Paper-Based Strips for the Electrochemical Detection of Single and

Subscriber access provided by UNIV OF LOUISIANA

Article

Paper-Based Strips for the Electrochemical Detection of Single and Double Stranded DNA Stefano Cinti, Elena Proietti, Federica Casotto, Danila Moscone, and Fabiana Arduini Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b04052 • Publication Date (Web): 19 Oct 2018 Downloaded from http://pubs.acs.org on October 20, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Paper-Based Strips for the Electrochemical Detection of Single and Double Stranded DNA Stefano Cinti,* Elena Proietti, Federica Casotto, Danila Moscone, and Fabiana Arduini. Department of Chemical Science and Technologies, University of Rome “Tor Vergata”, Via della Ricerca Scientifica 1, 00133 Rome, Italy. *Corresponding

author: Stefano Cinti, E-mail: [email protected], Tel: +39 0672594411

ABSTRACT: The detection of double stranded DNA (dsDNA) is often associated with the use of laboratory-bound approaches and/or with the prior generation of the single stranded DNA (ssDNA), making these methods not suitable for in-situ monitoring, i.e. point-of-care diagnostics. Screen-printed technology, coupled to the use of triplex forming oligonucleotides (TFO) as the recognizing probes, offers a great possibility towards the development of portable analytical tools. Moreover, the continuous demand for sustainable processes and waste lowering have highlighted the role of paper-based substrates for manufacturing easyto-use, low-cost, and sustainable electrochemical devices. In this work, filter paper and copy paper have been utilized to produce EDNA strips. Gold nanoparticles (AuNPs) have been exploited to immobilize the Methylene Blue (MB)-tagged TFO and to enhance the charge transfer kinetics at the electrode surface. Both the paper-based substrates have been electrochemically characterized and, in addition, the effect of amount of waxed layers has been evaluated. The paper-based E-DNA strips have been challenged towards detection of three model targets, obtaining 3 and 7 nM as the detection limit, respectively for single and double stranded sequences. The repeatability of the manufacturing (home-made) process has been evaluated with a relative standard deviation of circa 10%. The effectiveness of the filter paper-based platform has been also evaluated in un-diluted serum obtaining similar value of detection limit (compared to the measurements carried out in buffer solution). In addition, a synthetic PCR amplified dsDNA sequence, related to HIV, has been detected in serum samples.

KEYWORDS: Paper-based, DNA detection, Screen-printing, Electroanalysis, Gold nanoparticles, Sustainability Nowadays, the detection of nucleic acids is extremely important for many fields of application: diagnostics, gene therapy, and a variety of biomedical studies.1-4 In particular, a variety of analytical methods for environmental surveillance, food security and healthcare are based on the analysis of different sources of both DNA and RNA.5-9 In addition, on top of the 10 emerging technologies of 2017, the liquid biopsy has been listed (www.weforum.org). It represents the determination of circulating DNA and RNA sequences, related to a particular disease, i.e. cancer,10-12 but the presence of blood/serum-circulating nucleic acids might also serve as the target for the diagnosis or the therapy monitoring of different diseases such as HIV, hepatitis, celiacs, etc.13-15 Among all the existing analytical strategies to detect nucleic acids, the hybridization offers a satisfactory selectivity towards the chosen target, and it is coupled to the most widely used methods colorimetric, fluorimetric, plasmonic, and electrochemical.16-19 Among these, the electrochemical ones provide an important advantage if compared with those based on colorimetric detection: they can be easily interrogated in colored/grossly complex matrices because they do not suffer from the interference due to the color and/or turbidity of solutions. Many detection mechanisms have been developed to electrochemically detect DNA sequences: Boon et al.20 determined ssDNA sequences by using chemically vapor deposited gold electrodes and recording the accumulated charge as a consequence of the intercalation of methylene blue, in argon atmosphere and in presence of ferricyanide.

Another approach exploited the determination of ssDNA targets by indirect voltammetric determination of solubilized gold ions.21 The target was immobilized and hybridized in presence of colloidal gold into an external well: successively, by the addition of acid, gold ions were oxidized, released, and determined at the microband. The group of Prof. Mascini developed a genosensor to detect ssDNA (previously biotinylated) by exploiting the enzymatic amplification in presence of streptavidin-alkaline phosphatase conjugate.22 However, some drawbacks affect these approaches both in terms of manufacture and measurements: chemical vapor deposition to produce the chip electrodes, the addition of acid to release gold ions, the biotinylation of target and the subsequent enzyme amplification, represent only few of the limitations towards for in-situ application in low settings/specialized area. In addition, the generation of a ssDNA prior to analysis represents the main experimental requirement for those methods that are based on the hybridization with a probe:23 in fact, DNA is mainly present as double stranded. This represents a limitation towards the potential development of hand-held devices for the use by non-specialists, comparable in simplicity with the glucose sensor for people with diabetes.24 Although some approaches to detect dsDNA have been adopted, i.e. polyacrylamide gels, DNA binding proteins, pyrrole-imidazole polyamides, these remain cumbersome and laboratory-bound processes, not suitable for routine screening of dsDNA in the absence of skilled personnel.25-27 To overcome these limitations, the group

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

of Ricci developed an electrochemical sequence specific assay that avoids the cumbersome need to generate ssDNA targets: they took advantage of a redox-tagged triplex-forming oligonucleotides (TFOs) probe, which is homopyrimidine or homopurine sequence that is capable to detect dsDNA targets without invoking the prior generation of ssDNA.28 Briefly, the addition of the dsDNA target allowed to generate a rigid triplex structure via the formation of Hoogsteen base pairs:29-30 it was consistent with a “signal-off” platforms as a consequence of the lowered collisions between the redox tag and the electrode. Although this approach represented a breakthrough towards the direct detection of dsDNA, the use of bulk gold electrode represents the major drawbacks towards the development of user-friendly platforms. In fact, the drawbacks related to the use of gold bulk electrodes are both experimental (the surface needs to be mechanically and electrochemically cleaned after each measurement, making this approach not suitable for decentralized measurements) and economically (gold electrodes are expensive). These features do not entirely satisfy the ASSURED (Affordable, Sensitive, Specific, Userfriendly, Robust and rapid, Equipment-free, Deliverable) criteria that WHO established for diagnostic tests (www.who.int/std_diagnostics). To develop an easy-to-use point of care device, especially suitable for limited-resources areas, it should i) avoid any tasks for non-specialized endusers, ii) be cost-effective, iii) be effective for in-situ analyses, and iv) guarantee to minimize the waste-management (extremely relevant in the remote areas). However, the screen-printed technology (also known as thick film technology) is a commonly adopted approach to easily produce disposable screen-printed electrodes (SPEs), that offers specific and low-cost solutions towards the electroanalytical sensing scenario for on-site application. Besides their wide adaptability, in the last decade SPEs have been successfully coupled to paper-based substrates, i.e. filter paper, copy paper, in order to realize smart sensing platforms characterized by high flexibility, sustainability, aboundancy, and affordability.31-36 In particular, some examples based on the use of paper-based platforms to detect DNA sequences have been reported in literature. In 2015, the group headed by Crooks detected a DNA sequence from the hepatitis B virus.37 They adopted a paper-based platform to evaluate the target concentration as a consequence of the recognition event happened onto magnetic beads modified with complementary DNA probes labelled with AgNPs. This electrochemical platform only served to quantify the target DNA by detecting the presence of Ag. However, this approach appears not very suitable for Point-Of-Care (POC) development: a sandwich of DNA needs to be formed ex situ, and then analyzed on the electrochemical strips. A similar approach, involving the use of quantum dots as the electrochemical label, has been developed recently to detect ssDNA.38 However, the biotinylation of target DNA made this approach uncertain for future POC development. In addition to these approaches, Teengam et al.39 detected a DNA sequence corresponding to HPV: an anthraquinone-labeled pyrrolidinyl peptide nucleic acid (PNA) was used to recognize the target sequence by observing a current suppression. Also in this case, as in the previous ones, DNA was necessarily hybridized as single strand. The production of single strand represents the main obstacole towards the realization of “zero-tasks” analytical devices.

In this work, two different paper-based substrates, namely filter and copy papers, have been exploited for the development of disposable and low-cost printedelectrochemical platforms for ssDNA and dsDNA detection, going beyond the state of the art related to development of electrochemical paper-based tools for nucleic acid detection. Paper-based substrates are gradually replacing the traditional polymeric-based electroanalytical strips: paper is cheaper, more sustainable, more abundant, and it can be easily incinerated without accumulating waste. Regarding the cost of the single device, the Whitesides’ group demonstrated that the cost of a screen-printed electrode can be tremendously lowered, i.e., from 0.5/1 to 0.014 $/strip by replacing polyester with Whatman No. 1,40 and we recently reported that the use of office paper is capable to provide a further 30% saving over the entire production cost.41 From an economic point of view, just considering the glucose test strips used every year by diabetic patient (750 million, www.glucometrix.de/eng/markt.php), the replacing of plasticbased strips with the paper-based strip will have a tremendous economic impact on the glucose test strips manufacturing process, delivering more cost-effective glucose test strips. In addition, copy paper is still not spread as for the filter one, thus a direct comparison for DNA sensing might result useful for successive sensors design. These served as the subtrates to fabricate carbon-based SPEs, successively drop casted with gold nanoparticles (AuNPs) with the aim both to improve the electrochemical performance of the platforms and to allow the methylene blue (MB)-tagged TFO probes being covalently attached to the working electrode surface (via Au-S bond formation). For the first time, TFO probes have been engineered within an electrochemical paper-based device. This work offers the reader a complete characterization of the two different paper-based AuNPs-SPE platforms that have been exploited to manufacture effective E-DNA sensors. The keyrole of wax-printing technology is highlighted in order to produce reliable platforms, by modulating the thickness of the wax layer during the manufacturing process. To demonstrate the suitability of the produced platforms, they have been applied to detect dsDNA-related HIV sequences in serum sample. Moreover, these new sensor platforms have been successfully coupled to a multiplex reader, for the simultaneous detection of 8 paper-based strips. EXPERIMENTAL SECTION Reagents and Equipments. Chloroauric acid (HAuCl4), sodium borohydride, sodium citrate, sodium chloride, magnesium chloride, potassium chloride, potassium dihydrogen phosphate (KH2PO4), potassium monohydrogen phosphate (K2HPO4), potassium ferricyanide (K3Fe(CN)6), potassium ferrocyanide (K4Fe(CN)6), 6-mercapto-1-hexanol (C6-OH), and tris(2-carboxyethyl)phosphine hydrochloride (TCEP) were purchased from Sigma-Aldrich (St.Louis, MO, USA) and used without further purification. The TFO probe, labelled with Methylene Blue (MB) as the redox reporter, was purchased from Biosearch Technologies (Novato, CA, USA). All the targets have been purchased from IBA GmbH (Göttingen, Germany). All the electrochemical measurements were carried out using a portable PalmSens Instrument (PalmSens, Netherlands) equipped with a multiplexer for 8 cells and connected to a laptop. UV-Vis measurements to calculate the concentration of AuNPs, probes and targets were


Page 2 of 9

Page 3 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry carried out using a spectrophotometer UV 1800 (Shimadzu, Japan). DNA probe and targets. A 19-base polypyrimidine sequence (5′-HS-(CH2)6-TATTTTTCTTTTCCCCCCT(CH2)7NH2-MB-3′) has been used as the probe to be attached onto the working electrode surface of the paper-based AuNPs-SPE. The probe has been modified with C6-OH at the 5′-end (allowing the covalent binding onto AuNPs) and with MB at the 3′-end (allowing the electron transfer at the electrode). Several targets have been tested to evaluate the recognizing effectiveness of the immobilized probe. A complementary 15base ssDNA (Target 1, 5′-GGGGGGAAAAGAAAA-3’) was capable to form a dsDNA with the immobilized probe. Two 15-base ssDNAs (Target 2, 5′-AAAAGAAAAGGGGGG-3′, and Target 3, 5′-CCCCCCTTTTCTTTT-3′), after hybridization, were used as the dsDNA target to form a triplex structure. In addition, the triplex formation was evaluated by interrogating the sensor towards a 34-base hairpin (Target 4, 5′-AAAAGAAAAGGGGGGTTTTCCCCCCTTTTCTTTT3′). To evaluate the specificity of the immobilized probe, a 34base mutated hairpin (Target 5, 5′-AAACGCAAAGGTGGTT TTTACCACCTTTGCGTTT- 3′) was tested. The four pairs of base written in bold are not complementary to the TFO probe, but the hairpin is still capable to form a dsDNA. To demonstrate the real application of this TFO probe, a synthetic dsDNA duplex sequence which mimics the HIV-related sequence amplified with PCR, has been tested by using two 63-base ssDNA targets (HIV Target-A, 5′ GTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGA CTGGAAGGGCTAATTCACTCCCAAAGAA-3′, and HIV Target-B, 5′-TCTTTGGGAGTGAATTAGCCCTTCCAGTC CCCCCTTTTCTTTTAAAAAGTGGCTAAGATCTAC3′). Synthesis of AuNPs dispersion. The AuNPs were obtained in a round flask at room temperature (RT). Briefly, 9 mL of distilled water were mixed with 1 mL of 25 mM HAuCl4 and 2 mL of 35 mM sodium citrate.42 After 1-minute stirring, 0.5 mL of 20 mM sodium borohydride were added drop-by-drop (Figure S1, Supporting information). The solution was left under stirring and in dark condition for 24 h. All the glassware and magnetic stir bar used in this synthesis were cleaned in aqua regia (HCl/HNO3 3:1 v/v), rinsed in distilled water, and subsequently cleaned with piranha solution (H2SO4/H2O2 7:3 v/v) and rinsed again with distilled water before use. Gold nanoparticles have been characterized by recording UV-Vis spectrum that revealed a characteristic plasmon band centered at 523 nm (Figure S2, Supporting information).

electrical connections (electrode traces are 19 mm × 1.2 mm for, reference electrode is an arc 4 mm x 1.2 mm (length x width), and carbon ink (Electrodag 421, Acheson, Italy) for the working (circle of 4 mm-diameter, area of 12.6 mm2) and counter electrodes (arc 13 mm x 1.2 mm (length x width). The paper-based devices were printed in strips composed by 8 electrodes. Consequently, each paper-based strip was cut to obtain a 25 mm x 10 mm-device (Figure 3A). Engineerization of the paper-based SPE with the AuNPs/TFO hybrid. A drop containing 8 L of AuNPs was casted onto the working electrode, and after drying, the probe was immobilized following a protocol reported in literature.43 The first step is the reduction of 100 μM DNA in presence of 10 mM TCEP for 1 h. The resulting solution was then diluted to the chosen concentration (in the range of nanomolar) to be immobilized onto the AuNPs-SPE. A 20-μL drop of the probe was placed onto the working electrode area for 1 h at RT (in order to avoid solvent evaporation, the incubation was carried out in a humid chamber). The use of a 200-nM TFO probe was consistent in a calculated surface coverage of ca. 1012 molecules/cm2) as established by a relationship with the intensity of current voltammograms.44 SPE was gently rinsed with distilled water and incubated (in a humid chamber) with 2 mM C6-OH to passivate the empty spaces onto the working electrode. SPE was rinsed with distilled water and left in a humid chamber overnight at 4°C in the working buffer solution (50 mM phosphate buffer containing 150 mM NaCl (pH=7)) and, in the same condition, it might be stored up to a week. Measurement of DNA targets. During operative conditions, the signal was recorded after the background current reached a stable value: in absence of the target, the current was stable up to 50 min, while when the target was added, the peak current appeared to be constant up to ulterior 40/50 min. All the targets (ssDNA or dsDNA) have been analyzed in 50 mM phosphate buffer containing 150 mM NaCl (pH 7) in presence of a concentration range going from low- to high-nM level. However, the currents were sampled after 20 min the target was added. When the interrogated targets were dsDNA and hairpin, 5 mM of magnesium chloride was added to the 100-L working solution. The parameters of Square Wave-Anodic Stripping Voltammetry (SW-ASV) were the following: E begin = -0.1 V, E end = -0.5 V, E step = 0.001 V, E amplitude = 0.01 V, Frequency = 50 Hz.

Production of the paper-based SPE. Prior to screen-print the electrodes, filter (67 g/m2, 135 mm caliper, Cordenons, Italy) and copy (Copy 2, 80 g/m2, Fabriano, Italy) papers were wax-patterned with a wax-printer (Xerox ColorQube 8580). In this work, three typologies of waxed configurations were adopted. The paper-based substrates were patterned with 1, 2, and 3 layers of wax. After a curing stage in the oven at 100 °C for 2 and 4 min, respectively for filter and copy paper, the wax penetrated the paper-based structures producing hydrophobic areas that contained the testing area. The electrodes were manually screen-printed using Ag/AgCl ink (Electrodag 477 SS, Acheson, Italy) for the reference electrode and the



Figure 1. Schematic representation of the paper-based E-DNA platform for the detection of single and double stranded DNA targets. The measurements have been carried out with a multi-8 reader, by using one-shot SPE for each concentration of target.

RESULTS AND DISCUSSION Characterization of the AuNPs-modified paper-based platforms. In order to obtain a good electrochemical platform for immobilizing the DNA probes, the carbon-based SPEs need to be coupled with materials capable to serve as anchor points for the attachment of the thiol-extremity of the DNA probe. In view of that, AuNPs were chosen due their interesting features, such as good electrical properties, strong adsorption ability, and high surface-to-volume ratio. The paper-based SPEs were modified by drop casting with 8 L of AuNPs dispersion. Their electrochemical effectiveness was evaluated by means of cyclic voltammetry in presence of 5 mM ferrocyanide/ferricyanide (Fe(CN)64-/ Fe(CN)63-). The experiments were carried out by varying the scan rate from 10 to 1000 mV/s. As displayed in Figure 2, the presence of two similar peaks, i.e. cathodic and anodic, is consistent with a typical reversible electrochemical behavior.

Figure 2. Cyclic voltammetry experiments performed with 5mM [Fe(CN)6]4-/3- prepared in 100 mM KCl varying the scan rate from 10 to 1000 mV/s by using (black curves) bare and (red curves) AuNP-modified electrodes that have been screen-printed onto A) filter paper and B) copy paper. Insets of A and B report the existing correlation between anodic current intensities and the square root of the scan rate for both the modified and un-modified paper-based platforms.

All the paper-based electrodes, modified and un-modified, highlighted the presence of the voltammetric peaks that are dependent on the scan rate magnitude. Following the RandlesSevcik equation (ip= (2.69×105)n1.5ACD0.5v0.5), is well-known that the linearity of the current vs. (scan rate)0.5 is a confirmation that the mass transfer is controlled by the diffusion of the analyte within the investigated scan rates and that the species in solution are not entrapped on the working electrode.45-47 However, the presence of AuNPs produced a significant improvement of the electrochemical properties of the tested platforms in terms of peak-to-peak (E) separation, consistent with the interface electron transfer kinetic: regarding the filter paper-based SPE, E (calculated at 10 mV/s as the scan rate) decreased from 207 to 85 mV when the SPE was modified with AuNPs, while bare copy paper-based SPE showed a E of 204 mV and a E of 80 mV when AuNPs were present. These results are ascribable to the fact that the electron transfer process, as for the Fe(CN)64-/

Fe(CN)63- redox couple, follows an inner-sphere route that is dependent on the surface functionalities such as nanomaterials and defects.48-49 In addition, the presence of AuNPs was effective with a 100% increase of the current intensities as observed in the insets of Figures 2A and 2B. Another study involved the optimization of the number of wax layer in order to obtain a durable platform: the paper-based substrates were tested by screen-printing the electrodes onto a single or double wax layer (Figure 3).

Figure 3. A) Schematic representation of the steps followed to modify the paper-based substrates with different number of wax layers and to modify them with AuNPs. Electrochemical comparison between electrodes screen-printed onto i) filter paper and ii) copy paper, wax printed with one (green curves) and two bottom layers (red curves), in presence of B) 5 mM [Fe(CN)6]4-/3prepared in 100 mM KCl at a scan rate of 50 mV/s and C) 100 mM sulfuric acid at a scan rate of 100 mV/s.

The last layer of wax was not cured in the oven: in this way it was capable to produce a micro-sized step (ca. 10 m), producing a physical barrier to the drop spreading (Figure 3A). The different paper-based platforms were interrogated by means of cyclic voltammetry experiments to evaluate some possible differences in terms of electrochemical response of the AuNPs-SPE. Cyclic voltammetric studies were carried out in presence of the redox couple Fe(CN)64-/ Fe(CN)63- and in acidic media containing sulfuric acid. The former experiment was useful to evaluate any difference in terms of electron transfer at the electrodic surface, while the latter served to indicate the gold exposed surface (the anodic peaks correspond to the formation of monolayer of oxygen species and the cathodic peak is consistent with the removal of this layer).50 As displayed in Figures 3B and 3C, no difference was observed when a different number of wax layer was taken into account. Experimentally, the wax printer was not capable to print more than 3 wax layers (2 oven-cured layers and 1 uncured layer) due to the high thickness of the waxed substrate which affected the process at the printer. However, even if no detectable difference was observed by carrying out the two studies, the configuration involving 3 layers was adopted to continue the development of the E-DNA paper-based sensors. This configuration allowed the 100-L drop to stay longer on top of the SPE avoiding being adsorbed on paper during the measurement period. However, in this work the DNA measurements take longer than experienced for different electroanalytical systems involving office paper, i.e. 200 nM) appeared higher respect to those calculated when Target 4 was quantified in serum (Figure 5) and in comparison with those calculated for short hairpin (Target 4). This behavior could be due to the length of the target, probably ascribed to a steric hindrance effect while hybridizing with the immobilized probe, and to the higher charge density of the bases that might produce a major repulsion during the binding process. The electrochemical paper-based strips may be better suited for clinical applications with respect to the optical methods, e.g. instead of using fluorescence detection: they might be applied for in situ monitoring of DNA amplification PCR. According to literature, in terms of analytical performance, electrochemical-based real-time PCR compares well with the actual fluorescent-based methodologies.55 The detection scheme proposed here might be promising for the integration in handheld miniaturized systems for affordable point-of-care diagnosis applications. Furthermore, the accuracy of the method was evaluated by spiking serum with concentration of synthetic PCR amplified dsDNA equal to 30 and 100 nM. The recoveries were obtained equal to 98 ± 10% and 101 ± 11%, respectively to 30 and 100 nM PCR amplified dsDNA (n=3). CONCLUSIONS Novel printed paper-based electrochemical devices were evaluated for the direct quantification of double stranded DNA targets without requiring time-consuming for double helices denaturation and/or enzyme amplification. Filter and copy papers were the basis for a disposable development; wax printing and screen-printing allowed to obtain low-cost and ad-hoc designed sensing platforms; gold nanoparticles were chosen to improve the sensitivity of the platforms, and triplex forming oligonucleotides were used to selectively and readily detect double standed DNA targets. In this work, novel paperbased subtrates in the field of electroanalysis were interrogated in presence of different type of DNA targets, both single and double stranded. Paper-based devices exhibited a high suitability for being easily patterned by low-cost approaches, allowing detection of nucleic acids in the low nanomolar range. The advantages of developing this method for dsDNA quantification, if compared with other existing ones, i.e. those based on colorimetric and fluorimetric detection, are principally related to the possibility of being easily interrogated with laboratory-free instrumentation without suffering in presence of grossly/colored/turbid samples. The use of these electrochemical paper-based strips, embedded in a multi-8 portable reader, allows a rapid in-situ monitoring. Undiluted serum samples were successfully analyzed, and the strips were not required to be cleaned after the measurements due to their disposability: they can be easily incinerated without accumulating waste, highlighting an added-value in those remote areas where the waste removal represents an issue as consequence of the scarcity of resources, i.e. qualified personnel, instrumentation. The easy detection of double stranded DNAs in biological fluids can represent a starting point for the development of other sustainable point-of-care devices as in the field of liquid biopsy, i.e. cancer detection.


Page 6 of 9

Page 7 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry (10)

ASSOCIATED CONTENT

(11)

Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Details of AuNPs synthesis, UV-Vis spectra, repeatability, square wave voltammograms related to hairpin detection at paper-based devices, experimental conditions, and selectivity tests are reported.

AUTHOR INFORMATION

(12) (13) (14)

Corresponding Author *E-mail: [email protected]; Tel: +39 0672594411

ACKNOWLEDGMENT S.C. acknowledges Fondazione Umberto Veronesi for “Postdoctoral Fellowship 2018”. Authors acknowledge Julian Ramirez for proofreading the manuscript.

REFERENCES (1)

(2)

(3)

(4)

(5)

(6)

(7)

(8)

(9)

(15)

(16)

Jin, Z.; Geißler, D.; Qiu, X.; Wegner, K.D.; Hildebrandt, N. A rapid, amplification‐free, and sensitive diagnostic assay for single‐step multiplexed fluorescence detection of microRNA. Angew. Chem. Int. Ed. 2015, 54, 10024-10029. Li, J.; Mo, L.; Lu, C.H.; Fu, T.; Yang, H.H.; Tan, W. Functional nucleic acid-based hydrogels for bioanalytical and biomedical applications. Chem. Soc. Rev. 2016, 45, 1410-1431. Frei, A.P.; Bava, F.A.; Zunder, E.R.; Hsieh, E.W.; Chen, S.Y.; Nolan, G.P.; Gherardini, P.F. Highly multiplexed simultaneous detection of RNAs and proteins in single cells. Nat. Methods 2016, 13, 269275. Hänsel-Hertsch, R.; Di Antonio, M.; Balasubramanian, S. DNA G-quadruplexes in the human genome: detection, functions and therapeutic potential. Nat. Rev. Mol. Cell. Biol. 2017, 18, 279-284. Tortajada-Genaro, L.A.; Santiago-Felipe, S.; Morais, S.; Gabaldón, J.A.; Puchades, R.; Maquieira, A. Multiplex DNA detection of food allergens on a digital versatile disk. J. Agric. Food. Chem. 2011, 60, 36-43. Choi, J.R.; Hu, J.; Tang, R.; Gong, Y.; Feng, S.; Ren, H.; Wen, T.; Li, X.J.; Abas, W.A.B.W.; PingguanMurphy, B.; Xu, F. An integrated paper-based sampleto-answer biosensor for nucleic acid testing at the point of care. Lab Chip 2016, 16, 611-621. Cinti, S.; Volpe, G.; Piermarini, S.; Delibato, E.; Palleschi, G. Electrochemical biosensors for rapid detection of foodborne Salmonella: A critical overview. Sensors 2017, 17, 1910-1931. Arduini, F.; Cinti, S.; Scognamiglio, V.; Moscone, D. Paper-based electrochemical devices in biomedical field: recent advances and perspectives, in: Past, Present and Future Challenges of Biosensors and Bioanalytical Tools in Analytical Chemistry: A Tribute to Professor Marco Mascini, 2017, 77, 385. Li, C.; Hu, X.; Lu, J.; Mao, X.; Xiang, Y.; Shu, Y.; Li, G. Design of DNA nanostructure-based interfacial probes for the electrochemical detection of nucleic acids directly in whole blood. Chem. Sci. 2018, 9, 979-984.

(17)

(18)

(19)

(20)

(21)

(22)

(23) (24) (25) (26) (27)

Crowley, E.; Di Nicolantonio, F.; Loupakis, F.; Bardelli, A. Liquid biopsy: monitoring cancer-genetics in the blood. Nat. Rev. Clin. Oncol. 2013, 10, 472-484. Newman, A.M.; Bratman, S.V.; To, J.; Wynne, J.F.; Eclov, N.C.; Modlin, L.A.; Liu, C.L.; Neal, J.W.; Wakelee, H.A.; Merritt, R.E.; Shrager, J.B.; Loo Jr, B.W.; Alizadeh, A.A.; Diehn, M. Nat. Med. 2014, 20, 548-554. Heitzer, E.; Ulz, P.; Geigl, J.B. Circulating tumor DNA as a liquid biopsy for cancer. Clin. Chem. 2015, 61, 112-123. Niemz, A.; Ferguson, T.M.; Boyle, D.S. Point-of-care nucleic acid testing for infectious diseases. Trends Biotechnol. 2011, 29, 240-250. Huang, H.; Bai, W.; Dong, C.; Guo, R.; Liu, Z. An ultrasensitive electrochemical DNA biosensor based on graphene/Au nanorod/polythionine for human papillomavirus DNA detection. Biosens. Bioelectron. 2015, 68, 442-446. Martín-Fernández, B.; de-los-Santos-Álvarez, N.; Martín-Clemente, J.P.; Lobo-Castañón, M.J.; LópezRuiz, B. Challenging genosensors in food samples: The case of gluten determination in highly processed samples. Talanta 2016, 146, 490-495. Kang, D.; Vallée‐Bélisle, A.; Porchetta, A.; Plaxco, K.W.; Ricci, F. Re‐engineering electrochemical biosensors to narrow or extend their useful dynamic range. Angew. Chem. Int. Ed. 2012, 51, 6717-6721. Thavanathan, J.; Huang, N.M.; Thong, K.L. Colorimetric detection of DNA hybridization based on a dual platform of gold nanoparticles and graphene oxide. Biosens. Bioelectron. 2014, 55, 91-98. Idili, A.; Amodio, A.; Vidonis, M.; Feinberg-Somerson, J.; Castronovo, M.; Ricci, F. Folding-upon-binding and signal-on electrochemical DNA sensor with high affinity and specificity. Anal. Chem. 2014, 86, 90139019. Borghei, Y.S.; Hosseini, M.; Dadmehr, M.; Hosseinkhani, S.; Ganjali, M.R.; Sheikhnejad, R. Visual detection of cancer cells by colorimetric aptasensor based on aggregation of gold nanoparticles induced by DNA hybridization. Anal. Chim. Acta 2016, 904, 92-97. Boon, E.M.; Ceres, D.M.; Drummond, T.G.; Hill, M.G.; Barton, J.K. Mutation detection by electrocatalysis at DNA-modified electrodes. Nature Biotechnol. 2000, 18, 1096-1100. Authier, L.; Grossiord, C.; Brossier, P.; Limoges, B. Gold nanoparticle-based quantitative electrochemical detection of amplified human cytomegalovirus DNA using disposable microband electrodes. Anal. Chem. 2001, 73, 4450-4456. Carpini, G.; Lucarelli, F.; Marrazza, G.; Mascini, M. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids. Biosens. Bioelectron. 2004, 20, 167-175. Das, J.; Ivanov, I.; Sargent, E.H.; Kelley, S.O. DNA clutch probes for circulating tumor DNA analysis. J. Am. Chem. Soc. 2016, 138, 11009-11016. Turner, A.P. Biosensors: sense and sensibility. Chem. Soc. Rev. 2013, 42, 3184-3196. Paleček, E.; Fojta, M. Magnetic beads as versatile tools for electrochemical DNA and protein biosensing. Talanta 2007, 74, 276-290. Stellwagen, N.C. Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution. Electrophoresis 2009, 30, 188-195. Singh, I.; Wendeln, C.; Clark, A.W.; Cooper, J.M.; Ravoo, B.J.; Burley, G.A. Sequence-selective detection



(28)

(29) (30) (31)

(32) (33)

(34)

(35)

(36)

(37) (38)

(39)

(40)

(41)

(42)

of double-stranded DNA sequences using pyrrole– imidazole polyamide microarrays. J. Am. Chem. Soc. 2013, 135, 3449-3457. Patterson, A.; Caprio, F.; Vallée-Bélisle, A.; Moscone, D.; Plaxco, K.W.; Palleschi, G.; Ricci, F. Using triplexforming oligonucleotide probes for the reagentless, electrochemical detection of double-stranded DNA. Anal. Chem. 2010, 82, 9109-9115. Idili, A.; Vallée-Bélisle, A.; Ricci, F. Programmable pH-triggered DNA nanoswitches. J. Am. Chem. Soc. 2014, 136, 5836-5839. Hu, Y.; Cecconello, A.; Idili, A.; Ricci, F.; Willner, I. Triplex DNA nanostructures: from basic properties to applications. Angew. Chem. 2017, 56, 15210-15233. Martinez, A.W.; Phillips, S.T.; Whitesides, G.M.; Carrilho, E. Diagnostics for the developing world: microfluidic paper-based analytical devices. Anal. Chem. 2010, 82, 3-10. Yetisen, A.K.; Akram, M.S.; Lowe, C.R. Paper-based microfluidic point-of-care diagnostic devices. Lab Chip 2013, 13, 2210-2251. Yang, Y.; Noviana, E.; Nguyen, M.P.; Geiss, B.J.; Dandy, D.S.; Henry, C.S. Paper-based microfluidic devices: Emerging themes and applications. Anal. Chem. 2016, 89, 71-91. Cinti, S.; Basso, M.; Moscone, D.; Arduini, F. A paperbased nanomodified electrochemical biosensor for ethanol detection in beers. Anal. Chim. Acta 2017, 960, 123-130. Arduini, F.; Cinti, S.; Scognamiglio, V.; Moscone, D.; Palleschi, G. How cutting-edge technologies impact the design of electrochemical (bio) sensors for environmental analysis. A review. Anal. Chim. Acta 2017, 959, 15-42. Cinti, S.; Fiore, L.; Massoud, R.; Cortese, C.; Moscone, D.; Palleschi, G.; Arduini, F. Low-cost and reagent-free paper-based device to detect chloride ions in serum and sweat. Talanta 2018, 179, 186-192. Li, X.; Scida, K.; Crooks, R.M. Detection of hepatitis B virus DNA with a paper electrochemical sensor. Anal. Chem. 2015, 87, 9009-9015. Kokkinos, C.T.; Giokas, D.L.; Economou, A.S.; Petrou, P.S.; Kakabakos, S.E. Paper-based microfluidic device with integrated sputtered electrodes for stripping voltammetric determination of DNA via quantum dot labelling. Anal. Chem. 2018, 90, 1092-1097. Teengam, P.; Siangproh, W.; Tuantranont, A.; Henry, C.S.; Vilaivan, T.; Chailapakul, O. Electrochemical paper-based peptide nucleic acid biosensor for detecting human papillomavirus. Anal. Chim. Acta 2017, 952, 3240. Nie, Z.; Deiss, F.; Liu, X.; Akbulut, O.; Whitesides, G. M. Integration of paper-based microfluidic devices with commercial electrochemical readers. Lab Chip 2010, 10, 3163-3169. Cinti, S.; De Lellis, B.; Moscone, D.; Arduini, F. Sustainable monitoring of Zn (II) in biological fluids using office paper. Sens. Actuators, B 2017, 253, 1199120. Haiss, W.; Thanh, N.T.; Aveyard, J.; Fernig, D.G. Determination of size and concentration of gold

(43)

(44)

(45) (46)

(47)

(48)

(49)

(50)

(51)

(52) (53) (54) (55)

Page 8 of 9 nanoparticles from UV− Vis spectra. Anal. Chem. 2007, 79, 4215-4221. Xiao, Y.; Lai, R.Y.; Plaxco, K.W. Preparation of electrode-immobilized, redox-modified oligonucleotides for electrochemical DNA and aptamerbased sensing. Nat. Protoc. 2007, 2, 2875-2880. Ricci, F.; Lai, R.Y.; Heeger, A.J.; Plaxco, K.W.; Sumner, J.J. Effect of molecular crowding on the response of an electrochemical DNA sensor. Langmuir 2007, 23, 6827 -6834. Bard, A.J.; Faulkner, L.R. Electrochemical Methods. Fundamentals and Applications, second ed., John Wiley & Sons, New York, 2001. Streeter, I.; Wildgoose, G.G.; Shao, L.; Compton, R.G. Cyclic voltammetry on electrode surfaces covered with porous layers: an analysis of electron transfer kinetics at single-walled carbon nanotube modified electrodes. Sens. Actuators, B 2008, 133, 462-466. Cinti, S.; Talarico, D.; Palleschi, G.; Moscone, D.; Arduini, F. Novel reagentless paper-based screenprinted electrochemical sensor to detect phosphate. Anal. Chim. Acta 2016, 919, 78-84. Ji, X.; Banks, C.E.; Crossley, A.; Compton, R.G. Oxygenated edge plane sites slow the electron transfer of the ferro‐/ferricyanide redox couple at graphite electrodes. Chem. Phys. Chem. 2006, 7, 1337-1344. Cinti, S.; Arduini, F.; Carbone, M.; Sansone, L.; Cacciotti, I.; Moscone, D.; Palleschi, G. Screen‐printed electrodes modified with carbon nanomaterials: a comparison among carbon black, carbon nanotubes and graphene. Electroanalysis 2015, 27, 2230-2238. Cinti, S.; Politi, S.; Moscone, D.; Palleschi, G.; Arduini, F. Stripping analysis of As (III) by means of screen‐printed electrodes modified with gold nanoparticles and carbon black nanocomposite. Electroanalysis 2014, 26, 931-939. Esteban Fernández de Ávila, B.; Watkins, H.M.; Pingarrón, J.M.; Plaxco, K.W.; Palleschi, G.; Ricci, F. Determinants of the detection limit and specificity of surface-based biosensors. Anal. Chem. 2013, 85, 65936597. Lentner, C. Geigy Scientific Tables, 8th edition, 3 CIBA-Geigy, Basle, Switzerland, 1984. Drummond, T.G.; Hill, M.G.; Barton, J.K. Electrochemical DNA sensors. Nature Biotechnol. 2003, 21, 1192-1199. Duca, M.; Vekhoff, P.; Oussedik, K.; Halby, L.; Arimondo, P.B. The triple helix: 50 years later, the outcome. Nucleic Acids Res. 2008, 36, 5123-5138. Deféver, T.; Druet, M.; Evrard, D.; Marchal, D.; Limoges, B. Real-time electrochemical PCR with a DNA intercalating redox probe. Anal. Chem. 2011, 83, 1815-1821.


Page 9 of 9 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Table of Contents


Paper-Based Strips for the Electrochemical Detection of Single and

Recommend Documents