HRMS (M + H)+ (ESI+) 422.1180 [M + H]+ (calcd for C21H24ClNO4SH+ 422.1187).

(E)-4-(3-(4-((4’-Chlorostyrylvinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (19c) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.42 mmol), 4-chlorobenzaldehyde (0.34 g, 2.42 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.94 g (90%) of 19c as a white powder; Rf = 0.33 (EtOAc/MeOH 19/1); mp: 241–242 °C; 1H NMR (400 MHz, 41 ACS Paragon Plus Environment


DMSO-d6) δ 11.10 (s, HCl), 7.85 (d, J = 8.8 Hz, 2ArH), 7.77 (d, J = 8.5 Hz, 2ArH), 7.63 (d, J = 15.4 Hz, (E)-isomeric H), 7.58 (d, J = 15.6 Hz, (E)-isomeric H), 7.50 (d, J = 8.5 Hz, 2ArH), 7.18 (d, J = 8.8 Hz, 2ArH), 4.18 (t, J = 5.9 Hz, CH2), 3.95 (d, J = 11.6 Hz, CH2), 3.81 (t, J = 11.8 Hz, CH2), 3.44 (d, J = 11.3 Hz, CH2), 3.23 (s, CH2), 3.06–3.08 (m, CH2), 2.22 (s, CH2); 13C

NMR (75 MHz, DMSO-d6) δ 162.2, 139.5, 135.5, 132.2, 131.4, 130.6, 129.5, 129.0, 115.3,

65.7, 63.1, 53.2, 51.0, 22.7; one signal was not detected and is belived to overlap with nearby peak; HPLC purity: 4.2 min, 99.7%; HRMS (M + H)+ (ESI+) 422.1183 [M + H]+ (calcd for C21H24ClNO4SH+ 422.1187).

(E)-4-(3-(4-((2’-Fluorostyrylvinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (19d) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.42 mmol), 2-fluorobenzaldehyde (0.34 g, 2.42 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.81 g (82%) of 19d as a white powder; Rf = 0.38 (EtOAc/MeOH 19/1); mp: 247–248 °C; 1H NMR (400 MHz, DMSO-d6) δ 10.54 (s, HCl), 7.83–7.89 (m, 3ArH), 7.64 (d, J = 15.6 Hz, (E)-isomeric H), 7.59 (d, J = 15.6 Hz, (E)-isomeric H), 7.49–7.55 (m, ArH), 7.17–7.35 (m, 2ArH), 7.18 (d, J =8.9 Hz, 2ArH), 4.19 (t, J = 5.9 Hz, CH2), 3.97 (d, J =12.2 Hz, CH2), 3.74 (t, J = 12.1 Hz, CH2), 3.46 (d, J =11.6 Hz, CH2), 3.23–3.28 (m, CH2), 3.04–3.12 (m, CH2), 2.20 (s, CH2); 13C NMR (75 MHz, DMSO-d6) δ 162.1, 160.4 (d, JC-F = 250.1 Hz), 133.3 (d, JC-F = 8.9 Hz), 132.5 (d, JC-F = 4.4 Hz), 131.8, 131.1 (d, JC-F = 4.6 Hz), 129.6 (d, JC-F = 7.0 Hz), 125.1, 120.1 (d, JC-F = 11.2 Hz), 116.2 (d, JC-F = 21.4 Hz), 115.4, 65.6, 63.2, 53.2, 51.0, 22.8; one signal was not detected and is belived to overlap with nearby peak; HPLC purity: 4.7 min, 98.4%; HRMS (M 42 ACS Paragon Plus Environment

Page 42 of 74

Page 43 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


+ H)+ (ESI+) 406.1479 [M + H]+ (calcd for C21H24FNO4SH+ 406.1483).

(E)-4-(3-(4-((3’-Fluorostyrylvinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (19e) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.42 mmol), 3-fluorobenzaldehyde (0.34 g, 2.42 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.89 g (89%) of 19e as a white powder; Rf = 0.35 (EtOAc/MeOH 19/1); mp: 220–221 °C; 1H NMR (400 MHz, DMSO-d6) δ 10.77 (s, HCl), 7.85 (d, J = 8.9 Hz, 2ArH), 7.57–7.78 (m, 2ArH, (E)-isomeric 2H), 7.31–7.50 (m, ArH), 7.27–7.31 (m, ArH), 7.18 (d, J = 8.9 Hz, 2ArH), 4.19 (t, J = 5.8 Hz, CH2), 3.96 (d, J = 12.1 Hz, CH2), 3.77 (t, J = 11.8 Hz, CH2), 3.45 (d, J = 11.9 Hz, CH2), 3.25 (s, CH2), 3.06–3.09 (m, CH2), 2.20 (s, CH2); 13C NMR (75 MHz, MeOD-d6) δ 162.3 (d, JC-F = 242.4 Hz), 162.1, 139.4 (d, JC-F = 2.6 Hz), 134.9 (d, JC-F = 8.1 Hz), 133.2, 132.1, 131.0 (d, JCF

= 8.4 Hz), 130.7, 130.2, 129.5, 125.3 (d, JC-F = 2.6 Hz), 117.6 (d, JC-F = 21.2 Hz), 115.3, 114.9

(d, JC-F = 22.1 Hz), 65.6, 63.1, 53.1, 51.0, 22.7; HPLC purity: 4.7 min, 96.6%; HRMS (M + H)+ (ESI+) 406.1479 [M + H]+ (calcd for C21H24FNO4SH+ 406.1483).

(E)-4-(3-(4-((4’-Fluorostyrylvinyl)sulfonyl)phenoxy)propyl) morpholine hydrochloride (19f) Diethyl (((4-(3-morpholinopropoxy)phenyl)sulfonyl)methyl)phosphonate (0.96 g, 2.20 mmol), 2.0M n-BuLi solution in cyclohexane (1.21 mL, 2.42 mmol), 4-fluorobenzaldehyde (0.34 g, 2.42 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.79 g (78%) of 19f 43 ACS Paragon Plus Environment


as a white powder; Rf = 0.33 (EtOAc/MeOH 19/1); mp: 221–223 °C; 1H NMR (400 MHz, DMSO-d6) δ 10.89 (s, HCl), 7.76–7.87 (m, 4ArH), 7.60 (d, J = 15.4 Hz, (E)-isomeric H), 7.53 (d, J = 15.4 Hz, (E)-isomeric H), 7.25–7.30 (m, 2ArH), 7.16–7.20 (m, 2ArH), 4.18 (t, J = 6.0 Hz, CH2), 3.96 (d, J = 12.7 Hz, CH2), 3.78–3.82 (m, CH2), 3.45 (d, J = 12.4 Hz, CH2), 3.24 (s, CH2), 3.06–3.08 (m, CH2), 2.19–2.23 (m, CH2); 13C NMR (75 MHz, MeOD-d6) δ 163.8 (d, JC-F = 249.5 Hz), 162.1, 139.7, 132.4, 131.3 (d, JC-F = 8.8 Hz), 129.4, 129.1, 128.5, 116.0 (d, JC-F = 21.9 Hz), 115.3, 115.2, 65.6, 63.2, 53.2, 51.0, 22.8; one signal was not detected and is belived to overlap with nearby peak; HPLC purity: 4.3 min, 96.4%; HRMS (M + H)+ (ESI+) 406.1480 [M + H]+ (calcd for C21H24FNO4SH+ 406.1483).

(E)-2-(4-((2-(3’-Fluoropyridin-2’-yl)vinyl)sulfonyl)phenoxy)-1-(4-methylpiperazin-1yl)ethan-1-one hydrochloride (23a) Diethyl

(((4-(2-(4-methylpiperazine-1-yl)2-oxoethoxy)phenyl)sulfonyl)methyl)phosphonate

(0.50 g, 1.11 mmol), 2.0M n-BuLi solution in cyclohexane (0.61 mL, 1.22 mmol), 3fluoropyridine-2-carboxaldehyde (0.15 g, 1.22 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.51 g (91%) of 23a as a white powder; Rf = 0.35 (EtOAc/Acetone 4/1); mp: 153–154 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.72 (s, HCl), 8.49 (d, J = 3.7 Hz, ArH), 7.84–7.90 (m, 3ArH), 7.74 (s, (E)-isomeric 2H), 7.57–7.60 (m, ArH), 7.19 (d, J = 8.6 Hz, 2ArH), 5.04–5.17 (m, CH2), 4.36 (d, J = 13.1 Hz, CH), 4.00 (d, J = 13.4 Hz, CH), 3.60–3.63 (m, CH), 3.42 (s, CH2), 3.13–3.16 (m, CH2), 2.97 (s, CH), 2.76 (s, CH3); 13C NMR (100 MHz, DMSO-d6) δ 165.9, 162.8, 158.5 (d, JC-F = 261.4 Hz), 146.8 (d, JC-F = 4.8 Hz), 139.1 (d, JC-F = 11.0 Hz), 134.0 (d, JC-F = 4.0 Hz), 132.1, 131.7, 130.3, 128.2 (d, JC-F = 4.5 Hz), 125.2 (d, JC-F = 18.8 Hz), 116.2, 66.8, 66.1, 52.3 (d, JC-F = 15.6 Hz), 42.4, 41.4, 38.6; HPLC purity: 4.5 min, 98.7%; HRMS (M + H)+ (ESI+) 420.1384 [M + H]+ (calcd for C20H22FN3O4SH+ 420.1388). 44 ACS Paragon Plus Environment

Page 44 of 74

Page 45 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(E)-2-(4-((2-(3’-Chloropyridin-2’-yl)vinyl)sulfonyl)phenoxy)-1-(4-methylpiperazin-1yl)ethan-1-one hydrochloride (23b) Diethyl

(((4-(2-(4-methylpiperazine-1-yl)2-oxoethoxy)phenyl)sulfonyl)methyl)phosphonate

(0.50 g, 1.11 mmol), 2.0M n-BuLi solution in cyclohexane (0.61 mL, 1.22 mmol), 3chloropyridine-2-carboxaldehyde (0.17 g, 1.22 mmol) and 4.0M hydrogen chloride solution in dioxane (2.0 eq) gave 0.45 g (85%) of 23b as a white powder; Rf = 0.38 (EtOAc/Acetone 4/1); mp: 148–149 °C; 1H NMR (400 MHz, DMSO-d6) δ 11.28 (s, HCl), 8.59 (d, J = 4.0 Hz, ArH), 8.06 (d, J = 8.1 Hz, ArH), 7.86–7.91 (m, 2ArH, (E)-isomeric H), 7.72 (d, J = 14.8 Hz, (E)isomeric H), 7.51–7.54 (m, ArH), 7.18 (d, J = 8.8 Hz, 2ArH), 5.03–5.15 (m, CH2), 4.37 (d, J = 13.4 Hz, CH), 4.40 (d, J = 13.6 Hz, CH), 3.43–3.57 (m, CH, CH2), 3.09–3.12 (m, CH2), 2.96 (s, CH), 2.77 (s, CH3); 13C NMR (100 MHz, DMSO-d6) δ 165.9, 162.9, 149.1, 147.6, 138.9, 135.2, 134.4, 132.5, 131.6, 130.3, 127.4, 116.2, 99.1, 66.0, 52.5, 42.5; two signal were not detected and is belived to overlap with nearby solvent peak; HPLC purity: 4.5 min, 98.3%; HRMS (M + H)+ (ESI+) 436.1087 [M + H]+ (calcd for C20H22ClN3O4SH+ 436.1092).

Cell Culture Engineered U2OS Keap1-Nrf2 nuclear translocation cell lines (93-0821C3, DiscoveRX, Fremont, CA, USA) were grown with an AssayCompleteTM cell culture kit (92-3103G, DiscoveRX) at 37 °C in a humidified atmosphere containing 5% CO2. BV2 cells were grown in RPMI-1640 (Gibco, Carlsbad, CA, USA) supplemented with 10% (v/v) fetal bovine serum (Atlas Biologicals, Fort Collins, CO, USA), 100 U/mL penicillin, 10 μg/mL streptomycin, and 2 mM L-glutamine (Gibco) at 37 °C in a humidified atmosphere containing 5% CO2. 45 ACS Paragon Plus Environment


Keap1-Nrf2 Functional Assay The Keap1-Nrf2 functional assay was performed using a PathHunter® U2OS Keap1-Nrf2 nuclear translocation cell line (93-0821C3, DiscoveRx) according to the manufacturer’s instructions. Briefly, this Nrf2 activation system was designed to measure a non-transcriptional response of activation-dependent Nrf2 translocation to the nucleus using a principal enzyme fragment complementation (EFC) technology. This EFC technology utilized a genetically engineered β-galactosidase enzyme consisting of two fragments: a) Nrf2-tagged Enzyme Donor (ED); b) an Enzyme Acceptor (EA), which is localized to the nucleus. The activation of the Keap1-Nrf2 protein complex resulted in the formation of the functional β-galactosidase in the nucleus, the activity of which can be quantitatively detected using a chemiluminescent substrate. The engineered U2OS cells (1.5  104 cells/well) were seeded on a white 96-well plate and incubated overnight at 37 °C in a humidified atmosphere with 5% CO2. Cells were then incubated with test compounds in the dark at room temperature for 6 h. Subsequently, cells were incubated for 1 h in the same environment with working detection reagent solution. After, luminescence was detected using a SpectraMax®i3 microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Cell Viability Assay Cell viability was assessed using an Ez-Cytox cell viability assay kit (DoGenBio, Cheongju, South Korea) according to the manufacturer’s protocol. This assay is based on a water-soluble tetrazolium salt method. BV2 cells (1.0  104 cells/well) were seeded on a 96-well plate in 100 μL of medium and incubated overnight at 37 °C in a humidified atmosphere with 5% CO2. Cells were then treated with various concentrations of the synthesized compounds for 24 h at 37 °C. After, 10 µL of Ez-Cytox reagent was added to the wells and incubated for 1 h at 37 °C. 46 ACS Paragon Plus Environment

Page 46 of 74

Page 47 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Cell viability was then determined by measuring the absorbance at 450 nm using a SpectraMax®i3 microplate reader.

CYP Inhibition Assay CYP inhibition was measured using a P450-Glo screening system (Promega Corp.) according to the manufacturer’s protocols (Promega Technical Bulletin, P450-Glo Assays, 2009). Briefly, the CYP enzyme and substrate were mixed in KH2PO4 buffer (100 mM, pH 7.4) with or without test compounds, and the reaction was initiated by addition of the NADPH regeneration system (containing NADP+, MgCl2, glucose-6-phosphate, and glucose-6-phosphate dehydrogenase). After incubation for 10–30 min at 37 °C (different incubation times depending on the CYP isotype), the reconstituted luciferin detection reagent was added to stop the reaction and generate the luminescent signal. After incubation for 20 min to stabilize the luminescence, signals were detected using a SpectraMax®i3 microplate reader; inhibition of each CYP isotype by test compounds was expressed as the percentage of activity versus control.

Microsomal Stability Human liver microsomes (0.5 mg/mL) were preincubated with compounds (1 μM) in 0.1 M phosphate buffer (pH 7.4) at 37 °C for 5 min before adding the NADPH regeneration buffer (containing NADP+, MgCl2, glucose-6-phosphate, and glucose-6-phosphate dehydrogenase). The incubation was started by treating the NADPH regeneration buffer and terminated with chloroprorpamide in acetonitrile after 30 min at 37 °C. Precipitated proteins were removed by centrifugation for 5 min at 14,000 g at 4 °C. The supernatant was injected into a liquid chromatography-MS/MS system, and analyzed using a Shimadzu Nexera XR system and TSQ vantage (Thermo). The HPLC column was a Luna C18 column (2.0 × 50 mm, 3-μm particle size; Phenomenex, USA), and the mobile phase was distilled water (A) containing 0.1% formic 47 ACS Paragon Plus Environment


Page 48 of 74

acid and acetonitrile (B) containing 0.1% formic acid. Data analysis was performed using Xcalibur (version 1.6.1). Percent of remaining compound was calculated by comparing the peak area.

RT-qPCR Total RNA was extracted with Trizol (Invitrogen, Carlsbad, CA, USA) and converted to cDNA using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). RT-qPCR was performed using 50 ng of cDNA and the iQ-SYBR Green Supermix (Bio-Rad). Nrf2-depedent antioxidant genes

were

amplified

using

the

TGTGGTATTCGTGGTACTGCTC-3’, GCLM

(forward:

TCGGGATTTATCTTC

reverse:

primers:

GCLC

TCCACTGC-3’); reverse:

(forward:

5’-

5’-GGGCCACTTTCATGTTCTCG-3’);

5’-GGAGCTTCGGGACTGTATCC-3’,

CAGCCACACAGCACTATG-3’, hypoxanthine-guanine

following

HO-1

5’-GCAATC

phosphoribosyltransferase

reverse: (forward:

5’5’-

TTCTTCAGGACCT-3’); (forward:

5’-

CAGGAGAGAAAGATGTGATTGA TA-3’, reverse: 5’-GCCAACACTGCTGAAACA-3’); hypoxanthine-guanine phosphoribosyltransferase was used as an internal control. All RTqPCR reactions were performed on a Bio-Rad CFXTM Connect Real-Time PCR Detection system. The 2 ΔΔCt method was used to calculate fold changes in gene expression.

Western Blot Nuclear lysate extraction. Nuclear lysates were extracted by a previously described method.14 BV2 cells (3  106 cells/plate) were seeded onto a culture dish and treated with various concentrations of 17e for 6 h. After, cells were harvested in ice-cold phosphate-bufferes saline (PBS) and resuspended in 400 μL of cytoplasmic extract buffer containing 10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, and 0.5 mM 48 ACS Paragon Plus Environment

Page 49 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


phenylmethylsulfonyl fluoride. The resuspended cells were incubated at 4 °C for 20 min. Then, 28 μL of 10% NP40 was added, and cells were vortexed vigorously for 15 s. After centrifuging for 2 min at 17,800 g and 4 °C, the cytosoplasmic supernatant was transferred to a new tube. This process was repeated to wash the nuclear pellet; the supernatant was discarded. The nuclear pellet was subsequently resuspended in 100 μL of nuclear extract buffer containing 20 mM HEPES (pH 7.9), 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride and incubated at 4 °C for 20 min. During this incubation, the pellet was vortexed for 10 s in 5 min intervals. The lysates were then centrifuged for 10 min at 17,800 g and 4 °C, and the nuclear supernatant was tranferred to a new tube. The lysates were stored at at −80 °C until used for analysis. Whole cell lysate extraction. To extract the whole cell lysate, cells (5  105 cells/well) were seeded onto a 6-well plate and treated with various concentrations of 17e for 24 h. Then, cells were harvested in RIPA buffer (Sigma-Aldrich, St. Louis, MO, USA) containing a protease inhibitor cocktail and incubated at 4 °C for 30 min. The lysates were then centrifuged for 20 min at 15,814 g and 4 °C before being transferred to a new tube. The lysates were stored at −80 °C until used for analysis. Lysate concentrations were determined by BCA method, and equal amounts of protein (10–20 μg) diluted in 5× sample buffer were separated on a 10% sodium dodecyl sulfatepolyacrylamide gel followed by transfer onto a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). Membranes were incubated with blocking solution containing 4% nonfat dried milk in Tris-buffered saline with 0.1% Tween-20 (TBS-T) for 1 h at room temperature. The membranes were then rinsed three times with TBS-T and immunoblotted overnight at 4 °C with primary antibodies specific for Nrf2 (1:500; Cell signaling, Danvers, MA, USA), GCLC (1:1000; Novus Biologicals, Littleton, CO, USA), GCLM (1:2000; Santa Cruz Biotechnology, 49 ACS Paragon Plus Environment


Santa Cruz, CA, USA), β-actin (1:2000; Santa Cruz Biotechnology), HO-1 (1:1000; Enzo Life Sceince, Ann Arbor, MI, USA), and lamin B1 (1:4000; Bioworld Technology, St. Louis Park, MN, USA). After, membranes were rinsed three times with TBS-T and treated with the appropriate horseradish peroxidase-conjugated secondary antibody (1:10000; GeneTex, Irvine, CA, USA) for 1 h at room temperature. Subsequently, the membranes were rinsed three times with TBS-T and treated with the D-PlusTM enhanced chemiluminescence Pico system (Dongin Biotech, Seoul, South Korea) for 3 min. Immunoblotted proteins were detected with an Amersham Imager 600 (GE Healthcare, Arlington Heights, IL, USA). Densitometric analyses were performed using using ImageJ software (National Institutes of Health), and the data were normalized to lamin B1 or β-actin as loading controls.

PD Animal Model and Treatment All animal experiments were carried out in accordance with the National Institutes of Health guide for the care and use of laboratory animals (Publication No. 8023, revised 1978) and the guidelines of the Institutional Animal Care and Use Committee of the Korea Institute of Science and Technology (Seoul, South Korea). Male 10-week-old C57BL/6 mice (weight, 23– 26 g) were purchased from Daehan Biolink (Eumseong, South Korea). Food and water were given ad libitum, and mice were housed in the animal facility of the Korea Institute of Sceince and Technology on a standard 12-h light/12-h dark cycle. Vehicle for oral administration was used as a solution containing 10% N-methyl-2-pyrrolidone and 20% Tween-80 in distilled water. Vehicle or 17e (20 mg/kg/d) dissolved in the same vehicle solution was orally administered for 3 d; on the second day, MPTP-HCl (20 mg/kg) or saline was intraperitoneally injected four times at 2-h intervals to create the MPTP-induced PD mouse models (n = 10 per group). Six days after MPTP injection, mice were sacrificed for further study.


Page 50 of 74

Page 51 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Behavioral Tests Vertical grid test. All mice were handled daily and trained on the vertical grid apparatus for 3 d before oral drug administration. Mice were allowed to move freely on the apparatus for acclimation and trained to turn around and climb down within 15 s when placed on the top position of the apparatus with their head facing up. After 6 d of MPTP injection, vertical grid testing was conducted to evaluate motor function. The test was repeated twice and videotaped to measure the time to turn, total time, and time to climb down after turn. Coat-hanger test. Mice were placed on the center of the coat-hanger and allowed to climb into the safety zone for 3 min. The position of the mouse on the hanger was scored: 0, falling off the hanger within 20 s; 1, hanging on and moving from the starting position of the hanger; 2, reaching the side of the hanger; 3, climbing the top of one side of the hanger; 4, moving towards the top of the hanger; and 5, reaching the safety zone by climbing the hook of the hanger. Mice did not receive a score if they immediately fell off the hanger. The test was repeated twice.

Immunohistochemistry After anesthesia, mice were transcardially perfused using cold saline and 4% paraformaldehyde. The brains were removed and subsequently postfixed in paraformaldehyde at 4 °C overnight followed by transfer to 30% sucrose solution for 48 h for cryoprotection. After, brains were mounted into optimum cutting temperature embedding solution. The striatum and SNpc were serially cut in 35- or 30-μm sections in a HM525 NX Cryostat (Thermo Shandon Ltd., Cambridge, UK) and then stored in cryoprotectant containing 30% glycerol, 30% ethylene glycol, and 10% 0.2 M phosphate buffer at 4 °C. Immunostaining was performed by freefloating method. The brain sections were rinsed in PBS then incubated in 3% H2O2 for 15 min at room temperature. Subsequently, sections were treated with serum-free protein blocking 51 ACS Paragon Plus Environment


buffer (Agilent, Santa Clara, CA, USA) for 15 min followed by incubation with a primary antiTH antibody (1:1000; Pel-Freez Biologicals, Rogers, AZ, USA) overnight at 4 °C. The next day, sections were washed three times with PBS and treated with a Polink-2 Plus Horseraddish Peroxidase Broad secondary antibody for mouse and rabbit (GBI Labs, Mukilteo, WA, USA) in accordance with the manufacturer’s instructions. Immunoreactivity was visualized by application of 3,3’-diaminobenzidine. The striatum and SNpc were imaged using an Olympus IX51 microscope (Olympus, Tokyo, Japan) to measure the optical density and count the number of TH-positive cells.

Double Immunofluorescent Staining SNpc sections were rinsed in PBS with 0.3% Triton X-100 (PBS-T) and incubated in a blocking solution (1% bovine serum albumin in PBS-T) for 2 h. Then, sections were cotreated at 4 °C (16 h) with Iba-1 (1:800; Wako, Osaka, Japan) and TH (1:800; Millipore, Burlington, MA, USA) primary antibodies. After, the sections were washed three times with PBS-T before coincubating with anti-rabbit Alexa Flour 594 IgG (1:1000) and anti-mouse Alexa Flour 488 IgG (1:1000) for 2 h at room temperature. Finally, all sections were washed three times with PBST and mounted on slides using fluorescent mounting medium (Agilent). Fluorescent images were obtained with a CELENAS® Digital Imaging System microscope (Logos Biosystems, Anyang, South Korea).

Statistical Analysis All experimental results are presented as the mean  standard error of the mean. Statistical analyses were computed by GraphPad Prism 7.0 software (San Diego, CA, USA). Differences between groups were measured using an unpaired two-tailed Student’s t-test or 1-way analysis


Page 52 of 74

Page 53 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


of variance followed by Tukey’s or Dunnett’s multiple comparison test. A P < 0.05 was considered statistically significant.



ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publication website at DOI: Additional ADME/Tox results of compound 17e; Figure S1 showing the result graph of hERG fluorescence polarization assay for 17e; Figure S2 showing the result graph of Ames test for 17e; Table S1 listing the ability to induce HO-1 by ELISA assay for compound 5f, 5n, 6b, 7a, 7b, 17d, 17e, 18b, 19a, 19b, 19c, 19d, 19e, 19f; Table S2 listing plasma stability of 17e; Table S3 listing PAMPA-BBB data for 17e; synthetic methods and data for the intermediates 2, 3, 4, 9, 10, 13, 14, 15, 16, 20, 21, 22; supplemental methods; 1H and 13C NMR spectra of the final compounds 5, 6, 7, 8, 11, 12, 17, 18, 19, 23 (PDF) Molecular formula strigns (CSV)

AUTHOR INFORAMTION Corresponding Author *Phone: +82-2-9585132. Fax: +82-2-9585189. E-Mail: [email protected] ORICD Ki Duk Park: 0000-0002-7753-214X Author Contributions 1J.W.C.

and S.K. contributed equally to this wor.

Notes The authors declare no cometing finalcial interest.

ACNOWLEDGMENTS


Page 54 of 74

Page 55 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


This study was supported by a National Research Council of Science & Technology grant by the South Korean government (MSIP, No. CRC-15-04-KIST), the National Research Foundation of Korea (NRF-2018M3A9C8016849), and Main Research Program (E016450301) of the Korea Food Research Institute.

ABBREVIATIONS USED ADME/Tox, absorption, distribution, metabolism, and excretion/toxicity; CNS, central nerve system; CYP, cytochrome P; DAergic, dopaminergic; EC50, half maximal effective concentration; GCL, glutamate-cysteine ligase; GCLC, glutamate-cysteine ligase catalytic subunit; GCLM, glutamate-cysteine ligase modifier subunit; HO-1, heme oxygenase 1; hERG, human ether-a-go-go-related gene; HPLC, high-performance liquid chromatogtraphy; Iba-1, ionized calicium binding adaptor molecule 1; IC50, half maximal inhibitory concentration; Keap1, Kelch-like ECH-associated protein 1; L-DOPA, L-3,4-dihydroxyphenylalanine; MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; MS, mass spectrometry; Nrf2, nuclear factor (erythroid-derived 2)-like 2; PBS, phosphate-buffered saline; PBS-T, phosphate bufferd salineTriton X-100; PD, Parkinson’s disease; Pe, permeability in cm/s; RT-qPCR, real-time quantitative polymerase chain reaction; SNpc, substantia nigra pars compacta; TBS-T, Trisbuffered saline-Tween-20; TH, tyrosine hydroxylase



REFERENCES 1. Reeve, A.; Simcox, E.; Turnbull, D. Ageing and Parkinson's Disease: Why Is Advancing Age the Biggest Risk Factor? Ageing. Res. Rev. 2014, 14, 19-30. 2. Maiti, P.; Manna, J.; Dunbar, G. L. Current Understanding of the Molecular Mechanisms in Parkinson’s Disease: Targets for Potential Treatments. Transl. Neurodegener. 2017, 6, 28. 3. Sarkar, S.; Raymick, J.; Imam, S. Neuroprotective and Therapeutic Strategies against Parkinson’s Disease: Recent Perspectives. Int. J. Mol. Sci. 2016, 17, 904. 4. AlDakheel, A.; Kalia, L.V.; Lang, A.E. Pathogenesis-Targeted, Disease-Modifying Therapies in Parkinson Disease. Neurotherapeutics. 2014, 11, 6-23. 5. Smith, Y.; Wichmann, T.; Factor, S. A.; DeLong, M. R. Parkinson’s Disease Therapeutics: New Developments and Challenges Since the Introduction of Levodopa. Neuropsychopharmacology. 2012, 37, 213-246. 6. Rizek, P.; Kumar, N.; Jog, M. S. An Update on the Diagnosis and Treatment of Parkinson Disease. CMAJ. 2016, 188, 1157-1165. 7. Pahwa, R.; Tanner, C. M.; Hauser, R. A.; Isaacson, S. H.; Nausieda, P. A.; Truong, D. D.; Agarwal, P.; Hull, K. L.; Lyons, K. E.; Johnson, R.; Stempien, M. J. ADS-5102 (Amantadine) Extended-Release Capsules for Levodopa-Induced Dyskinesia in Parkinson Disease (EASE LID Study): A Randomized Clinical Trial. JAMA. Neurol. 2017, 74, 941-949. 8. Kim, K. S. Toward Neuroprotective Treatments of Parkinson’s Disease. Proc. Natl. Acad. Sci. U.S.A. 2017, 114, 3795-3797. 9. Dong, J.; Cui, Y.; Li, S.; Le, W. Current Pharmaceutical Treatments and Alternative Therapies of Parkinson’s Disease. Curr. Neuropharmacol. 2016, 14, 339-355. 56 ACS Paragon Plus Environment

Page 56 of 74

Page 57 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


10. Michel, P. P.; Hirsch, E. C.; Hunot, S. Understanding Dopaminergic Cell Death Pathways in Parkinson Disease. Neuron. 2016, 90, 675-691. 11. Puspita, L.; Chung, S. Y.; Shim, J. W. Oxidative Stress and Cellular Pathologies in Parkinson’s Disease. Mol. Brain. 2017, 10, 53 12. Dallé, E.; Mabandla, M. V. Early Life Stress, Depression and Parkinson’s Disease: A New Approach. Mol. Brain. 2018, 11, 18. 13. Dias, V.; Junn, E.; Mouradian, M. M. The Role of Oxidative Stress in Parkinson’s Disease. J. Parkinsons. dis. 2013, 3, 461-491. 14. Garcia-Garcia, A.; Zavala-Flores, L.; Rodriguez-Rocha, H.; Franco, R. Thiol-Redox Signaling, Dopaminergic Cell Death, and Parkinson’s Disease. Antioxid. Redox. Signal. 2012, 17, 1764-1784. 15. Choi, D. H.; Cristóvão, A. C.; Guhathakurta, S.; Lee, J.; Joh, T. H.; Beal, M. F.; Kim, Y. S. NADPH Oxidase 1-Mediated Oxidative Stress Leads to Dopamine Neuron Death in Parkinson’s Disease. Antioxid. Redox. Signal. 2012, 16, 1033-1045. 16. Lee, J. A.; Son, H. J.; Choi, J. W.; Kim, J.; Han, S. H.; Shin, N.; Kim, J. H.; Kim, S. J.; Heo, J. Y.; Kim, D. J.; Park, K. D.; Hwang, O. Activation of the Nrf2 Signaling Pathway and Neuroprotection of Nigral Dopaminergic Neurons by a Novel Synthetic Compound KMS99220. Neurochem. Int. 2018, 112, 96-107. 17. Simoni, E.; Serafini, M. M.; Caporaso, R.; Marchetti, C.; Racchi, M.; Minarini, A.; Bartolini, M.; Lanni, C.; Rosini, M. Targeting the Nrf2/Amyloid-Beta Liaison in Alzheimer's Disease: A Rational Approach. ACS. Chem. Neurosci. 2017, 8, 16181627. 18. Shekh-Ahmad, T.; Eckel, R.; Dayalan Naidu, S.; Higgins, M.; Yamamoto, M.; Dinkova-Kostova, A. T.; Kovac, S.; Abramov, A. Y.; Walker, M. C. KEAP1 Inhibition 57 ACS Paragon Plus Environment


Is Neuroprotective and Suppresses the Development of Epilepsy. Brain. 2018, 141, 1390-1403 19. Lastres-Becker, I.; García-Yagüe, A. J.; Scannevin, R. H.; Casarejos, M. J.; Kügler, S.; Rábano, A.; Cuadrado, A. Repurposing the NRF2 Activator Dimethyl Fumarate as Therapy against Synucleinopathy in Parkinson's Disease. Antioxid. Redox. Signal. 2016, 25, 61-77. 20. Lastres-Becker, I. Role of the Transcription Factor Nrf2 in Parkinson’s Disease: New Insights. J. Alzheimers. Dis. Parkinsonism. 2017, 7, 4. 21. Vomund, S.; Schäfer, A.; Parnham, M. J.; Brüne, B.; von Knethen, A. Nrf2, the Master Regulator of Anti-Oxidative Responses. Int. J. Mol. Sci. 2017, 18, 2772. 22. Liu, X. F.; Zhou, D. D.; Xie, T.; Hao, J. L.; Malik, T. H.; Lu, C. B.; Qi, J.; Pant, O. P.; Lu, C. W. The Nrf2 Signaling in Retinal Ganglion Cells under Oxidative Stress in Ocular Neurodegenerative Diseases. Int. J. Mol. Sci. 2018, 14, 1090-1098. 23. Woo, S. Y.; Kim, J. H.; Moon, M. K.; Han, S. H.; Yeon, S. K.; Choi, J. W.; Jang, B. K.; Song, H. J.; Kang, Y. G.; Kim, J. W.; Lee, J.; Kim, D. J.; Hwang, O.; Park, K. D. Discovery of Vinyl Sulfones as a Novel Class of Neuroprotective Agents toward Parkinson's Disease Therapy. J. Med. Chem. 2014, 57, 1473-1487. 24. Lee, J. A.; Kim, J. H.; Woo, S. Y.; Son, H. J.; Han, S. H.; Jang, B. K.; Choi, J. W.; Kim, D. J.; Park, K. D.; Hwang, O. A Novel Compound VSC2 Has Anti-Inflammatory and Antioxidant Properties in Microglia and in Parkinson's Disease Animal Model. Br. J. Pharmacol. 2015, 172, 1087-1100. 25. Vitaku, E.; Smith, D. T.; Njardarson, J. T. Analysis of the Structural Diversity, Substitution Patterns, and Frequency of Nitrogen Heterocycles among U.S. FDA Approved Pharmaceuticals. J. Med. Chem. 2014, 57, 10257-10274. 26. Pennington, L. D.; Moustakas, D. T. The Necessary Nitrogen Atom: A Versatile High58 ACS Paragon Plus Environment

Page 58 of 74

Page 59 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Impact Design Element for Multiparameter Optimization. J. Med. Chem. 2017, 60, 3552-3579. 27. Patil, P.; Madhavachary, R.; Kurpiewska, K.; Kalinowska-Tłuścik, J.; D ömling, A. De Novo Assembly of Highly Substituted Morpholines and Piperazines. Org. Lett. 2017, 19, 642-645. 28. Rupak, K.; Vulichi, S. R.; Suman, K. Emphasizing Morpholine and its Derivatives (MAID): Typical Candidate of Pharmaceutical Importance. Int. J. Chem. Sci. 2016, 14, 1777-1788. 29. Park, J. H.; Choi, J. W.; Ju, E. J.; Pae, A. N.; Park, K. D. Antioxidant and AntiInflammatory Activities of a Natural Compound, Shizukahenriol, through Nrf2 Activation. Molecules. 2015, 20, 15989-16003. 30. Wakabayashi, N.; Dinkova-Kostova, A. T.; Holtzclaw, W. D.; Kang, M. I.; Kobayashi, A.; Yamamoto, M.; Kensler, T. W.; Talalay, P. Protection against Electrophile and Oxidant Stress by Induction of the Phase 2 Response: Fate of Cysteines of the Keap1 Sensor Modified by Inducers. Proc. Natl. Acad. Sci. U.S.A. 2004, 101, 2040-2045. 31. Fourquet, S.; Guerois, R.; Biard, D.; Toledano, M. B. Activation of NRF2 by Nitrosative Agents and H2O2 Involves KEAP1 Disulfide Formation. J. Biol. Chem. 2010, 285, 8463-8471. 32. Jazwa, A.; Cuadrado, A. Targeting Heme Oxygenase-1 for Neuroprotection and Neuroinflammation in Neurodegenerative Diseases. Curr. Drug Targets 2010, 11, 1517−1531.


Journal of Medicinal Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46

Page 60 of 74

Scheme 1. Synthesis of Compounds 5-8.

2 3

O P OEt OEt

TsO SH

R1

4

2

2

R1

Cs2CO3, DMF, r.t., 12 h 84 - 87%

3

O P OEt OEt

S

4

2

mCPBA CH2Cl2, r.t., 2 h 95 - 96%

R1

3 4

3a; R1 = 2-OMe 3b; R1 = 3-OMe 3c; R1 = 4-OMe

N R

2

n-BuLi

2 3

R

THF, -78 °C to r.t., 2 h 43 - 99%

1

4

O S O

2'

N

6'

R2

3'

5' 4'

O H

N

R2

2

R1

3 4

O S O

3'

2'

N

4'

R2

6' 5'

O H N

R2 R

1

3

2

4

O S O

4'

3' 2'

N

5'

R

2

6'

O N

H N

R2 R1

3 4

2

O S O

3' 4'

2'

N N

O P OEt OEt

4a; R1 = 2-OMe 4b; R1 = 3-OMe 4c; R1 = 4-OMe

O H

O S O

R2

6'

5a; R1 = 2-OMe, R2 = H 5b; R1 = 2-OMe, R2 = 6'-Cl 5c; R1 = 2-OMe, R2 = 5'-Cl 5d; R1 = 2-OMe, R2 = 3'-F 5e; R1 = 2-OMe, R2 = 3'-Cl 5f; R1 = 3-OMe, R2 = H 5g; R1 = 3-OMe, R2 = 6'-Cl 5h; R1 = 3-OMe, R2 = 5'-Cl

5i; R1 = 3-OMe, R2 = 3'-F 5j; R1 = 3-OMe, R2 = 3'-Cl 5k; R1 = 4-OMe, R2 = H 5l; R1 = 4-OMe, R2 = 6'-Cl 5m; R1 = 4-OMe, R2 = 5'-Cl 5n; R1 = 4-OMe, R2 = 3'-F 5o; R1 = 4-OMe, R2 = 3'-Cl

6a; R1 = 2-OMe, R2 = H 6b; R1 = 2-OMe, R2 = 2'-OMe 6c; R1 = 2-OMe, R2 = 2'-Cl 6d; R1 = 2-OMe, R2 = 2',6'-Cl 6e; R1 = 3-OMe, R2 = H

6f; R1 = 3-OMe, R2 = 2'-Cl 6g; R1 = 4-OMe, R2 = H 6h; R1 = 4-OMe, R2 = 2'-Cl 6i; R1 = 4-OMe, R2 = 6'-F

7a; R1 = 2-OMe, R2 = H 7b; R1 = 3-OMe, R2 = H 7c; R1 = 4-OMe, R2 = H 8a; R1 = 2-OMe, R2 = H 8b; R1 = 2-OMe, R2 = 2',4'-Cl 8c; R1 = 3-OMe, R2 = H 8d; R1 = 4-OMe, R2 = H


Page 61 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46


Scheme 2. Synthesis of Compounds 11 and 12.

TsO X Y

2

SH

O P OEt OEt

X

Cs2CO3, DMF, r.t., 12 h 65 - 99%

R1

X = N or C Y = N or C R1 = CF3 or H O

R2

S

Y

mCPBA CH2Cl2, r.t., 2 h 80 - 92%

R1

X

n-BuLi Y

R2

O S O R1

X Y

O S O R1

11a; X = N, Y = C, R1 = H, R2 = OMe 11b; X = N, Y = C, R1 = H, R2 = F 11c; X = N, Y = C, R1 = CF3, R2 = F 11d; X = C, Y = N, R1 = CF3, R2 = F

O N

H

X

F Y

O S O R1

O P OEt OEt

10a; X = N, Y = C, R1 = H 10b; X = N, Y = C, R1 = CF3 10c; X = N, Y = C, R1 = CF3 10d; X = H, Y = N, R1 = H

9a; X = N, Y = C, R1 = H 9b; X = N, Y = C, R1 = CF3 9c; X = N, Y = C, R1 = CF3 9d; X = H, Y = N, R1 = H

H THF, -78 oC to r.t., 2 h 70 - 92%

O P OEt OEt

N F


12; X = N, Y = C, R1 = CF3


Page 62 of 74

Scheme 3. Synthesis of Compounds 17-19. TsO 2

SH

3

HO

2

O P OEt OEt

2 3

4

S

HO

Cs2CO3, DMF, r.t., 12 h 58 - 87%

4

O P OEt OEt

13a; 2-OH 13b; 3-OH 13c; 4-OH

2

mCPBA

3

HO

CH2Cl2, r.t., 2 h 84 - 96%

2 3

N O

O

4

O P OEt OEt

16a; 2-O(CH2)3-morpholine 16b; 3-O(CH2)3-morpholine 16c; 4-O(CH2)3-morpholine

N

H

R2

O P OEt OEt

14a; 2-OH 14b; 3-OH 14c; 4-OH

O O S O

4

O S O

HCl N

4M HCl

n-BuLi, THF, EtOAc, r.t., 2 h O -78 °C to r.t., 2 h

2 3

O

4

O S O

2' N

6'

R2

3'

5' 4'

46 - 98% O H

N

R2

HCl N

4M HCl

n-BuLi, THF, EtOAc, r.t., 2 h -78 °C to r.t., 2 h 72 - 79%

O S O O

H

R2

4M HCl

HCl N

O S O O

EtOAc, r.t., 2 h O

n-BuLi, THF, -78 °C to r.t., 2 h 72 - 90%


17a; 2-O(CH2)3-morpholine·HCl, R2 = H 17b; 2-O(CH2)3-morpholine·HCl, R2 = 3'-F 17c; 3-O(CH2)3-morpholine, R2 = 3'-F 17d; 4-O(CH2)3-morpholine·HCl, R2 = H 17e; 4-O(CH2)3-morpholine·HCl, R2 =3'-F 17f; 4-O(CH2)3-morpholine·HCl, R2 = 3'-Cl

2'

N

4'

R2

6'

2' 3'

R2

4'

15

K2CO3, CH3CN, 82 °C, 2.5 h 57 - 80%

18a; R2 = 2'-Cl 18b; R2 = 6'-F

5'

O

O

3'

OMs

N O

19a; R2 = 2'-Cl 19b; R2 = 3'-Cl 19c; R2 = 4'-Cl 19d; R2 = 2'-F 19e; R2 = 3'-F 19f; R2 = 4'-F

Page 63 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46


Scheme 4. Synthesis of Compounds 23. O S O

O

O P OEt OEt

Br

OEt

K2CO3, CH3CN, 82 °C, 2.5 h 100%

HO 14c

O S O

EtO

O P OEt OEt

O O

O S O

1. NaOH 2. HCl EtOH, r.t., 0.5 h 98%

20

HO

O P OEt OEt

O O

21

O O S O

NH N CDI, THF, r.t., 2 h 60%

N N

O O

O P OEt OEt

N

H R

2

n-BuLi, THF, -78 °C to r.t., 2 h

22

4M HCl EtOAc, r.t., 2 h 85 - 91%


O S O

HCl N N

O O

23a; R2 = F 23b; R2 = Cl

N R2


Page 64 of 74

Table 1. Effects of Synthesized Compounds 5−12 on Nrf2 Activation. 2 3

R1

4

O S O

N

6'

R2

3'

5' 4'

Comp.

R1

R2

Nrf2 EC50 (μM)a

Comp.

R1

R2

Nrf2 EC50 (μM)a

5a 5b 5c 5d 5e 5f 5g 5h

2-OMe 2-OMe 2-OMe 2-OMe 2-OMe 3-OMe 3-OMe 3-OMe

-H 6’-Cl 5’-Cl 3’-F 3’-Cl -H 6’-Cl 5’-Cl

9.070 ± 0.021 1.155 ± 0.017 6.312 ± 0.040 0.877 ± 0.015 0.142 ± 0.008 2.171 ± 0.012 0.786 ± 0.025 0.132 ± 0.049

5i 5j 5k 5l 5m 5n 5o

3-OMe 3-OMe 4-OMe 4-OMe 4-OMe 4-OMe 4-OMe

3’-F 3’-Cl -H 6’-Cl 5’-Cl 3’-F 3’-Cl

0.444 ± 0.067 0.098 ± 0.050 >10 3.270 ± 0.012 9.355 ± 0.066 1.083 ± 0.005 0.347 ± 0.056

2 3

R

1

4

O S O

O S R1 O

2'

N 4'

R

2

6' 5'

Comp.

R1

R2

Nrf2 EC50 (μM)a

6a 6b 6c 6d 6e 6f 6g 6h

2-OMe 2-OMe 2-OMe 2-OMe 3-OMe 3-OMe 4-OMe 4-OMe

-H 2’-OMe 2’-Cl 2’, 6’-Cl -H 2’-Cl -H 2’-Cl

>10 >10 0.849 ± 0.062 0.178 ± 0.025 6.287 ± 0.039 0.348 ± 0.036 >10 0.955 ± 0.016

Comp.

11a

11b


R1 N

N

R2

R2

Nrf2 EC50 (μM)a OMe

7.021 ± 0.340

F

1.007 ± 0.103

Page 65 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46


6i

4-OMe 3

R

2

1

4

6’-F O S O

6.845 ± 0.045

3' 2'

N

5'

R

11c

0.124 ± 0.024 CF3

6'

Comp.

R1

R2

Nrf2 EC50 (μM)a

7a 7b 7c

2-OMe 3-OMe 4-OMe

-H -H -H

1.517 ± 0.126 0.655 ± 0.018 1.198 ± 0.017

3

2

R1

4

O S O

F

N

2

F

11d

0.350 ± 0.060

N

2'

N 4'

N

R2

N

N

6'

Comp.

R1

R2

Nrf2 EC50 (μM)a

8a 8b 8c 8d

2-OMe 2-OMe 3-OMe 4-OMe

-H 2’, 4’-Cl -H -H

>10 0.148 ± 0.019 7.383 ± 0.219 >10

12

0.202 ± 0.022 CF3

1b SFNc

a The

F

0.530 ± 0.025 0.580 ± 0.024

Keap1-Nrf2 functional assay was performed using a PathHunter® U2OS Keap1-Nrf2 nuclear translocation cell line (93-0821C3, DiscoveRx). U2OS cells were plated at 13,000 cells/well in triplicate with various compound concentrations for 6 h. The activation-dependent nuclear factor (erythroid-derived 2)-like 2 (Nrf2) translocation was determined using a cell-based functional assay, with mean ± standard error of the mean half maximal effective concentration (EC50) values. bCompound 1 developed in previous study as an Nrf2 activator.23 cSFN, sulforaphane: a well-known potent activator of Nrf2.



Page 66 of 74

Table 2. Effects of Synthesized Compounds 17−23 on Nrf2 Activation. O S O

2

HCl N

3

O

4

O

Comp.

N

17a 17b 17c 17d 17e 17f

2-morpholine∙HCl 2-morpholine∙HCl 3-morpholine 4-morpholine∙HCl 4-morpholine∙HCl 4-morpholine∙HCl

HCl N

HCl N

R2

R2

O

3'

R2

4'

O

Nrf2 EC50

(μM)a

>10 7.610 ± 0.056 0.908 ± 0.057 7.978 ± 0.025 0.346 ± 0.050 0.246 ± 0.043

Comp.

R2

Nrf2 EC50 (μM)a

19a 19b 19c 19d 19e 19f

2’-Cl 3’-Cl 4’-Cl 2’-F 3’-F 4’-F

3.230 ± 0.121 >10 >10 8.659 ± 0.981 >10 >10

N 4'

O S O

HCl N

2'

R2

N

6'

N R2

O

5'

O

2'

O

-H -F -F -H -F -Cl O S O

O S O

O

Comp.

R2

18a 18b

2’-Cl 6’-F

Nrf2 EC50

(μM)a

2.642 ± 0.145 >10

Comp.

R2

Nrf2 EC50 (μM)a

23a 23b

-F -Cl

1.204 ± 0.104 0.327 ± 0.090

aU2OS

cells were plated at 13,000 cells/well in triplicate with various compound concentrations for 6 h. Activation-dependent nuclear factor (erythroid-derived 2)-like 2 (Nrf2) translocation was determined using a cell-based functional assay mean ± standard error of the mean half maximal effective concentration (EC50) values.


Page 67 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46


Table 3. CYP Inhibition, Microsomal Stability, and Cell Viability Tests of the Synthesized Compounds. CYP enzyme activitiesa (%)a Comp. 5a

Microsomal Stabilityb

Cell viabilityc at 10 & 50 μM (%)

2C19

2D6

2C9

1A2

3A4

47.8

100.0

97.7

72.5

38.4

91

100±0.1, 100±2.9

(%, human)

CYP enzyme activities a (%) Comp.

Microsomal Stabilityb

Cell viabilityc at 10 & 50 μM (%)

2C19

2D6

2C9

1A2

3A4

7c

0.1

23.0

38.8

65.9

76.9

nde

71.0±1.2, 69.0±1.5

100±2.9, 80.5±0.8

8a

80.5

86.6

100.0

81.6

84.4

98

100±2.4, 97.9±3.0

(%, human)

5b

18.9

100.0

100.0

69.2

64.6

nde

5c

7.40

100.0

73.6

82.4

83.1

nde

100±1.5, 92.6±0.6

8b

16.9

96.4

100.0

57.5

78.5

nde

100±1.3, 79.9±0.8

5d

19.5

91.9

100.0

85.2

75.9

nde

100±1.2, 99.2±1.3

8c

57.1

89.8

87.5

85.9

86.9

96

100±3.0, 100±4.6

100±2.7, 100±3.2

8d

57.8

86.6

100.0

63.0

90.7

94

100±1.0, 100±0.5

5e

11.1

98.4

100.0

78.5

48.6

nde

5f

7.8

82.7

100.0

84.1

83.7

74

100±2.0, 98.9±1.3

11a

47.4

91.1

100.0

47.1

98.8

71

100±0.9, 93.4±0.7

5g

2.35

91.2

100.0

82.7

36.7

34

100±2.3, 89.3±2.4

11b

37.4

99.1

100.0

74.9

98.8

91

100±2.0, 98.6±0.5

5h

3.33

81.8

39.5

80.8

40.6

9.6

100±3.1, 67.6±1.4

11c

24.8

74.0

100.0

71.5

75.2

97

100±2.5, 100±3.1

5i

5.6

100.0

97.2

86.6

68.8

31

100±0.8, 97.4±0.3

11d

33.7

84.2

92.0

8.8

74.3

73

100±1.6, 100±0.8

5j

3.40

93.2

31.9

81.3

38.0

22

100±2.9, 82.2±4.3

12

22.6

72.2

100.0

65.1

78.3

98

100±1.1, 84.1±0.1

5k

9.70

100.0

100.0

82.8

82.9

56

100±1.7, 100±1.2

17a

87.4

86.7

87.9

97.3

91.8

nde

100±1.2, 87.8±1.3

97.0±0.9, 85.0±1.0

17b

68.7

66.7

100.0

53.2

62.8

nde

100±2.0, 92.2±0.1

5l

1.16

90.7

100.0

87.8

70.0

nde

5m

1.90

89.0

59.0

75.6

85.8

6.0

100±2.0, 84.1±0.8

17c

63.1

96.0

100.0

98.1

80.7

48

100±1.6, 92.6±0.8

5n

1.50

89.7

100.0

83.5

70.4

1.8

94.2±0.3, 86.6±1.7

17d

87.7

99.3

90.7

92.3

84.8

84

96.3±2.5, 93.0±1.1

5o

3.80

97.5

100.0

88.2

91.8

2.0

94.7±0.1, 89.8±2.0

17e

77.4

99.7

100.0

87.2

97.4

84

100±1.3, 99.0±1.5

6a

100.0

68.5

49.4

88.7

33.2

97

100±2.1, 92.0±3.7

17f

53.6

89.6

100.0

98.6

100.0

nde

100±2.9, 83.4±0.2

6b

20.1

100.0

100.0

54.0

75.7

nde

100±0.5, 81.9±1.8

18a

93.6

87.9

93.0

86.3

79.9

71

88.2±1.9, 80.1±0.3 84.5±2.2, 80.8±0.3

6c

29.0

100.0

100.0

82.0

92.0

77

99.7±1.0, 87.5±0.9

18b

80.1

91.7

100.0

77.8

100.0

nde

6d

13.0

84.3

100.0

46.3

56.3

18

100±3.2, 99.8±2.0

19a

43.6

89.6

100.0

95.1

56.6

82

91.0±0.7, 74.3±1.3

6e

22.0

91.9

100.0

69.7

63.3

75

100±0.6, 90.8±0.8

19b

43.0

71.9

78.4

93.1

53.2

nde

100±1.2, 71.6±0.9

83.0

nde

94.5±0.1, 78.5±0.4

6f

0.9

90.0

100.0

76.8

44.3

29

100±0.4, 78.8±0.8

19c

59.8


70.3

60.8

89.7


6g

6.6

84.0

76.5

75.1

80.5

nde

100±2.3, 76.3±0.2

19e

63.8

46.8

84.9

99.5±3.8, 85.8±1.5

19d

56.2

Page 68 of 74

83.6

97.6

93.6

89.7

nde

77.4±3.1, 70.2±0.5

88.0

91.3

nde

100±1.4, 82.4±0.1

6h

4.0

95.5

100.0

91.8

96.4

nde

6i

3.6

87.9

100.0

64.7

98.2

46

100±2.4, 95.7±0.3

19f

82.8

57.7

80.1

87.1

100.0

nde

100±0.8, 90.4±3.0

7a

14.2

78.6

52.2

53.4

85.0

nde

96.8±0.4, 78.9±0.4

23a

83.9

93.0

100.0

95.6

96.2

84

100±0.8, 100±0.3

7b

1.8

34.2

44.4

36.0

49.7

72

84.3±1.0, 21.3±0.1

23b

71.9

89.9

73.4

93.9

91.1

50

100±1.0, 88.5±0.6

1d

5.4

88.1

100.0

41.7

42.3

20

100±1.4, 82.5±1.1

aCytochrome

P450 (CYP) inhibition assay was performed using a P450-GloTM assay system (Promega) . bIn vitro microsomal stability of the synthesized compound; % remaining was determined after 30-min incubation with human microsomes. The % of parent compound remaining was calculated by comparing peak areas. cCell viability was determined using Ez-Cytox. BV2 cells (10,000 cells/well) were treated with test compounds (10 or 50 μM) and incubated for 24 h before EZ-cytox assay. All experiments were perfomed in triplicate cultures, and the data were averaged and expressed as percent of untreated contro ± standard error of the mean. dCompound 1 developed in a previous study.23 end, not determined.


Page 69 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table 4. Summary of 17e properties.

HCl N

O S O F

O

O

N

17e

Aqueous solubility

> 30 mg/mL

pKa, LogP (cLogP)

7.58, 2.29 (2.49)

Actiavtion of the Nrf2 response (EC50, μM)

0.346 ± 0.050

Cell viability in 50 μM (%)

99.0 ± 1.5 77.4 (2C19), 99.7 (2D6), 96.7 (2C9),

CYP inhibition (% of control activity)

87.2 (1A2), 97.4 (3A4),

Human microsomal stability

84.0

(% remaining) PAMPA-BBB (Pe, cm/s)

15.63 (CNS+)

Plasma stability

98.2 (human), 90.2 (rat)

(% remaining) hERG toxicity (IC50, μM)

112.1 ± 13.5

Mutagenic toxicity (TA98, TA100, fold

negative

induction over the negative control)

All experiments were performed in triplicate except for microsomal and plasma stability tests. The predicted pKa and ClogP values were calculated using ChemDraw v15.1. PAMPA-BBB, parallel artificial membrane permeability assay-blood-brain barrier; CYP, cytochrome P; hERG, human ether-a-go-go-related gene; Nrf2, nuclear factor (erythroid-derived 2)-like 2; IC50, half maximal inhibitory concentration; Pe, permeability



Figure 1. 17e induces nuclear translocation of Nrf2. (a) The Keap1-Nrf2 functional assay of engineered U2OS cells treated with various concentrations of 17e for 6 h. Signal was detected as relative luminescence units of the saturated concentration using a chemiluminescent substrate. Cell viability assay of BV2 cells treated with various concentrations of 17e for 24 (b) or 6 h (c, d). The amount of nuclear and total Nrf2 was measured by Western blot with lamin B1 as a nuclear marker; β-actin was used as an internal control. All experiments were performed in triplicate. Data are shown as means  standard error of the means and analyzed by Student’s t-test; *P < 0.05, **P < 0.01, ***P < 0.001 versus the vehicle-treated control group. 70 ACS Paragon Plus Environment

Page 70 of 74

Page 71 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 2. 17e dose-dependently induced expression of antioxidant enzymes in BV2 cells. (a, b) BV2 cells were treated with various concentrations of 17e for 24 h then subjected to Western blot analysis of HO-1, GCLM, and GCLC using β-actin as an internal control. (c) BV2 cells were treated with various concentrations of 17e for 6 h, and relative mRNA levels of Nrf2dependent genes were measured by RT-qPCR; hypoxanthine-guanine phosphoribosyl transferase was used as an internal control. All experiments were performed in triplicate. Data are shown as means  standard error of the means and analyzed by Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001 versus the vehicle-treated control group.



Figure 3. 17e attenuates motor abnormalities in MPTP-induced PD mice. (a) Experimental protocols for vertical grid and coat-hanger behavioral tests. (b) The time to turn and total time were measured in the vertical grid test. (c) Coat-hanger test scores measured according to the position of the mouse. Data are shown as means  standard error of the means (n = 10 per group); *P < 0.05, **P < 0.01, ***P < 0.001 versus the MPTP-treated group.


Page 72 of 74

Page 73 of 74 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. 17e protects DAergic neurons and reduces microglial activation in MPTPinduced PD mice. (a) Representative immunohistochemical staining (Brown, TH) in the striatum and SNpc. Bar graphs summarize TH-immunopositive density and cell numbers. (b) Representative double immunofluorescent staining in the SNpc (Green, TH; Red, Iba-1). Bar graph summarizing analysis of Iba-1 immunofluorescence intensity. Data are shown as the mean  standard error of the mean (n = 6 per group); ***P < 0.001 versus the MPTP-treated group.



TOC


Page 74 of 74

Optimization of Vinyl Sulfone Derivatives as Potent Nuclear Factor

Recommend Documents