Article pubs.acs.org/ac
Pd Nanowires as New Biosensing Materials for Magnified Fluorescent Detection of Nucleic Acid Libing Zhang, Shaojun Guo, Shaojun Dong, and Erkang Wang* State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, Jilin, 130022, P.R. China Graduate School of the Chinese Academy of Sciences, Beijing, 100039, P.R. China S Supporting Information *
ABSTRACT: The designed synthesis of new nanomaterials with controlled shape, composition, and structure is critical for tuning their physical and chemical properties, and further developing interesting analytical sensing devices. Herein, we presented that Pd nanowires (NWs) can be used as a new biosensing platform for high-sensitivity nucleic acid detection. The general sensing concept is based on the fact that Pd NWs can adsorb the fluorescently labeled single-stranded DNA probe and lead to substantial fluorescence quenching of dye, followed by specific hybridization with the complementary region of the target DNA sequence. This results in desorption of double-stranded DNA from Pd NWs surface and subsequent recovery of fluorescence. Furthermore, an amplification strategy based on Pd NWs for nucleic acid detection by using exonuclease III (Exo III) was demonstrated. The present dual-magnification sensing system combined Pd NWs with Exo III has a detection range of 1.0 nM to 2.0 μM with the detection limit of 0.3 nM (S/N = 3), which is about 20-fold higher than that of traditional unamplified homogeneous assays.
O
carbon nanotubes (SWNTs), graphene oxide (GO), and conjugation polymer nanobelts, respectively.18−28 In principle, nanomaterials suitable as an ideal platform for this assay should have several advantages. First, as a new class of universal fluorescence quenchers, their quenching efficiency should be effective with low background and high signal-to-noise ratio. Second, as new nanocarriers, they should have an ultrahigh surface area for loading multiple molecules. Third, the interactions of nanomaterials and molecules should be weak or not interact after the molecules interact with their corresponding targets. Therefore, exploring new nanomaterials that can be used as an effective fluorescent sensing platform for nucleic acid detection is still a great challenge. Pd nanowires modified with functional molecules are promising nanostructured materials for application in DNA fluorescent sensing because of their large surface area, different interactions with single-stranded DNA (ssDNA) and doublestranded DNA (dsDNA), interesting optical property, and strong quenching ability for fluorescent molecules. In this article, we demonstrated that polyvinylpyrrolidone-functionalized (PVP-functionalized) thin Pd NWs are an effective fluorescent sensing platform capable of discrimination of complementary and single-base mismatched target sequences. The general concept used in this approach is based on the adsorption of the fluorescently labeled ssDNA probe by Pd NWs, which is accompanied by substantial fluorescence
ver the past years, the intensive development of biosensing systems allowing rapid, cost-effective, sensitive, and specific detection of nucleic acids is being greatly motivated by their potential applications in gene analysis, clinical disease diagnostics and treatment, environmental monitoring, antibioterrorism, etc.1 At present, nucleic acid assay technology is making significant progress by taking advantage of a large number of novel materials designed and fabricated because of their unique optical, electronic, and catalytic properties.2−6 In particular, more attention has been drawn toward the design of nanomaterial-based DNA sensors with good sensitivity, selectivity, and practicality based on the interactions between DNA and nanomaterials with different compositions, dimensions, and shapes.7−13 Among these assays, nanomaterials-based fluorescent biosensing is of great interest because homogeneous detection of nucleic acids with fluorescent DNA probes possesses several inherent advantages, such as operation convenience, rapid hybridization kinetics, and potential compatibility with real-time polymerase chain reaction and in situ cellular imaging.14−16 Such probes usually consist of fluorophore quencher pairs and rely on fluorescence resonance energy transfer, for which distance-dependent fluorescence quenching is elaborately designed to be closely associated with DNA hybridization events.17 The key challenge for fluorescent biosensing is increasing the signal-to-noise ratio of such DNA probes. So far, a number of smart approaches have been developed for increasing the signal-to-noise ratio, including traditional organic fluorophores and quenchers being replaced with highly bright quantum dots and organics with highly efficient nanoquenchers such as Au nanoparticles, single-walled © 2012 American Chemical Society
Received: December 4, 2011 Accepted: March 14, 2012 Published: March 14, 2012 3568
dx.doi.org/10.1021/ac2032194 | Anal. Chem. 2012, 84, 3568−3573
Analytical Chemistry
■
Article
EXPERIMENTAL SECTION Materials. All oligonucleotides were purchased from Sangon Biotechnology Co., Ltd. (Shanghai, China) and their sequences are listed in Table 1. Probe DNA was labeled with a
quenching, followed by specific hybridization with its target to form dsDNA. This results in desorption of the hybridized complex from Pd NWs surface and subsequent recovery of fluorescence. To further improve the sensitivity, exonuclease III-catalyzed (Exo III-catalyzed) amplification strategy is introduced because it is sequence-independent and can catalyze the stepwise removal of mononucleotides from 3′-hydroxyl termini of duplex DNA. Its activity on ssDNA is limited and preferred for blunt or recessed 3′ termini.29 The nuclease can cleave the fluorescently labeled DNA, thereby liberating the fluorophore and ultimately releasing the target DNA. The released target DNA then binds another fluorescently labeled DNA, and the cycle starts anew, which leads to significant amplification of the signal. By monitoring the increase in fluorescence intensity, we could detect the target with very high sensitivity. Scheme 1 presents a schematic diagram to illustrate the fluorescence-enhanced nucleic acid detection using Pd NWs as
Table 1. Oligonucleotide Sequences Used in This Work oligonucleotide P1: probe DNA T1: target T2: single-base mismatched target T3: two-base mismatched target T4: four-base mismatched target
sequence 5′ FAM-AGTCAGTGTGGAAAATCTCTAGC-3′ 5′GCTAGAGATTTTCCACACTGACT(GAGA)3′ 5′-GCTAGAGATTTCCCACACTGACT-3′ 5′-GCTAGAGCTTTTCCAAACTGACT-3′ 5′-GCTTGAGATATTCCGCACTCACT-3′
fluorescein derivative, FAM. The stock solutions of oligonucleotides were prepared in 25 mM Tris-HCl buffer and accurately quantified using UV−Vis absorption spectroscopy with the following extinction coefficients (ε260 nm, M−1 cm−1) for each nucleotide: A = 15400, G = 11500, C = 7400, T = 8700. Poly-(N-vinyl-2-pyrrolidone) (PVP·K30, molecular weight: 30 000−40 000), ammonium hydroxide (NH4·OH), acetone, hydrazine (50%), PdCl2, and ethanol were purchased from the Shanghai Chemical Factory (Shanghai, China) and used as received without further purification. Na2TeO3 was obtained from Aldrich. Exo III was purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). Other chemicals were of reagent grade and were used without further purification. Solutions were prepared with deionized water processed with a Milli-Q ultra high purity water system (Millipore, Bedford, MA). Apparatus. Transmission electron microscopy (TEM) measurements were made on an Hitachi H-8100 EM with an accelerating voltage of 200 kV. XPS measurement was performed on an ESCALAB-MKII spectrometer (VG Co., United Kingdom) with Al Kα X-ray radiation as the X-ray source for excitation. Fluorescent emission spectra were recorded on a Fluoromax-4 spectrofluorometer (Horiba Jobin Yvon, Inc., France). The time-resolved fluorescence was measured by using FLSP920 Combined Steady State and Lifetime Spectrometer (Edinburgh, England). Synthesis of Te Nanowires. The nanowires were synthesized according to our reported literature.30 First, 2.0 g of PVP was dissolved with 50 mL of double-distilled water under vigorous magnetic stirring to form a homogeneous solution at room temperature. Then 0.267 g of sodium tellurite (Na2TeO3) was added to the previous solution and dissolved, followed by the addition of hydrazine hydrate (5 mL, 50% w/ w) and 4.5 mL of an ammonia solution (25% w/w). Next, the obtained solution was transferred into the container of a Teflon-lined stainless steel autoclave, sealed, and maintained at 180 °C for 4 h. Finally, the product was centrifuged with acetone, washed with double-distilled water, and dissolved in 40 mL of water. Synthesis of Pd NWs. Four milliliters of Te NW solution was added to 25 mL of water, followed by the addition of 4.5 mL of H2PdCl4 (56.4 mM) under stirring. The mixture was stored at room temperature for several minutes. Then the solution was centrifuged and the resulting sediment washed
Scheme 1. Illustration of DNA Hybridization Sensing Schemea
a
(A) Traditional binding strategy that one target can release only one probe from the Pd surface. (B) Amplification via Exo III digestion of the probe to release the target DNA for more reaction cycles.
a sensing platform. The Pd NWs in solution are typically stabilized by polyvinylpyrrolidone, which can strongly bind ssDNA through H-bonding between the amides of the PVP side chains and the nitrogenous bases of DNA. In addition, the coordination interaction between Pd NWs and the nucleotide bases may contribute little to the binding of ssDNA to Pd NWs. In contrast, Pd NWs should have no binding with dsDNA because the duplex structure does not permit the uncoiling needed to expose the bases. The essential difference arises because ssDNA can uncoil sufficiently to expose its bases, whereas dsDNA has a stable double-helix geometry that always presents the phosphate backbone. Pd NWs can quench the fluorescence of fluorophores tethered to ssDNA, which could be ascribed to the energy or electron transfer from the fluorophore to Pd NWs. When challenged with a target, dsDNA forms with a stable, rigid, double-helix geometry and is released from Pd NWs and subsequent recovery of the fluorescence. In the amplified strategy, to ensure that the nuclease can cleave the fluorescently labeled DNA, an additional four bases overhang at the 3′ termini of the target DNA. The released target DNA then binds another fluorescently labeled DNA, and the cycle starts anew, which leads to significant amplification of the signal. 3569
dx.doi.org/10.1021/ac2032194 | Anal. Chem. 2012, 84, 3568−3573
Analytical Chemistry
Article
Figure 1. TEM images of Te NWs (A, B) and Pd NWs (C, D).
NWs at different magnifications. It is observed that a great number of Pd NWs with diameter (Figure 1D) similar to that of pristine Te NWs are obtained. The formation of Pd NWs was further characterized by X-ray photoelectron spectroscopy (XPS). The XPS pattern (Figure S1, Supporting Information) of the resulting Pd NWs shows significant Pd 3d signals corresponding to the binding energy of Pd, suggesting that Te NWs have reacted with the Pd precursor through the galvanic reaction. The result indicates that the product obtained is actually Pd NWs. We test the feasibility of the Pd NWs as a fluorescent sensing platform for nucleic acid detection. Figure 2 illustrates the measurement results of comparing the fluorescence emission of
several times with double-distilled water and dissolved in 4 mL water. Fluorescent DNA Assays. In a typical DNA assay, the fluorescent probe P1 (20 nM) in 25 mM Tris−HCl buffer 1 (100 mM NaCl, 5.0 mM MgCl2, pH 7.4) was heated at 88 °C for 10 min and gradually cooled to room temperature. An aliquot of the Pd NWs suspension (about 0.10 mg/mL) was added to the working solution. Then appropriate concentrations of target DNA were added after 10 min, the mixture was incubated for 1 h, and then the fluorescence intensity was measured. In the amplified strategy, the fluorescent probe P1 (20 nM) in 25 mM Tris−HCl buffer 2 (5.0 mM MgCl2, pH 7.4) was heated at 88 °C for 10 min and gradually cooled to room temperature. An aliquot of the Pd NWs suspension (about 0.10 mg/mL) was added to the working solution. Then appropriate concentrations of target DNA and Exo III (20 U) were simultaneously added after 10 min, and the mixture was incubated at 37 °C for 2 h. Finally, the fluorescence intensity was measured.
■
RESULTS AND DISCUSSION The morphologies of the as-prepared Te NWs and Pd NWs were investigated by transmission electron microscopy (TEM), respectively. Figure 1A,B shows the typical TEM images of the as-prepared Te NWs. From the magnified image (Figure 1B), it is observed that these Te NWs have the diameter of about 10 nm. Considering that the redox reaction between Te NWs with Pd precursor is a fast process,30 herein Pd NWs were facilely obtained through adding the Pd precursor to the Te NW solution. Figure 1C,D show the TEM images of as-prepared Pd
Figure 2. Fluorescence emission spectra of P1 (20 nM) at different conditions: (a) P1 in Tris−HCl; (b) P1 + Pd NWs; (c) P1 + Pd NWs + 1.0 μM T1; (d) P1 + Pd NWs + 1.0 μM T1 + 20 U Exo III. 3570
dx.doi.org/10.1021/ac2032194 | Anal. Chem. 2012, 84, 3568−3573
Analytical Chemistry
Article
P1 at different conditions in Tris−HCl solution. Upon exciting at the maximal absorption wavelength of FAM, P1 shows strong fluorescence intensity from FAM (curve a). However, the fluorescence of P1 was greatly quenched in the presence of Pd NWs (curve b). In our experiment, we have investigated the fluorescence intensity of P1 under different concentrations of Pd NWs (see Figure S2, Supporting Information). Upon the addition of an increasing concentration of Pd NWs, the fluorescence intensity of P1 decreased evidently. It is found that more than 88% of FAM’s fluorescence was quenched with 0.11 mg/mL Pd NWs in the solution. This result reveals that Pd NWs can efficiently quench the fluorescence of FAM, which may be attributed to the energy or electron transfer from the fluorophore to the Pd NWs. In Figure 2, curve c is the fluorescence emission spectrum of P1−Pd in the presence of T1. Significant fluorescence emission enhancement is observed compared with that without T1 (curve b). The fluorescence enhancement is the result of the formation of dsDNA, which releases from Pd NWs and hampers the energy or electron transfer between FAM and Pd NWs. While in the presence of T1 and 20 U Exo III, the fluorescence enhancement is much higher than that without Exo III. The Exo III can cleave the fluorescently labeled DNA, thereby liberating the fluorophore and ultimately releasing the target DNA. The released target DNA then binds another fluorescently labeled DNA, and the cycle starts anew, which leads to significant amplification of the signal. This fluorescence emission change constitutes the basis for fluorescent detection of DNA proposed in this paper. We then performed time-resolved fluorescence studies to explore the quenching mechanism of the Pd NWs system. Apparently, the fluorescence lifetime of the FAM-tagged ssDNA became significantly shortened upon interaction with Pd NWs (Figure 3). The fluorescence lifetime decay of the
We further studied the kinetic behaviors of P1 and Pd NWs, as well as the P1−Pd complex in the absence and presence of T1 by collecting the time-dependent fluorescence emission spectra (see Figure S3, Supporting Information). Curve a shows the fluorescence quenching of P1 in the presence of Pd NWs as a function of incubation time. In the absence of the target, the curve exhibits a rapid reduction in the first 10 min and gradually reaches equilibrium within the following time. It is hypothesized that the surface effect of Pd NWs and the coordination role between Pd NWs and ssDNA should be the main reason for the adsorption. Curves b and c show the fluorescence signal of P1−Pd in the presence and absence of T1 as a function of time, respectively. Without T1, the fluorescence signal does not change, whereas in the presence of the target T1, the curve shows a slow enhancement over a period of 40 min. The best fluorescence response was obtained after about 1 h of incubation time. Therefore, the kinetics of the hybridization of the probe adsorbed on Pd NWs to its target and the subsequent release of the dsDNA thus formed from Pd NWs is also slower than that on graphene (30 min) but faster than that on SWCNT (65 min).22,26 For the sensitivity study, different concentrations of T1 solution were investigated. Figure 4A shows the fluorescence emission spectra of P1−Pd in the presence of T1 from 0.01 to 2.0 μM in Tris−HCl buffer solution. With the increase in the concentration of T1, the fluorescence intensity was enhanced obviously. This phenomenon indicates that dsDNA is formed and released from Pd NWs surface with subsequent recovery of the fluorescence. Figure 4B shows the relationship between the fluorescence intensity and the concentration of T1. Upon the addition of an increasing amount of T1, the fluorescence intensity was enhanced obviously. However, when the concentration of T1 reached a high value, the fluorescence intensity would not enhance any more and a plateau was reached; this may be attributed to the hybridization between P1 and T1 reaching a balance and saturation. The inset shows the calibration curve for quantitative analysis of target DNA. The absorbance is linearly dependent on the concentration of T1 in the range from 10 to 100 nM (R = 0.991), and the detection limit is 6.0 nM (three times the standard deviation of the blank solution). To further improve the sensitivity, Exo III-catalyzed amplification strategy is introduced to the detection system. The effect of different amounts of Exo III on the signal amplification was investigated. Fluorescence at 520 nm was recorded in the presence of different amounts of Exo III from 0 to 30 U (see Figure S4, Supporting Information). As can be seen, the amplified effect increases sharply upon increasing the amount of Exo III and is saturated at ≥20U. Thus, 20 U of Exo III is used in all further experiments. In addition, we further examined the effect of Exo III on the fluorescence signal. Figure S5 (Supporting Information) shows the measurement results of the fluorescence emission at different conditions. It can be seen that the fluorescence intensity is not enhanced by Exo III (activated or heat-deactivated, compare curves b and c with curve a) in the absence of taget DNA T1, indicating that Exo III cannot be absorbed to the surface of Pd NWs, which does not lead to P1 released from the surface of Pd NWs, thus resulting in the recovery of the fluorescence intensity, whereas in the presence of target DNA T1, only activated Exo III can enhance the fluorescence intensity (curve e). After the Exo III is heatdeactivated, the fluorescence intensity (curve f) is almost identical to that in the presence of T1 (curve d). These results
Figure 3. Fluorescence decay of a FAM-labeled ss-DNA (20 nM) in a Tris−HCl buffer solution (25 mM, pH 7.4) upon incubation with Pd NWs.
FAM-labeled ssDNA could be fitted with a monoexponential component with a time constant of ∼4.0 ns. While in the presence of Pd NWs, the fluorescence lifetime decay could be fitted both with a dominant fast component with time constant of ∼0.4 ns and a minor slow decay component with time constant of ∼3.9 ns. The fast component is due to the bound complex between FAM-ssDNA and Pd NWs, and the minor slow component is due to free FAM-ssDNA molecules in the solution. The efficient quenching of FAM-ssDNA by Pd NWs is believed to arise from energy or electron transfer from FAM to Pd NWs, which closely resembles GO quenching matrixes with fluorescent dye.31−33 3571
dx.doi.org/10.1021/ac2032194 | Anal. Chem. 2012, 84, 3568−3573
Analytical Chemistry
Article
Figure 4. (a) Fluorescence emission spectra of analyzing different concentrations of T1 (from a to h): 0, 10, 25, 50, 100, 250, 500, and 1000 nM. (b) The relationship between the fluorescence intensity and the concentration of T1. The inset shows a linear relationship (R = 0.991) over the concentration of T1 in the range from 1 × 10−8 to 1 × 10−7 M.
Figure 5. (a) Fluorescence emission spectra of analyzing different concentrations of T1 (from a to j): 0, 1, 5, 10, 25, 50, 100, 250, 500, and 1000 nM. (b) The relationship between the fluorescence intensity and the concentration of T1. The inset shows a linear relationship (R = 0.990) over the concentration of T1 in the range from 1 × 10−9 to 1 × 10−7 M.
demonstrate that Exo III itself could not be absorbed onto the Pd surface, whereas the activated Exo III could act as an enzyme to induce the amplified fluorescence signal. The amplification assay was prepared by mixing the P1 with Pd NWs to form the P1−Pd complex. Then target T1 and Exo III (20 U) were simultaneously added, and the mixture was incubated at 37 °C for 2 h. Subsequent fluorescence measurements showed a dramatic increase in the final fluorescence intensity. Figure 5A shows the fluorescence emission spectra of the P1−Pd complex upon the addition of Exo III and T1 at concentrations from 0.001 to 2.0 μM. The fluorescence intensity started to recover after addition of only 1.0 nM T1, and Figure 5B shows the calibration plot. The inset shows the calibration curve for quantitative analysis of target DNA. The absorbance is linearly dependent on the concentration of T1 in the range from 1.0 to 100 nM (R = 0.990) with a very low detection limit of 0.3 nM (3 times the standard deviation of the blank solution), which is 20-fold lower than that of the traditional unamplified strategy. Although the system has not yet been fully optimized, these results clearly demonstrate that the amplification strategy greatly enhances the sensitivity of the detection platform. Along with the sensitivity requirement, high specificity is crucial for the detection. To evaluate the specificity of the sensor, the similar target DNA strands with only single (T2), two (T3), and four (T4) mismatched nucleotides were also investigated. The sequences of these mismatched DNA strands are shown in Table 1. Figure 6 shows the fluorescence changes of target DNA and other mismatched DNA strands. In the presence of T1, the fluorescence enhanced obviously; this is
Figure 6. Selectivity of the DNA/Pd platform analyzing target DNA T1 (1.0 μM) over other mismatched DNA (1.0 μM): T2 (single-base mismatched target), T3 (two-base mismatched target), and T4 (fourbase mismatched target).
because T1 can hybridize with P1 to form dsDNA and release from the Pd surface, whereas others of mismatched DNA make the fluorescence a little enhance. These data clearly demonstrate that the detection approach shows a high selectivity toward the target DNA, and even one mismatched nucleotide could be distinguished.
■
CONCLUSIONS
In conclusion, we have demonstrated that the use of Pd NWs as an effective sensing platform for fluorescence-enhanced nucleic acid detection capable of discrimination of complementary and single-base mismatched target sequences. Furthermore, we 3572
dx.doi.org/10.1021/ac2032194 | Anal. Chem. 2012, 84, 3568−3573
Analytical Chemistry
Article
(20) Maxwell, D. J.; Taylor, J. R.; Nie, S. J. Am. Chem. Soc. 2002, 124, 9606−9612. (21) Wang, H.; Wang, Y. X.; Jin, J. Y.; Yang, R. H. Anal. Chem. 2008, 80, 9021−9028. (22) Yang, R. H.; Tang, Z. W.; Yan, J. L.; Kang, H. Z.; Kim, Y. M.; Zhu, Z.; Tan, W. H. Anal. Chem. 2008, 80, 7408−7413. (23) Yang, R. H.; Jin, J. U.; Chen, Y.; Shao, N.; Tang, Z. W.; Wu, Y. R.; Zhou, Z.; Tan, W. H. J. Am. Chem. Soc. 2008, 130, 8351−8358. (24) Zhang, L. B.; Wei, H.; Li, J.; Li, T.; Li, D.; Li, Y. H.; Wang, E. K. Biosens. Bioelectron. 2010, 25, 1897−1901. (25) Zhang, L. B.; Li, T.; Li, B. L.; Li, J.; Wang, E. K. Chem. Commun. 2010, 46, 1476−1478. (26) Lu, C.; Yang, H.; Zhu, C.; Chen, X.; Chen, G. Angew. Chem., Int. Ed. 2009, 48, 4785−4787. (27) Lu, C. H.; Li, J.; Lin, M. H.; Wang, Y. W.; Yang, H. H.; Chen, X.; Chen, G. N. Angew. Chem., Int. Ed. 2010, 49, 8454−8457. (28) Wang, L.; Zhang, Y.; Tian, J.; Li, H.; Sun, X. Nucleic Acids Res. 2011, 39, e37. (29) Zuo, X. L.; Xia, F.; Xiao, Y.; Plaxco, K. W. J. Am. Chem. Soc. 2010, 132, 1816−1818. (30) Guo, S. J.; Dong, S. J.; Wang, E. K. Chem. Commun. 2010, 46, 1869−1871. (31) Wang, Y.; Kurunthu, D.; Scott, G. W.; Bardeen, C. J. J. Phys. Chem. C 2010, 114, 4153−4159. (32) Chang, H.; Tang, L.; Wang, Y.; Jiang, J.; Li, J. Anal. Chem. 2010, 82, 2341−2346. (33) Wen, Y. Q.; Peng, C.; Li, D.; Zhuo, L.; He, S. J.; Wang, L. H.; Huang, Q.; Xu, Q. H.; Fan, C. H. Chem. Commun. 2011, 47, 6278− 6280.
show that this approach can be used for amplified detection of nucleic acid sequences. The sensitivity of this new type of amplified assay was about 20-fold higher than that of traditional unamplified homogeneous assays. Thus, the proposed assay not only provides a new sensing platform for nucleic acid detection but also will open the door to explore the use of nanomaterial and the nuclease as an amplified platform for the detection and subsequent analysis of target molecules.
■
ASSOCIATED CONTENT
S Supporting Information *
Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.
■
AUTHOR INFORMATION
Corresponding Author
*Fax: +86-431-85689711. Tel.: +86-431-85262003. E-mail:
[email protected]. Notes
The authors declare no competing financial interest.
■
ACKNOWLEDGMENTS The work was supported by the National Natural Science Foundation of China with Grants 21075120 and 21190040, the 973 Project 2010CB933600 and 2011CB911000. L.Z. and S.G. contributed equally to this work.
■
REFERENCES
(1) Gresham, D.; Ruderfer, D. M.; Pratt, S. C.; Schacherer, J.; Dunham, M. J.; Botstein, D.; Kruglyak, L. Science 2006, 311, 1932− 1936. (2) Rosi, N. L.; Giljohann, D. A.; Thaxton, C. S.; Lytton-Jean, A. K. R.; Han, M. S.; Mirkin, C. A. Science 2006, 312, 1027−1030. (3) Giljohann, D. A.; Seferos, D. S.; Prigodich, A. E.; Patel, P. C.; Mirkin, C. A. J. Am. Chem. Soc. 2009, 131, 2072−2073. (4) Liu, Z.; Winters, M.; Holodniy, M.; Dai, H. Angew. Chem., Int. Ed. 2007, 46, 2023−2027. (5) Liu, Y.; Yu, Z. L.; Zhang, Y. M.; Guo, D. S.; Liu, Y. P. J. Am. Chem. Soc. 2008, 130, 10431−10439. (6) Wu, Y.; Phillips, J. A.; Liu, H.; Yang, R.; Tan, W. ACS Nano 2008, 2, 2023−2038. (7) Yang, H.; Xia, Y. Adv. Mater. 2007, 19, 3085−3087. (8) Katz, E.; Willner, I. Angew. Chem., Int. Ed. 2004, 43, 6042−6108. (9) Li, H.; Huang, J.; Lv, J.; An, H.; Zhang, X.; Zhang, Z.; Fan, C.; Hu, J. Angew. Chem., Int. Ed. 2005, 44, 5100−5103. (10) Zhang, J.; Song, S. P.; Wang, L. H.; Pan, D.; Fan, C. Nat. Protoc. 2007, 2, 2888−2895. (11) Feldkamp, U.; Niemeyer, C. M. Angew. Chem., Int. Ed. 2006, 45, 1856−1876. (12) Liu, Z.; Tabakman, S.; Welsher, K.; Dai, H. Nano Res. 2009, 2, 85−120. (13) Barone, P. W.; Baik, S.; Heller, D. A.; Strano, M. S. Nat. Mater. 2005, 4, 86−92. (14) Tyagi, S.; Kramer, F. R. Nat. Biotechnol. 1996, 14, 303−308. (15) Tan, W.; Wang, K.; Drake, T. J. Curr. Opin. Chem. Biol. 2004, 8, 547−553. (16) Storhoff, J. J.; Lucas, A. D.; Garimella, V.; Bao, Y. P.; Muller, U. R. Nat. Biotechnol. 2004, 22, 883−887. (17) He, S. J.; Song, B.; Li, D.; Zhu, C. F.; Qi, W. P.; Wen, Y. Q.; Wang, L. H.; Song, S. P.; Fang, H. P.; Fan, C. H. Adv. Funct. Mater. 2010, 20, 453−459. (18) Dubertret, B.; Calame, M.; Libchaber, A. J. Nat. Biotechnol. 2001, 19, 365−370. (19) Seferos, D. S.; Giljohann, D. A.; Hill, H. D.; Prigodich, A. E.; Mirkin, C. A. J. Am. Chem. Soc. 2007, 129, 15477−15479. 3573
dx.doi.org/10.1021/ac2032194 | Anal. Chem. 2012, 84, 3568−3573
