Orthogonal Operation of Constitutional Dynamic Networks

Subscriber access provided by READING UNIV

Article

Orthogonal Operation of Constitutional Dynamic Networks Consisting of DNA-Tweezer Machines Liang Yue, Shan Wang, Alessandro Cecconello, Jean-Marie Lehn, and Itamar Willner ACS Nano, Just Accepted Manuscript • DOI: 10.1021/acsnano.7b04557 • Publication Date (Web): 15 Nov 2017 Downloaded from http://pubs.acs.org on November 16, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Nano is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Orthogonal Operation of Constitutional Dynamic Networks Consisting of DNA-Tweezer Machines Liang Yue,† Shan Wang,† Alessandro Cecconello,† Jean-Marie Lehn‡ and Itamar Willner*,† †

Institute of Chemistry, The Center for Nanoscience and Nanotechnology, The Hebrew

University of Jerusalem, Jerusalem 91904, Israel ‡

Institut de Science et d’Ingénierie Supramoléculaires (ISIS), University of Strasbourg, 8 Rue

Gaspard Monge, Strasbourg 67000, France KEYWORDS: nucleic acid; nanobiotechnoloy; supramolecular structure; DNAzyme; Gquadruplex; triplex; strand-displacement

ABSTRACT: Overexpression or down-regulation of cellular processes are often controlled by dynamic chemical networks. Bioinspired by nature, we introduce constitutional dynamic networks (CDNs) as systems that emulate principle of the nature processes. The CDNs comprise of dynamically exchangeable equilibrated constituents that respond to external triggers by adapting the composition of the dynamic mixture to the energetic stabilization of the constituents. We introduce a nucleic acid-based CDN that includes four exchangeable and mechanically-triggered tweezers AA', BB', AB' and BA' existing in close, close, open and open configurations, respectively. By subjecting the CDN to auxiliary triggers, the guided stabilization of one of the network constituents dictates the dynamic reconfiguration of the structures of the

1 Environment ACS Paragon Plus

ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

tweezers constituents. The orthogonal and reversible operations of the CDN DNA-tweezers are demonstrated, using T-A·T triplex or K+-stabilized G-quadruplex as structural motifs that control the stabilities of the constituents. The implications of the study rest on the possible applications of input-guided CDNs assemblies for sensing, logic gate operations and programmed activation of molecular machines.

Intracellular biological transformations are often up-regulated or down-regulated by complex dynamically equilibrated mixtures of constitutional networks.1–4 Bioinspired by the natural processes, substantial research efforts are directed to emulate such process by artificial means.5–8 An artificial constitutional dynamic network (CDN) consists of a mixture of self-assembled molecular or macromolecular constituents that are inter-converted by component-exchange. The contents of the constituents in the equilibrated mixture are dictated by the thermodynamic stabilities of the constituents. Subjecting the CDN to an external physical or chemical trigger (effector), which affects the stability of one of the network constituents, leads to a “systemresponse”, whereby the composition, and eventually the functions of the network are altered to adapt to the input-guided trigger.9,10 The concept of the input-guided control of CDNs is exemplified in Figure 1. The CDN in state X includes four equilibrated constituents, AA', BB', AB' and BA'. While constituents connected with blunt lines share components, the constituents connected with arrows do not share components. Subjecting the mixture to the trigger T1 stabilizes constituent AA' that results in the “system-response”, state Y, where the content of AA' is enriched by the concomitant separation of constituents AB' and BA', and the simultaneous enrichment of the constituent BB'. Treatment of state Y with the counter-trigger T1' that destabilizes AA', leads to a “system-response” that recovers to state X. Similarly, the T2 triggered stabilization of the constituent AB' in state X leads to state Z, where constituents AB'


Page 2 of 37

Page 3 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

and BA' are up-regulated while constituents AA' and BB' are down-regulated. As before, destabilization of AB' by the counter-trigger T2', recovers state X. CDN ensembles reveal distinct chemical properties reflected by the self-organization and adaptive features and triggered, effector-induced dynamic programmability. Significant advances in designing chemical CDN assemblies

were

reported,

including

the

orthogonal

triggering

of

equilibrated

hydrazone/arylhydrazone constituents by light or metal ions,11 and the orthogonal control of polymeric hydrazone/hydrazine grids by Lewis acids or metal ions as triggers.12,13 Despite the progress in designing biomimetic CDN systems, the field suffers from several limitations: (i) The diversity of inter-convertible chemical constituents is limited and lacks a versatile chemical building block. (ii) The nature of chemical triggers that can be adapted for the operation of the CDNs is limited. (iii) The operation of the CDNs usually lacks a sequential programmable functionality. The base sequence, comprising nucleic acids provides a rich “tool-box” to design and construct complex stimuli-responsive supramolecular CDNs assemblies: (i) The number and nature of base-pairs comprising duplex nucleic acids provides a versatile means to delicately control the stability of equilibrated supramolecular CDN constituents.14 (ii) Many different auxiliary triggers and the respective counter-triggers that stabilize and destabilize duplex nucleic acid

structures,

are

available.15

These

include,

for

example,

fuel/anti-fuel

strand

displacement,16,17 metal-ion bridging bases,18,19 e.g., Ag+-ions and ion-eliminating ligands as counter-triggers (e.g., cysteine), pH,20–22 and light23,24 (e.g., intercalation and removal of transazobenzene and cis-azobenzene photoisomers). These triggers provide general means to control adaptive nucleic acid-based CDNs. (iii) A variety of sequence-specific catalytic nucleic acid scaffolds (DNAzymes) are available, such as the hemin/G-quadruplex peroxidase mimicking


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

DNAzyme25–28 or the metal-ion-dependent DNAzymes.29–31 These catalytic functions of nucleic acid do not only introduce functions into the CDNs, but allow the use of these catalytic reactions of the DNAzymes to provide readout-signatures for the CDNs constituents (e.g., color, fluorescence and chemiluminescence). These properties of nucleic acids allowed the development of the topic of DNA nanotechnology.32–34 Diverse supramolecular DNA structures acting as switches,14 DNA machines,35–37 e.g., tweezers,38–41 walkers,42–48 swings,49 reconfigurable 2D50–52 and 3D nanostructures,53,54 were produced and DNA-based materials with switchable macroscopic properties, such as stimuli-responsive hydrogels55–57 were demonstrated. Different applications of switchable DNA structures were reported,57,58 including their use as sensors, logic gates and computing circuits, stimuli-responsive micro- and nano-carriers for drug release, shape-memory hydrogels, and stimuli-responsive hydrogel actuators/transducers exhibiting programmed mechanical properties. Thus, the rich “tool-box” of structural and functional information encoded in nucleic acid provides versatile means to shift the equilibrium mixtures of different nucleic acid based CDNs, and to readout the contents of the constituents by the catalytic and photophysical properties of the constituents. Recently, we highlighted the feasibility to construct nucleic acid-based CDNs,59 and we introduced means to follow the triggered adaptive-reconfiguration of the CDNs. In the present study we further advance the area of DNA nanotechnology by integrating DNA machines into CDNs. We report on the assembly of CDNs consisting of a mixture of DNA tweezers nanostructures. In the presence of appropriate triggers (fuel/anti-fuel strands, or K+-ions), the open/closed states of the tweezers constituents are controlled. We demonstrate the programmed control on the mechanical and chemical functions of the constituents-associated with the CDNs. In addition to the control of the “mechanical” properties of the CDN, we note that the effector(s)-stimulated shifts of the CDNs yield


Page 4 of 37

Page 5 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

“uncaged” single-stranded tethers coupled to the supramolecular nucleic acid tweezers. These uncaged single-strand tethers add an important functionality into the CDNs assemblies, since they could act as functional units, e.g., aptamer sequences that inhibit target proteins (vide infra). RESULTS AND DISCUSION One CDN system composed of four tweezers is depicted in Figure 2. The system is designed to include an equilibrium of two closed tweezers AA' – state I, BB' – state II and two open tweezers AB' – state III and BA' – state IV. While the pairs of tweezers AA'/BB' and AB'/BA' do not share components in the respective constituents, the peripheral pairs of tweezers of the CDN constituents AA'/AB', AA'/BA', BB'/AB' and BB'/BA' share common components. The tweezer AA' includes as component A the supramolecular structure of the strands (1)/(2)/(3), where strand (2) bridges the arms (1) and (3). The component A' is composed of strand (4), and it bridges the arms (1) and (3) by complementary base-pairing that retains the tweezers in the closed state. (Note the different colors in Figure 2 identify complementary base-pairing domains or define different functions of the constituents, vide infra). The structure in AA' includes the arm (3) and strand (4) domains a and a' (brown) that are guanosine rich. The strand (1) includes a thymidine-rich tether (yellow), b. Also, the bridging unit (2) is functionalized at its 5'- and 3'ends with a fluorophore (Cy5) and a quencher unit (IBRQ), respectively. The constituent BB' is composed of the supramolecular structure comprising the strands (5)/(6)/(7), where the arms (5) and (7) are bridged by the fluorophore (Cy3)/quencher (BHQ-2)-functionalized strand (6), as component B. The tweezer structure is retained in the closed state II by bridging the arms (5) and (7) with the strand (8, component B'). The 5'- and 3'- ends of the strands (7) and (8) include the tethers c and d that corresponds to the Mg2+-dependent DNAzyme subunits. Also, the strand (8) includes the thymidine-rich tether b' (yellow). The structures AB' and BA' include the respective


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

components and are retained in their open configurations state III and state IV, using appropriate hybridization patterns. Note that the bridges (2), in AB' – state III, and (6), in BA' – state IV are modified with the Cy5/quencher and Cy3/quencher units, respectively. The quantitative distribution of the dynamically-equilibrated constituents of the CDN system “K” is probed by: (i) The colorimetric assay of the hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme, generated by the G-rich subunits a and a' associated with AA' in the presence of K+ions and hemin, that leads to the oxidation of ABTS2− by H2O2 to the colored product, ABTS•− (Inset Ⅰ, Figure 2). (ii) The self-assembly of the tethers c and d, associated with BB', in the presence of Mg2+-ions yields the Mg2+-dependent DNAzyme that catalyzes the cleavage of its fluorophore-quencher modified ribonucleobase-containing substrate (Inset Ⅰ, Figure 2). The resulting fluorescence provides then, a means to quantify the concentration of BB'. (iii) The fluorophore Cy5 associated with AA' and AB' provides a cumulative fluorescence value for the two constituents, while the fluorescence of Cy3, associated with BA' and BB' provides a cumulative fluorescence value generated by the two constituents. That is, by extracting the calibration curves of the catalytic activities of intact structures of AA' and BB', as a function of their concentrations, the molar concentrations of these constituents in the CDN can be evaluated. Furthermore, by deriving calibration curves relating the fluorescence intensities of the separated intact structures of the CDN (AA', BB', AB' and BA') as a function of their concentrations, the concentrations of AB' and BA' can be evaluated by subtracting the fluorescence intensities contributed by AA' and BB', as derived from their concentrations of AA' and BB' (calculated through the respective DNAzyme-catalyzed transformations) from the cumulative fluorescence values of Cy5 (AA' + AB') and Cy3 (BB' + BA') and the use of the respective fluorescence calibration curves of AB' and BA', respectively.


Page 6 of 37

Page 7 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

The signal-triggered reconfiguration of the CDN and the transformation of CDN “K” into the CDN “L” is depicted in Figure 2. Subjecting CDN “K” to the effector strand E, (9), results in the formation of the T-A·T triplex units between (9) and the two tethers associated with AB' to yield the constituent AB'TAT. Formation of the triplex stabilizes this constituent and the system adapts to an equilibrium where the concentration of AB'TAT increases and the concentration of the constituent BA' also increases. Conversely, the effector-induced decrease of the concentrations of AA' and BB' is anticipated. Subjecting the CDN “L” to the counter-effector E', (10), results in the displacement of E, (9), the separation of the triplex and the recovery of CDN “K” from CDN “L”. That is, by the cyclic treatment of the CDNs with the effector (9) and counter-effector (10) the CDN can be switched between CDN “L” and “K” states, respectively, demonstrating the control over the mechanical constituents in the systems and their chemical functionalities. (Note that the transition of CDN “K” to CDN “L” was followed after an equilibration time-interval of 12 hours, for further discussion vide infra.) It should be noted that the effector-induced shifts of the equilibrated transitions of the CDNs between states “K” and “L” yield tweezers constituents exhibiting different “mechanically-induced” supramolecular structures of the constituents. For example, the effector E induced the shift of CDN “K” to “L”, results in the increase in the contents of the open tweezers AB' and BA' that include “uncaged” single strands L2 and L3. Such single strands may have future potential applications, as they can be designed to act as aptamers that inhibit target proteins. Figure 3a depicts the time-dependent absorbance change as a result the hemin/G-quadruplexcatalyzed oxidation of ABTS2− by H2O2 to form ABTS•− before subjecting the CDN “K” to the effector E, (i), and after subjecting the CDN “K” to the effector E (transition to CDN “L”), (ii). Similarly, Figure 3b shows the time-dependent fluorescence changes generated by the


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

constituent BB' before treatment with the effector E, (i), and after treatment with the effector E, (ii). Evidently, the catalytic activities associated with constituents AA' (the oxidation of ABTS2− by H2O2 to form ABTS•−) and BB' (the cleavage of the substrate (11) by the Mg2+-ions dependent DNAzyme) in CDN “K” are higher than those in CDN “L”, implying that the concentrations of the closed tweezers are higher in CDN “K” as compared to CDN “L”. Figure 3c depicts the cumulative fluorescence changes of Cy3 and Cy5 before the application of the effector E, curve (i), and after the application of the effector E that transforms CDN “K” into CDN “L”, curve (ii). Evidently, low intensities of the two fluorophores in CDN “K” are observed, while the effector E-induced transition of CDN “K” into “L” yields enhanced fluorescence intensities of the two fluorophores, suggesting quantitative enrichment of the constituents AB' and BA' (where the spatial separation between the fluorophores and the quenchers are increased in the open configurations of these tweezers constituents). Figures S1a and S1b show the calibration curve corresponding to the oxidation of ABTS2− by H2O2 to form ABTS•− by different concentrations of the intact constituent AA'. Figures S1c and S1d depict the calibration curves corresponding to the time-dependent fluorescence changes generated by different concentrations of the constituent BB'. Figure S2 shows the fluorescence intensities and derived calibration curves corresponding to the constituents AA' and BB'. Similarly, Figure S3 shows the calibration curves corresponding to the fluorescence intensities of Cy5 and Cy3 associated with different concentrations of the separate intact constituents AB' and BA'. Table 1 summarizes the contents (concentrations) of the different constituents in the CDNs “K” and “L” (after the application of the effector E), respectively. Evidently, subjecting CDN “K” to the effector E, stabilizes the constituent AB’ resulting in an increase in its content (concentration) in CDN “L” by 263% and the concomitant increase in the concentration of the constituent BA' by


Page 8 of 37

Page 9 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

137%, while the contents of AA' and BB' decreased by 61% and 71%, respectively. Figure S4 summarizes the concentrations of the constituents in CDN “K” and “L” in the form of bars presentation (for further gel electrophoresis experiments examining the different constituents see Figures S5 and S6). The transitions between the CDN “K” and “L” are switchable and the treatment of CDN “L” with the counter-effector, E', (10) regenerates the CDN “K”, while the reverse treatment of the CDN “K” with the effector E, (9), recovers the CDN “L”. Figure S7 depicts the time-dependent catalytic functions of the constituents AA', BB', and the fluorescence features of the systems upon the switchable transition of CDN “K” (i)

CDN “L” (ii)

CDN

“K”, (iii). Figure 4 depicts the switchable effector/counter-effector-stimulated concentrations of the different constituents in the CDNs “K” and “L”. In this experiment, a volume of CDN “K” (450 µL) is prepared, and subjected repeatedly to a concentrated solution of the effector E or counter effector E’ (so that practically, no obvious volume change of the CDNs occurs). In each step of shifting CDN “K” to “L” and back, aliquots of 90 µL are withdrawn from the respective CDN mixtures, and these are used to evaluate the contents of the constituents via the respective DNAzyme and fluorescence/quencher reporter units. Evidently, the contents of the constituents in the two CDNs adapt themselves to the information dictated by the effector/counter-effector: in CDN “K” the constituents AA' and BB' predominate, while in the CDN “L” the constituents AB' and BA' predominate. (For further support of the transition of CDN “K” to CDN “L” by electrophoretic experiments see Figures S5 and S6 and accompanying discussion). It should be noted that the time-interval for the dynamic equilibration of CDN in state K to state L corresponded to twelve hours (see experimental details). This time-interval was selected to ensure the complete equilibrium shift between CDN “K” and “L”. In fact, using shorter timeintervals for the equilibration of the transition of CDN “K” to “L”, e.g., four hours, yielded an


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 37

equilibrium shift of CDN “K” to “L” that corresponded to 85% of the complete equilibration after twelve hours (see Figure S8 and accompanying discussion). It should be noted that the addition of the DNAzyme substrate to the mixture of constituents of CDN “K” has no effect on the contents of the constituents in CDN “K” or on the dynamic equilibration of CDN “K” to “L” (see Figure S9 and accompanying discussion). We note that the addition of K+-ions and hemin to the CDNs in states “K” or “L” to quantitatively report the contents of the constituent AA' via the hemin G-quadruplex catalyzed oxidation of ABTS2− has no effect on the equilibrium of the CDNs within the time-course of the catalytic readout process. We note that the hemin/Gquadruplex catalyzed reaction proceeds on a time-scale of fifteen minutes, whereas the dynamic reconfiguration of the CDN “K” to “L” occurs on a time-scale of hours. The lack of effect of the hemin/G-quadruplex on the equilibrium of CDNs “K” and “L” was proved by following the fluorescence of F1 and F2 of CDNs “K” and “L” before and after a fifteen minutes time interval of the addition of K+-ions and hemin. We find that the fluorescence features of F1 and F2 are unchanged implying that the equilibrated CDNs in states “K” and “L” were not affected by the addition of K+ -ions and hemin. It should be noted that the strands comprising the constituents of the CDNs represent optimized sequence for maximum shifts in the triggered reconfiguration of the CDNs (For a detailed description of the design of the sequences and their optimization see Figure S10, supporting information, and the accompanying discussion). Furthermore, the existence of signal-triggered transitions of equilibrated mixtures between states “K” and “L” implies that free components associated with the CDN constituents are present in the respective solutions. Knowing the initial concentrations of the components and the experimental values of the respective components in the constituent structures, we estimated the contents of the free


Page 11 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

components, and these were used to evaluate the dissociation constant of each of the constituents (For further details see supporting information Table S4, and accompanying discussion). We have further examined the orthogonal control of the dynamic equilibrium of the CDN by the triggered stabilization of the constituents AA' in CDN “K”, in contrast to the stabilization of the constituent AB' by the effector, E, in the previous system. (The term “orthogonal control” aims to describe the triggering of the intersecting opposite pairs of constituents in the mixture of four constituents, Cf. Figure 1.) Toward this end, the CDN “K” was subjected to K+ ions, Figure 5. This results in the formation of the K+-stabilized G-quadruplex between the guanosine tethers a and a' associated with AA'. The stabilization of AA' by formation of the G-quadruplexstabilized structure, AA'-K+ is anticipated to reconfigure CDN “K” into CDN “M”, where the equilibrated mixture is enriched with AA'-K+ and the concomitant enrichment of the constituent BB', while the concentrations of the constituents AB' and BA' decreases. Again, the quantitative evaluation of the concentration of constituent AA' or AA'-K+ is achieved by the hemin/Gquadruplex catalyzed oxidation of ABTS2− by H2O2 to form the colored product ABTS•−, and the concentration of BB' in the two CDNs is probed by the time-dependent fluorescence changes generated by the Mg2+-dependent DNAzyme associated with BB'. The concentrations of AB' and BA' are evaluated by analyzing the cumulative fluorescence features of Cy5 associated with AA' + AB' and of Cy3 associated with BB' + BA'. By subtracting the calculated fluorescence values contributed by AA' and BB', using their catalytically-derived concentrations and the respective fluorescence calibration curves of the separate intact AA' and BB' constituents, the net fluorescence intensities of AB' and BA' were evaluated. By extraction of calibration curves relating the fluorescence features of the intact constituents AB' and BA' as a function of their concentrations, the quantitative evaluation of the concentrations of AB' and BA' in the different


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 37

CDNs was accomplished. Figures S11a and S11b depict the calibration curve corresponding to the catalytic rates for generating ABTS•− by the hemin/G-quadruplex DNAzyme associated with different concentrations of the intact AA' constituent, and Figures S11c and S11d show the calibration curve corresponding to the catalytic rates of the Mg2+-dependent DNAzyme associated with the constituent BB' as a function of the concentration of BB'. Figure S12 depicts the calibration curves corresponding to the fluorescence intensities of the intact constituents AA' and BB' as a function of their concentrations. Figure S13 depicts the calibration curves corresponding to the fluorescence intensities of the intact constituent AB' and constituent BA' as a function of the concentrations of the different constituents. As discussed earlier, the effectorinduced shifts of the contents of the supramolecular constituents may lead to the enrichment of constituents coupled to functional single-strand units. In the system described in Figure 5, the K+-ion-induced enrichment of the constituent AA' includes the coupled single strand L1. This might act as a protein inhibiting aptamer or a silencing DNA. Figure 6a depicts the time-dependent absorbance changes corresponding to the H2O2stimulated oxidation of ABTS2− by H2O2 to form the ABTS•−, by the hemin/G-quadruplex associated with the constituent AA' before the interaction with K+ ions (CDN “K”), (i), and after the interaction with K+ ions (CDN “M”), (ii). Similarly, Figure 6b shows the time-dependent fluorescence changes generated by the Mg2+-dependent DNAzyme associated with constituent BB' before the interaction with K+ ions, (i), and after the interaction with K+ ions, (ii). Evidently, the interaction with K+ ions and the transition of CDN “K” to CDN “M” results in the increase of the closed tweezers constituents AA' and BB', reflected by enhanced catalytic function of the DNAzymes. Figure 6c shows the fluorescence spectra of Cy3 (cumulative fluorescence of BB' and BA') and of Cy5 (cumulative fluorescence of AA' and AB') before the interaction with K+


Page 13 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

ions, curve (i), and after the interaction with K+ ions, curve (ii), respectively. Using the respective calibration curves corresponding to the catalytic rates for the formation of ABTS•− and the cleavage of the substrate (11), by the Mg2+-dependent DNAzyme, Figure S11, that report the concentrations of AA'-K+ and BB', and using the cumulative fluorescence values of the pairs BB' + BA' and AA' + BB', and the respective calibration curves, we evaluated the concentrations of the constituents in CDN “K” and CDN “M”. Table 2 summarizes the concentrations of the constituents. Evidently, the treatment of CDN "K" with K+-ions increases the concentration of AA' and BB' by 34% and 22%, respectively, and the concomitant decrease in the concentrations of the open tweezers, AB' and BA', by 60% and 29% is observed, respectively. It should be noted, however, that the K+-triggered transition of CDN “K” to CDN “M” could not be reversed or cycled. High concentration of 18-crown-6-ether are needed to dissociate the K+-stabilized Gquadruplex, and at this level the equilibrium of all structural constituents is perturbed. For further qualitative evaluation of the concentrations of the constituents of CDN “K” and CDN “M” before and after the interaction with K+-ions by gel electrophoresis, see Figures S5 and S14 and accompanying discussion. An important issue related to the development of the different CDNs rests on the reproducibility to regenerate the stated equilibrated mixtures. We find that the deviation in the results, in a set of three experiments, is < 6%, e.g., Figure 6(a), 6(b) and 6(c), insets. (For detailed experimental results demonstrating the reproducibility of the systems see Figure S15 and accompanying discussion). It should be noted that previous studies have reported on the assembly of multi-tweezers systems. For example, a mixture of three independent triggers was used to develop a finite state automata with a finite memory.60 Also, mixtures of two tweezers were reported to act as SETRESET logic systems.39,40 Nonetheless, these systems differ in their functionalities as compared


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 37

to the present four tweezer CDNs. In the reported three tweezer systems,60 the open/close structure of the tweezers do not affect or communicate with the other tweezers, whereas in the present systems the structural changes in one of the tweezers is reflected in the structure and functions of the other tweezers. Similarly, the SET-RESET, two-tweezers systems,39,40 represent mixtures of two components (not a network) that are triggered only across two states that are composed of two tweezers structures. In addition, we note that substantial research efforts are directed to develop bioinspired chemical networks, and it is important to highlight the differences between the reported systems and the present tweezers CDNs, while emphasizing the features and advantages of nucleic acidbased CDNs. For example, Ghadiri’s seminal studies,61–63 followed by Ashkenasy,64,65 reported on template-directed synthetic networks consisting of interacting molecules that lead to autocatalytic or cross-catalytic self-replicating systems that generate the products (e.g., peptides). Although some conceptual similarities between these systems and the present tweezers CDNs systems exist, one should note the differences between the nature and functions of the networks. While in the reported systems the equilibrated templates provide information transfer for downstream autocatalysis or cross-catalysis by binary network interactions, the tweezers CDNs system represent an integrated four-constituent dynamic system that is triggered by auxiliary stimuli. This DNA-based dynamic network exhibits the capability to be integrated in subsequent downstream network functionalities (vide infra). In addition, we note that the programmed sequenceguided duplex formation, and strand displacement of nucleic acids were extensively used to develop dynamic DNA-based networks operating as logic gates and computing circuits.66 Nonetheless, these nucleic acid networks are driven by different input-guided structural transitions without inter-communication between the constituents, as in the present CDNs.


Page 15 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

The special features of nucleic acid-based CDNs should be, however, emphasized and the future utility of these functions should be addressed. The many auxiliary triggers to reversibly reconfigure nucleic acid structures (e.g., strand displacement,16,17 G-quadruplexes formation and dissociation,27 triplex-formation,20–22 aptamer-ligand complexes,67 light,23,24 and more) provide an arsenal of stimuli to operate CDN systems. The present study has highlighted the challenges to construct and to optimize the complex nucleic acid constituents, and it introduced guiding principles for the assembly of the constitutional structures. These principles can be adapted to develop many other DNA-based CDNs, and thus a versatile methodology to assemble CDNs is introduced. Beyond the ability to reversibly trigger the CDNs by different auxiliary stimuli, the DNA-based CDNs reveal further important features. In the present systems, we conjugated to the constituents the Mg2+-ion dependent DNAzyme or the hemin G-quadruplex as catalytic reporter for the constituents composition in the different networks. One might use, however, these catalytic functions as a means to expand the networks to other motifs of enhanced complexity, and eventually to couple the CDNs to down-stream events. For example, by the coupling of ribonucleobase-modified hairpin nucleic acid structures, as a substrate for the Mg2+-dependent DNAzyme, the catalyzed cleavage of the substrate would generate two fragmented strands that provide functional “information transfer” sequences for other networks or cascade events. That is, the CDN-induced cleavage of the hairpin substrate could be applied to inter-communicate different CDNs, or to operate feedback-driven and oscillatory CDNs. Alternatively, the CDNsdriven release of specific strands might be used to control gene expression or dictate miRNA transcription and subsequent protein translation processes.


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 37

CONCLUSIONS The present study has demonstrated that the information encoded in supramolecular nucleic acid nanostructures can be used to develop constitutional dynamic networks. Such bioinspired CDNs emulate biological networks68 and add important dimensions to the field of systems chemistry.69 Specifically, we constructed a network composed of two closed tweezers and two open tweezers. In the presence of external triggers, e.g., a fuel strand or K+-ions, orthogonal equilibrated reconfiguration of the tweezers was demonstrated. Namely, by applying the different triggers the “mechanical” properties of the different constituents could be controlled by dictating the concentrations of the constituents in the different networks. The study has highlighted the following important conclusions: (i) The base sequence of nucleic acids, and the diversity of structures formed by the nucleic acids provide a rich “tool-box” to control the concentrations of the constituents in the equilibrated networks. (ii) The networks respond to the external triggers and adapt themselves to the instructive information introduced by the triggers. (iii) The triggered control over the concentrations of the constituents in the different networks revealed the translation of chemical equilibria into mechanical properties of the tweezers. (iv) One of the CDN systems demonstrated reversible reconfiguration properties in the presence of fuel/anti-fuel strands. (v) The catalytic functions of the CDN systems provided a useful means to follow the CDNs. (vi) Besides broadening the concept of CDNs59 by introducing dynamic shifts in the equilibrated mixtures of “mechanically-responsive” tweezers constituents, we have emphasized the potential advantages of these structures for future applications. Specifically, we note that the dynamic equilibration of the different CDNs, that included supramolecular constituents of enhanced complexities, enable the uncaging of constituent-coupled sequencespecific functional single strands that may act as protein inhibiting aptamer or silencing DNA.


Page 17 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

(vii) Furthermore, the study demonstrated the effector-induced up-regulation and downregulation of “mechanical” open or closed supramolecular tweezers. One might realize that by the tethering of sequence-specific aptamer subunits, as functional arms to the “open” tweezers, the up-regulated closure of the tweezer might “grab” specific ingredients from the bulk environment through the formation of aptamer-ligand complexes. In addition, the implications of the study rest on the possible applications of input-guided CDNs assemblies for sensing, logic gate operations and programmed activation of molecular machines. EXPERIMENTAL SECTION Materials. 2-[4-(2-Hydroxyethyl)piperazin-1-yl]ethanesulfonic acid sodium salt (HEPES), 2, 2'azinobis-(3-ethylbenzthiazoline-6-sulfonate) (ABTS2−), sodium chloride, magnesium chloride and potassium chloride were purchased from Sigma-Aldrich. DNA oligonucleotides were purchased from Integrated DNA Technologies Inc. (Coralville, IA). Hydrogen peroxide solution was purchased from Fluka. Hemin was purchased from Porphyrin Products (Logan, UT). Tris– borate–EDTA (TBE) buffer solution was purchased from Biological Industries Israel BEIT HAEMEK LTD. (Kibutz Beit-Haemek, Israel). “SYBR Gold nucleic acid gel stain” was purchased from Invitrogen. Ultrapure water from NANOpure Diamond (Barnstead) source was used in all of the experiments. The chemicals used in the study are detailed in the supporting information. The oligonucleic acid sequences used in the study include: (1) 5'–CATGATGGTTACAAGGTACGTCAACAA CCACAAACAGATTCTTTTCTTTCTTT–3', (2) 5'–Cy5-GTACCTTGTAACCATCATGAAAAC TCCAGAGACCAAGACGAC-Iowa Black® RQ–3', (3) 5'–GGGGATAGGGGTTAACAGCGA TGTCGTCTTGGTCTCTGGAG–3', (4) 5'–GTTGTTGACATCGCTGTATTGGGGTAAGGG G–3', (5) 5'–GGTTCGCTCTTACAAGGACGTCAAACAG–3', (6) 5'-Cy3-GTCCTTGTAAGA


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 37

GCGAACCTTTTCAAGTGGAATGTCTCGAAG-BHQ2–3', (7) 5'–GATATCAGCGATCACA ACAACCTTCGAGACATTCCACTTG–3', (8) 5'–TTTCTTTCTTTTCTTACTGTTTGACGTTG TTGTGCACCCATGTTACTCT–3', (8a) 5'–TTTCTTTCTTTTCTTTCTGTTTGACGTTGTTGT GCACCCATGTTACTCT–3', (9) 5'–AAGAAAAGAAAGAAATCATCAAGTAGT–3', (10) 5'– ACTACTTGATGATTTCTTTCTTTTCTT–3', (11) 5'–FAM-AGAGTATrAGGATATC-BHQ1– 3', (11a) 5'–AGAGTATrAGGATATC–3', (12) 5'–GGGGATAGGGGTTAACAGCGATGTCGT CTTGGTCTCTGGAGATATGT ATAGTAGTT–3'. The ribonucleobase cleavage site, rA, in the substrate of the Mg2+-dependent DNAzyme is indicated in bold, the G-quadruplex sequences are underlined, and the triplex domains associated with the different structures are presented in italic. Fluorescence and UV/Vis measurements. Fluorescence spectra were recorded with a Cary Eclipse Fluorometer (Varian Inc.). Absorbance spectra were recorded with a Shimadzu UV-2401PC UV/Vis spectrophotometer. The gels were run on a Hoefer SE 600 electrophoresis unit. The excitation of FAM, Cy3 and Cy5 were performed at 496, 550 and 648 nm, respectively. The emission of FAM was recorded at 520 nm. The activity of the hemin/G-quadruplex DNAzyme was followed spectroscopically by the DNAzyme-catalyzed oxidation of ABTS2− to the colored product ABTS•−, λ = 414 nm. Preparation of CDN “K”. The CDN “K” shown in Figure 2, which includes the constituents AA'-state I, BB'-state II, AB'state III and BA'-state-IV, was prepared by the initial assembly of the (1)/(2)/(3) (component A) and (5)/(6)/(7) (component B) duplexes. (2) and (6) was hybridized with (1)/(3) and (5)/(7), 4 µM each, respectively, in a HEPES buffer solution (10 mM HEPES, 20 mM MgCl2 and pH = 7.2). Hybridization was carried out by the initial annealing of the respective mixtures at 80 Ⅰ for 5 minutes, followed by cooling to 25 Ⅰ at the rate of 0.46 Ⅰ minute−1, and allowed to equilibrate


Page 19 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

for 2 hours at 25 Ⅰ. Subsequently, a mixture of A, B, A' (4) and B' (8), 1 µM each, in a HEPES buffer solution (10 mM HEPES, 20 mM MgCl2 and pH = 7.2), was annealed at 50 Ⅰ for 5 minutes, cooled down to 25 Ⅰ at a rate of 0.42 Ⅰ minute−1, and allowed to equilibrate for 2 hours at 25 Ⅰ, to yield the mixture of the AA', AB', BA' and BB' constituents of the CDN “K”. Probing the catalytic functions and fluorescence features of the constituents in the CDNs. In the typical experiments, the equilibrated mixture of AA', AB', BA' and BB', CDN “K”, 60 µL, was treated with the substrate (11), 1.8 µL, 100 µM. Subsequently, the time-dependent fluorescence change generated from the cleavage of substrate (11) by the Mg2+ dependent DNAzyme associated with the constituent BB' were followed. And the equilibrated mixture of AA', AB', BA' and BB' was incubated with hemin and K+, 2 µM and 50 mM, respectively, for 15 minutes. After incubation, the solution (30 µL) was diluted with HEPES buffer (10 mM HEPES, 20 mM MgCl2 and 50 mM KCl) to a total volume of 150 µL, and mixed with ABTS2− (2 mM) and H2O2 (5 mM) to allow the oxidation of ABTS2− by H2O2 to ABTS•−. The catalytic activities of AA' were probed by following the time-dependent absorbance changes (as a result of the catalyzed oxidation of ABTS2− by H2O2 to ABTS•−). The fluorescence features of the constituents AA'/AB' (Cy5), BA'/BB' (Cy3) in the CDNs were monitored. Using the appropriate calibration curves corresponding to the catalytic activities of the intact constituents AA' and BB', and the fluorescence intensities (Cy3 and Cy5) by different concentrations of the intact constituents (see detailed description in Figures S1−S3), and the contents of the constituents in the different CDNs were evaluated. Orthogonal operation of CDN “K” to CDN “L” (Figure 2) or “M” (Figure 5). For the transition of CDN “K” to CDN “L” or “M”, the mixture of AA', AB', BA' and BB', was subjected to the effectors E, 1 µM, or K+, 50 mM, allowed to equilibrate at 35 Ⅰ for a time-


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

interval of 12 hours, and then was treated with the substrate (11), 1.8 µL 100 µM, to yield the CDNs “L” or “M”, respectively. Subsequently, the catalytic activities and fluorescence features of constituents in CDNs were characterized. Note that, for the transition of CDN “K” to CDN “M”, to avoid the influence of the K+-ions to the catalytic activities and fluorescence features of constituents, the initial CDN “K” was also treated with K+ ions, 50 mM, all the measurements were conducted immediately, and these results were compared to those in CDN “M”. For the reverse transformation between CDN “K” and CDN “L”: the CDN “L”, without the substrates (11), were treated with the counter-effector E' (10), 1 µM, allowed to equilibrate at 35 Ⅰ for a time-interval of 12 hours, and then was subjecting to the substrate (11), 1.8 µL, 100 µM, subsequently all the measurements were conducted.


Page 20 of 37

Page 21 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Figure 1. Trigger-guided reversible switching of dynamic constitutional networks consisting of four exchangeable constituents. T1/ T1' and T2/ T2' represent two orthogonal triggers and countertriggers.


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 37

Figure 2. Switchable control of the open/closed tweezers constituents in two CDNs, “K” and “L”, using nucleic acid strands E as effector, and E' as counter-effector. The effector E-induced stabilization of the constituent AB' in CDN “K” forms the T-A·T stabilized constituent AB'TAT leading to CDN “L”. Treatment of CDN “L” with the counter-trigger E' separates the AB'TAT constituent by the formation of the E/E' duplex, a process that regenerates CDN “K”. The quantitative evaluation of the contents of the constituents of CDNs “K” and “L” is followed by the catalytic functions of the constituents AA' and BB' and the fluorescence features of the tweezers AA' and AB' labeled with fluorophore (Cy5, F1)/quencher (IBRQ, Q1) labels and of BA' and BB' labeled with fluorophore (Cy3, F2)/quencher (BHQ 2, Q2) labels. The catalytic functions of tweezers AA' are followed by the hemin/G-quadruplex catalyzed oxidation of ABTS2− by H2O2 to form ABTS•−, panel Ⅰ. The catalytic functions of BB' are followed by the catalytic cleavage of a fluorophore-quencher modified substrate by the Mg2+-dependent DNAzyme associated with the constituent, panel Ⅰ.


Page 23 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Figure 3. Probing the dynamic transitions of CDN “K” to CDN “L”: (a) Time-dependent absorbance changes resulting in upon the hemin/G-quadruplex-catalyzed oxidation of ABTS2− by H2O2 to form ABTS•− by: (i) The AA' constituent in CDN “K”. (ii) The AA' constituent in CDN “L” after treatment CDN “K” with the effector E. (b) Time-dependent fluorescence changes generated by BB' upon the cleavage of the substrate (11) by the Mg2+-dependent DNAzyme: (i) The BB' constituent in CDN “K”. (ii) The BB' constituent in CDN “L” generated


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

by subjecting CDN “K” to E. (c) Fluorescence spectra corresponding to the fluorescence of: Panel I – The mixture of constituents BA' + BB' in: (i) CDN “K” (ii) CDN “L” after subjecting CDN “K” to the effector E. Panel II – The mixture AA' + AB' (or AB'TAT) in: (i) CDN “K” (ii) CDN “L” after treatment of CDN “K” with effector E.


Page 24 of 37

Page 25 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Table 1. Concentrations of the constituents associated with the dynamic networks displayed in Figure 2. CDN state

[AA']/µM

[BB']/µM

[AB']/µM

[BA']/µM

“K”

0.71 ± 0.03

0.59 ± 0.02

0.16 ± 0.01

0.38 ± 0.01

“L”

0.28 ± 0.01

0.17 ± 0.01

0.58 ± 0.01

0.90 ± 0.02

Figure 4. The concentrations of the constituents associated with the CDNs shown in Figure 2 (in the form of a bar presentation) upon the switchable reconfiguration between states “K” and “L”. State “L” is generated by treatment of the initial state or any “K” state with the effector E, 1 µM. State “K” is generated by subjecting state “L” to the counter-effector E', 1 µM. The reconfiguration of the CDNs is probed by quantitative evaluation of the content of the constituents by the catalytic and fluorescence features of the constituents, and by using appropriate calibration curves, Figures S1−S3.


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 37

Figure 5. Control of the constituents of CDNs by the effector-induced formation of Gquadruplex using K+ ions as effector. Inset Ⅰ: Schematic hemin/G-quadruplex-catalyzed oxidation of ABTS2− by H2O2 to yield the colored ABTS•− (ABTS2− = 2, 2'-azinobis-(3ethylbenzthiazoline-6-sulfonate)). Inset Ⅰ: Schematic readout of the catalytic constituent BB' by the Mg2+-ion-dependent DNAzyme units. CDN “K” and “M” indicate the structures of the constituents in the CDNs before and after subjecting the system to the input K+ ions.


Page 27 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Figure 6. Probing the dynamic transitions of CDN “K” to CDN “M”. (a) Time-dependent absorbance changes associated with the hemin/G-quadruplex catalyzed oxidation of ABTS2− by H2O2 to form ABTS•− where (i) corresponds to CDN “K” and (ii) corresponds to CDN “M” (after the interaction of CDN “K” with K+ ions). (b) Time-dependent fluorescence changes observed upon the Mg2+-dependent catalyzed cleavage of the substrate (11) where (i) corresponds to CDN “K” and (ii) corresponds to CDN “M” (after the interaction of CDN “K” 27 Environment ACS Paragon Plus

ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 37

with K+ ions). (c) Fluorescence spectra associated with the K+-ion-triggered transition of CDN “K” to CDN “M”. Panel I – Fluorescence spectra of BA' + BB'. Panel II – Fluorescence spectra of AB' + AA' (or AA'-K+). For the two panels: fluorescence spectra (i) CDN “K” and (ii) CDN “L” after the interaction of CDN “K” with K+ ions. The insets in the different panels provide error bars for the experimental results of N = 3 experiments to highlight that the systems reveal high reproducibility with < 6% experimental deviations (see, also, Figure S15, supporting information).

Table 2. Concentrations of the constituents associated with the dynamic networks displayed in Figure 5.

a

CDN state

[AA']/µM

[BB']/µM

[AB']/µM

[BA']/µM

“K”a

0.71 ± 0.03

0.59 ± 0.03

0.35 ± 0.02

0.35 ± 0.01

“M”

0.96 ± 0.02

0.72 ± 0.02

0.14 ± 0.01

0.25 ± 0.01

To avoid the influence of K+ ions on the catalytic and fluorescence features of constituents in

CDNs, for the transition of CDN “K” to CDN “M”, the CDN “K” was subjected to K+ ions (50 mM) and immediately probed by quantitative evaluation of the content of the constituents by the catalytic and fluorescence features generated by constituents and using appropriate calibration curves (with K+ ions 50 mM).


Page 29 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

ASSOCIATED CONTENT The authors declare no competing financial interest Supporting Information. Calibration curves, the native PAGE gel electrophoresis results and discussion of the CDNs, and additional results. AUTHOR INFORMATION Corresponding Author *E-mail: [email protected] Author Contributions L.Y. and S.W. designed the systems, performed the experiment, analysis the results and participated in the formulation of the paper. A.C. participated in the design of the systems and the formulation of the paper. J.-M.L followed the progress of the project and participated in the formulation of the paper. I.W. led the project and participated in the formulation of the paper. ACKNOWLEDGMENT This study is partially supported by The Minerva Center for Complex Biohybrid Systems. REFERENCES 1. Jaenisch, R.; Bird, A. Epigenetic Regulation of Gene Expression: How the Genome Integrates Intrinsic and Environmental Signals. Nat. Genet. 2003, 33, 245−254. 2. Barabási, A. L.; Oltvai, Z. N. Network Biology: Understanding the Cell's Functional Organization. Nat. Rev. Genet. 2004, 5, 101−113. 3. Davidson, E.; Levin, M. Gene Regulatory Networks. Proc. Natl. Acad. Sci. U. S. A. 2005,


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 30 of 37

102, 4935−4942. 4. Vogel, C.; Marcotte, E. M. Insights into the Regulation of Protein Abundance from Proteomic and Transcriptomic Analyses. Nat. Rev. Genet. 2012, 13, 227−232. 5. Rowan, S. J.; Cantrill, S. J.; Cousins, G. R.; Sanders, J. K.; Stoddart, J. F. Dynamic Covalent Chemistry. Angew. Chem., Int. Ed. 2002, 41, 898−952. 6. Corbett, P. T.; Leclaire, J.; Vial, L.; West, K. R.; Wietor, J.-L.; Sanders, J. K. M.; Otto, S. Dynamic Combinatorial Chemistry. Chem. Rev. 2006, 106, 3652−3711. 7. Belowich, M. E.; Stoddart, J. F. Dynamic Imine Chemistry. Chem. Soc. Rev. 2012, 41, 2003−2024. 8. Roche, C.; Percec, V. Complex Adaptable Systems Based on Self-assembling Dendrimers and Dendrons: toward Dynamic Materials. Isr. J. Chem. 2013, 53, 30−44. 9. Ghosh, S.; Mukhopadhyay, P.; Isaacs, L. Deconvolution of a Multi-Component Interaction Network Using Systems Chemistry. J. Syst. Chem. 2010, 1, 1−6. 10. Lehn, J.-M. Constitutional Dynamic Chemistry: Bridge from Supramolecular Chemistry to Adaptive Chemistry. Top. Curr. Chem. 2012, 322, 1−32. 11. Vantomme, G.; Jiang, S.; Lehn, J.-M. Adaptation in Constitutional Dynamic Libraries and Networks, Switching between Orthogonal Metalloselection and Photoselection Processes. J. Am. Chem. Soc. 2014, 136, 9509−9518. 12. Giuseppone, N.; Schmitt, J.-L; Lehn, J.-M. Generation of Dynamic Constitutional Diversity and Driven Evolution in Helical Molecular Strands under Lewis Acid Catalyzed Component Exchange. Angew. Chem., Int. Ed. 2004, 43, 4902−4906. 13. Kovaříček, P.; Lehn, J.-M. Merging Constitutional and Motional Covalent Dynamics in Reversible Imine Formation and Exchange Processes. J. Am. Chem. Soc. 2012, 134, 9446−9455.


Page 31 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

14. Soloveichik, D.; Seelig, G.; Winfree, E. DNA as a Universal Substrate for Chemical Kinetics. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 5393−5398. 15. Wang, F.; Liu, X.; Willner, I. DNA Switches: from Principles to Applications. Angew. Chem., Int. Ed. 2015, 54, 1098−1129. 16. Yurke, B.; Mills, A. P. Using DNA to Power Nanostructures. Genet. Program. Evol. M. 2003, 4, 111–122. 17. Zhang, D. Y.; Seelig, G. Dynamic DNA Nanotechnology Using Strand Displacement Reactions. Nat. Chem. 2011, 3, 103−113. 18. Miyake, Y.; Togashi, H.; Tashiro, M.; Yamaguchi, H.; Oda, S.; Kudo, M.; Tanaka, Y.; Kondo, Y.; Sawa, R.; Fujimoto, T.; Machinami, T.; Ono, A. MercuryII-Mediated Formation of Thymine−HgII−Thymine Base Pairs in DNA Duplexes. J. Am. Chem. Soc. 2006, 128, 2172−2173. 19. Park, K. S.; Jung, C.; Park, H. G. “Illusionary” Polymerase Activity Triggered by Metal Ions: Use for Molecular Logic-Gate Operations. Angew. Chem., Int. Ed. 2010, 49, 9757−9760. 20. Häner, R.; Dervan, P. B. Single-Strand DNA Triple-Helix Formation. Biochemistry 1990, 29, 9761−9765. 21. Soto, A. M.; Loo, J.; Marky, L. A. Energetic Contributions for the Formation of TAT/TAT, TAT/CGC+, and CGC+/CGC+ Base Triplet Stacks. J. Am. Chem. Soc. 2002, 124, 14355−14363. 22. Chen, Y.; Lee, S.-H.; Mao, C. A DNA Nanomachine Based on a Duplex–Triplex Transition. Angew. Chem., Int. Ed. 2004, 43, 5335−5338. 23. Asanuma, H.; Liang, X.; Yoshida, T.; Komiyama, M. Photocontrol of DNA Duplex Formation by Using Azobenzene-Bearing Oligonucleotides. ChemBioChem 2001, 2, 39−44.


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 37

24. Phillips, J. A.; Liu, H.; O’Donoghue, M. B.; Xiong, X.; Wang, R.; You, M.; Sefah, K.; Tan, W. Using Azobenzene Incorporated DNA Aptamers to Probe Molecular Binding Interactions. Bioconjug. Chem. 2011, 22, 282−288. 25. Travascio, P.; Li, Y.; Sen, D. DNA-Enhanced Peroxidase Activity of a DNA AptamerHemin Complex. Chem. Biol. 1998, 5, 505−517. 26. Travascio, P.; Bennet, A. J.; Wang, D. Y.; Sen. D. A Ribozyme and a Catalytic DNA with Peroxidase Activity: Active Sites versus Cofactor-Binding Sites. Chem. Biol. 1999, 6, 779−787. 27. Xiao, Y.; Pavlov, V.; Niazov, T.; Dishon, A.; Kotler, M.; Willner, I. Catalytic Beacons for the Detection of DNA and Telomerase Activity. J. Am. Chem. Soc. 2004, 126, 7430−7431. 28. Pavlov, V.; Xiao, Y.; Gill, R.; Dishon, A.; Kotler, M.; Willner, I. Amplified Chemiluminescence Surface Detection of DNA and Telomerase Activity Using Catalytic Nucleic Acid Labels. Anal. Chem. 2004, 76, 2152−2156. 29. Breaker, R. R.; Joyce, G. F. A DNA Enzyme That Cleaves RNA. Chem. Biol. 1994, 1, 223−229. 30. Joyce, G. F. Forty Years of In Vitro Evolution. Angew. Chem., Int. Ed. 2007, 46, 6420−6436. 31. Famulok, M.; Hartig, J. S.; Mayer, G. Functional Aptamers and Aptazymes in Biotechnology, Diagnostics, and Therapy. Chem. Rev. 2007, 107, 3715−3743. 32. Seeman, N. C. DNA Nanotechnology: Novel DNA Constructions. Annu. Rev. Biophys. Biomol. Struct. 1998, 27, 225−248. 33. Seeman, N. C. An Overview of Structural DNA Nanotechnology. Mol. Biotechnol. 2007, 37, 246−257. 34. Lu, C.-H.; Willner, B.; Willner, I. DNA Nanotechnology: from Sensing and DNA


Page 33 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Machines to Drug-Delivery Systems. ACS Nano 2013, 7, 8320−8332. 35. Bath, J.; Turberfield, A. J. DNA Nanomachines. Nat. Biotechnol. 2007, 2, 275−284. 36. Teller, C.; Willner, I. Functional Nucleic Acid Nanostructures and DNA Machines. Curr. Opin. Biotechnol. 2010, 21, 376−391. 37. Seeman, N. C. From Genes to Machines: DNA Nanomechanical Devices. Trends Biochem. Sci. 2005, 30, 119−125. 38. Yurke, B.; Turberfield, A. J.; Mills, A. P.; Jr, Simmel, F. C.; Neumann, J. L. A DNAFuelled Molecular Machine Made of DNA. Nature 2000, 406, 605–608. 39. Elbaz, J.; Wang, Z. G.; Orbach, R.; Willner, I. pH-Stimulated Concurrent Mechanical Activation of Two DNA “Tweezers”. a “SET-RESET” Logic Gate System. Nano Lett. 2009, 9, 4510–4514. 40. Elbaz, J.; Moshe, M.; Willner, I. Coherent Activation of DNA Tweezers: a “SET–RESET” Logic System. Angew. Chem., Int. Ed. 2009, 48, 3834–3837. 41. Chhabra, R.; Sharma, J.; Liu, Y.; Yan, H. Addressable Molecular Tweezers for DNATemplated Coupling Reactions. Nano Lett. 2006, 6, 978–983. 42. Omabegho, T.; Sha, R.; Seeman, N. C. A bipedal DNA Brownian Motor with Coordinated Legs. Science 2009, 324, 67–71. 43. Wang, Z. G.; Elbaz, J.; Willner, I. DNA Machines: Bipedal Walker and Stepper. Nano Lett. 2011, 11, 304–309. 44. You, M.; Chen, Y.; Zhang, X.; Liu, H.; Wang, R.; Wang, K.; Williams, K. R.; Tan, W. An Autonomous and Controllable Light-Driven DNA Walking Device. Angew. Chem., Int. Ed. 2012, 51, 2457–2460. 45. Yin, P.; Yan, H.; Daniell, X. G.; Turberfield, A. J.; Reif, J. H. A Unidirectional DNA


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 34 of 37

Walker That Moves Autonomously along a Track. Angew. Chem., Int. Ed. 2004, 43, 4906–4911. 46. Wickham, S. F.; Bath, J.; Katsuda, Y.;Endo, M.; Hidaka, K.; Sugiyama, H.; Turberfield, A. J. A DNA-Based Molecular Motor That Can Navigate a Network of Tracks. Nat. Nanotechnol. 2011, 6, 166–173. 47. Liu, X.; Niazov-Elkan, A.; Wang, F.; Willner, I. Switching Photonic and Electrochemical Functions of a DNAzyme by DNA Machines. Nano Lett. 2013, 13, 219–225. 48. Qu, X.; Zhu, D.; Yao, G.; Su, S.; Chao, J.; Liu, H.; Zuo, X.; Wang, L.; Shi, J.; Wang, L.; Huang, W.; Pei, H.; Fan, C. An Exonuclease III-Powered, on-Particle Stochastic DNA Walker. Angew. Chem., Int. Ed. 2017, 56, 1855–1858. 49. Nishioka, H.; Liang, X.; Kato, T.; Asanuma, H. A Photon-Fueled DNA Nanodevice That Contains Two Different Photoswitches. Angew. Chem., Int. Ed. 2012, 51, 1165–1168. 50. Wu, N.; Willner, I. pH-Stimulated Reconfiguration and Structural Isomerization of Origami Dimer and Trimer Systems. Nano Lett. 2016, 16, 6650–6655. 51. Han, D.; Huang, J.; Zhu, Z.; Yuan, Q.; You, M.; Chen, Y.; Tan, W. Molecular Engineering of Photoresponsive Three-Dimensional DNA Nanostructures. Chem. Commun. 2011, 47, 4670– 4672. 52. Rajendran, A.; Endo, M.; Katsuda, Y.; Hidaka, K.; Sugiyama, H. Programmed TwoDimensional Self-Assembly of Multiple DNA Origami Jigsaw Pieces. ACS Nano 2011, 5, 665– 671. 53. Sharma, J.; Chhabra, R.; Yan, H.; Liu, Y. pH-Driven Conformational Switch of ‘‘i-Motif’’ DNA for the Reversible Assembly of Gold Nanoparticles. Chem. Commun. 2007, 477–479. 54. Hu, L.; Liu, X.; Cecconello, A.; Willner, I. Dual Switchable CRET-Induced Luminescence of CdSe/ZnS Quantum Dots (QDs) by the Hemin/G-Quadruplex-Bridged Aggregation and


Page 35 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

Deaggregation of Two-Sized QDs. Nano Lett. 2014, 14, 6030–6035. 55. Guo, W.; Qi, X.-J.; Orbach, R.; Lu, C.-H.; Freage, L.; Mironi-Harpaz, I.; Seliktar, D.; Yang, H.-H.; Willner, I. Reversible Ag+-Crosslinked DNA Hydrogels. Chem. Commun. 2014, 50, 4065−4068. 56. Lu, C.-H.; Q, X.-J.; Orbach, R.; Yang, H.-H.; Mironi-Harpaz, I.; Seliktar, D.; Willner, I. Switchable Catalytic Acrylamide Hydrogels Cross-Linked by Hemin/G-Quadruplexes. Nano Lett. 2013, 13, 1298−1302. 57. Kahn, J. S.; Hu, Y.; Willner, I. Stimuli-Responsive DNA-Based Hydrogels: from Basic Principles to Applications. Acc. Chem. Res. 2017, 50, 680−690. 58. Wang, F.; Lu, C.-H.; Willner, I. From Cascaded Catalytic Nucleic Acids to Enzyme–DNA Nanostructures: Controlling Reactivity, Sensing, Logic Operations, and Assembly of Complex Structures. Chem. Rev. 2014, 114 2881–2941. 59. Wang, S.; Yue, L.; Shpilt, Z.; Cecconello, A.; Kahn, J. S.; Lehn, J.-M.; Willner, I. Controlling the Catalytic Functions of DNAzymes within Constitutional Dynamic Networks of DNA Nanostructures. J. Am. Chem. Soc. 2017, 139, 9662−9671. 60. Wang, Z.-G.; Elbaza, J.; Remacleb, F.; Levinea, R. D.; Willner, I. All-DNA Finite-State Automata with Finite Memory. Proc. Natl. Acad. Sci. U. S. A. 2010 107, 21996−22001. 61. Lee, D. H.; Severin, K.; Yokobayashi, Y.; Ghadiri, M. R. Emergence of Symbiosis in Peptide Self-Replication through a Hypercyclic Network. Nature 1997, 390, 591–594. 62. Ashkenasy, G.; Jagasia, R.; Yadav, M.; Ghadiri, M. R. Design of a Directed Molecular Network. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 10872−10877. 63. Ashkenasy, G.; Ghadiri, M. R. Boolean Logic Functions of a Synthetic Peptide Network. J. Am. Chem. Soc. 2004, 126, 11140−11141.


ACS Nano

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 36 of 37

64. Dadon, Z.; Wagner, N.; Ashkenasy, G. The Road to Non-Enzymatic Molecular Networks. Angew. Chem., Int. Ed. 2008, 47, 6128−6136. 65. Wagner, N.; Mukherjee, R.; Maity, I.; Peacock-Lopez, E.; Ashkenasy, G. Bistability and Bifurcation in Minimal Self-Replication and Nonenzymatic Catalytic Networks. ChemPhysChem 2017, 18, 1842−1850. 66. G.; Seelig, Soloveichik, D.; Zhang, D. Y.; Winfree, E. Enzyme-Free Nucleic Acid Logic Circuits. Science 2006, 314, 1585−1588. 67. Osborne, S. E.; Matsumura, I.; Ellington, A. D. Aptamers as Therapeutic and Diagnostic Reagents: Problems and Prospects. Curr. Opin. Chem. Biol. 1997, 1, 5−9. 68. U. Alon, Network Motifs: Theory and Experimental Approaches. Nat. Rev. Genet. 2007, 8, 450−46. 69. U. Alon, An Introduction to Systems Biology: Design Principles of Biological Circuits, CRC, Boca Raton, 2006.


Page 37 of 37

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Nano

TOC graphic


Orthogonal Operation of Constitutional Dynamic Networks

Recommend Documents