Pharmacological inhibition of Rac1 activity prevents pathological

Subscriber access provided by BOSTON UNIV

Tissue Engineering and Regenerative Medicine

Pharmacological inhibition of Rac1 activity prevents pathological calcification and enhances tendon regeneration Long Yang, Chenqi Tang, Yangwu Chen, Dengfeng Ruan, Erchen Zhang, zi yin, Xiao Chen, Yangzi Jiang, Youzhi Cai, Yang Fei, Shouan Zhu, Huanhuan Liu, Jiajie Hu, Boon Chin Heng, Weishan Chen, Weiliang Shen, and HongWei Ouyang ACS Biomater. Sci. Eng., Just Accepted Manuscript • DOI: 10.1021/ acsbiomaterials.9b00335 • Publication Date (Web): 29 May 2019 Downloaded from http://pubs.acs.org on June 3, 2019

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Biomaterials Science & Engineering

Pharmacological inhibition of Rac1 activity prevents pathological calcification and enhances tendon regeneration Long Yang a, b, c, 1, Chenqi Tang a, b, d, e, 1, Yangwu Chen a, b, d, e, 1, Dengfeng Ruan d, e, Erchen Zhang a, b,

Zi Yin a, b, Xiao Chen a, b, f, Yangzi Jiang a, b, g, h, Youzhi Cai b, i, Yang Fei d, e, Shouan Zhu a, b,

Huanhuan Liu a, b, Jiajie Hu a, b, Boon Chin Heng k, Weishan Chen d, e***, Weiliang Shen a, b, d, e, f, g **, Hongwei Ouyang a, b, f, g, j * a

Dr. Li Dak Sum & Yip Yio Chin Center for Stem Cells and Regenerative Medicine, School of

Medicine, Zhejiang University, China b

Key Laboratory of Tissue Engineering and Regenerative Medicine of Zhejiang Province, School

of Medicine, Zhejiang University, China c The

d

First Affiliated Hospital of Zhejiang Chinese Medical University, Hangzhou, China

Department of Orthopaedics, Second Affiliated Hospital, Zhejiang University, China

e Orthopaedics

Research Institute of Zhejiang University, Hangzhou, China

f

China Orthopedic Regenerative Medicine Group (CORMed), China

g

Department of Sports Medicine, School of Medicine, Zhejiang University, China

h

Center for Cellular and Molecular Engineering, Department of Orthopaedic Surgery, University

of Pittsburgh, Pittsburgh, PA, USA i

Center for Sport Medicine, The First Affiliated Hospital, School of Medicine, Zhejiang

University, China j

State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, Collaborative

Innovation Center for Diagnosis and Treatment of Infectious Diseases, The First Affiliated Hospital, School of Medicine, Zhejiang University, China

ACS Paragon Plus Environment

ACS Biomaterials Science & Engineering 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

k

Faculty of Dentistry, Department of Endodontology, The University of Hong Kong, Pokfulam,

Hong Kong

*

Corresponding author: Hongwei Ouyang M.D., Ph.D.

Center for Stem Cell and Tissue engineering, School of Medicine, Zhejiang University, 388 Yu Hang Tang Road, Hangzhou 310058, China. **

Co-corresponding author: Weiliang Shen M.D.

Department of Orthopedic Surgery, 2nd Affiliated Hospital, School of Medicine, Zhejiang University, 88 Jie Fang Road, Hangzhou 310009, China. ***CO-Corresponding

author: Weishan Chen M.D.

Department of Orthopedic Surgery, 2nd Affiliated Hospital, School of Medicine, Zhejiang University, 88 Jie Fang Road, Hangzhou 310009, China. Email addresses: [email protected] (Hongwei Ouyang); [email protected] (Weiliang Shen); [email protected] (Weishan Chen) 1. These authors contribute equally to this work.


Page 2 of 39

Page 3 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Abstract Tendinopathy is a common disease, which was characterized by pain, swelling and dysfunction. At the late stage of tendinopathy, there may occur pathological changes, such as tendon calcification. Previously we have shown that in situ tendon stem/progenitor cells (TSPCs) underwent osteogenesis in the inflammatory niche in diseased tendons. And in this study, we demonstrated this process was accompanied by the activation of Ras-related C3 botulinum toxin substrate 1 (Rac1) signaling. A specific inhibitor NSC23766 significantly downregulated catabolic factors and calcification related genes, and rescued the tenogenesis gene expression of TSPCs under the influence of Interleukin (IL)-1β in vitro. For in vivo evaluation, we further developed a drug delivery system to encapsulate Rac1 inhibitor NSC23766. Chitosan/β-glycerophosphate hydrogel encapsulated NSC23766 effectively impeded tendon calcification and enhanced tendon regeneration in rat Achilles tendinosis. Our findings indicated that inhibiting Rac1 signaling could act as an effectively intervention for tendon pathological calcification and promote tendon regeneration, thus providing a new therapeutic strategy.

Key words：Tendon calcification; Rac1; NSC23766; Chitosan/β-glycerophosphate; Tendon Stem Progenitor Cells;



1. Introduction Tendon is a kind of tissue that connect muscles and bones, and plays a role in mechanical conduction during movement. Tendons are susceptible to injury during exercise. It has been reported that 30 to 50% of all sporting injuries involve tendons, causing enormous economic burden1. During the progress of tendinopathy, a series of degenerative changes may occur, such as hypercellulartiy, matrix disorders. What’s more, it can also been found ectopic bone formation in part of degenerative tendons2. Researchers had reported that the prevalence of calcific tendinopathy is 2.7 to 22% in Caucasian populations3. Calcification is an important pathological feature in damaged tendon that some of those may lead to pain and dysfunction. The reason of the pathological calcification is still unclear. There are many hypotheses, including micro-injury4, inflammatory mediator5-6, mechanical-biological coupling7-8 and ischemia - reperfusion hypothesis9 that are used to explain the calcification. In addition to the abnormality in mechanical and biological microenvironments, the behavior of resident cells that respond to the damage and pathological changes could also be an important reason for the pathological calcification. In a lot of soft tissues, tissue specific stem cells (e.g., muscle, bone marrow) are thought to maintain homeostasis and regenerate injured tissues by proliferation and differentiation10. However, sometimes the local tissue specific stem cells may also quit the homeostasis maintenance stage and switch to other unexpected lineages due to the influence of disease environment11. In our previous study, we have found that tendon stem/progenitor cells (TSPCs) would commit to osteochondral differentiation rather than tenogenesis under the inflammatory environment12. In other words, tendon calcification is not only one of the radiological features of tendinopathy, but also represents the exhausted local stem/progenitor cell pool, resulting


Page 4 of 39

Page 5 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


in impaired tissue regeneration. Therefore, identification of factors that regulate the pathological differentiation of TSPCs is essential for the development of new treatments to prevent tendon calcification and enhance its regeneration. Ras-related C3 botulinum toxin substrate 1 (Rac1) is one of small GTPases that belongs to the RAS superfamily of small GTP-binding proteins. It has been reported to be involved in many cellular

processes,

including

cell

motility,

adhesion,

phagocytosis,

proliferation

and

differentiation13-15. Previously we had shown that in situ tissue specific stem/progenitor cells underwent osteogenesis in diseased human soft tissues (i.e., tendon12, cartilage16 and heart valves12), accompanied by the activation of Rac1 signaling, particularly in the tissues that affected by degenerative

diseases16-17.

NSC23766

[(N6-[2-[[4-(diethylamino)-1-methylbutyl]-amino]-6-

methyl-4-pyrimidinyl]-2-methyl-4,6-quinolinediamine trihydrochloride] is a small molecule inhibitor, which can inhibit Rac1 activation18. Specifically, in the cartilage degenerative disease, osteoarthritis, inhibiting the Rac1 activity with a small molecule inhibitor, NSC23766, could effectively ameliorate tissue degeneration and chondrocyte hypertrophy16. Taking the similarity of the pathological calcification process in degenerative diseases in connective tissues, we therefore hypothesized that inhibiting Rac1 signaling in degenerative tendon would prevent the pathological calcification and enhance endogenous regeneration in Achilles tendon. To study the activation levels of Rac1 signaling pathway in diseased Achilles tendon, we firstly examined the baseline of healthy and degenerated tendons from human and rats, and the effect of Rac1 inhibitor, NSC23766, was tested both in vitro and in vivo. Interestingly, the activated Rac1 was found co-localized with tissue specific-stem cell markers in diseased tendon. Therefore in the present study, we used TSPCs, and the levels of Rac1 signaling activation to predict the pathological



teno-/osteo- lineage differentiation in vitro. A collagenase induced tendinosis model in rat Achilles was used to mimic the rapid developed tendon degeneration, and the Rac1 inhibitor NSC23766 was encapsulated and delivered by chitosan/β-glycerophosphate hydrogel. The osteogenesis of TSPCs, tendon calcification and regeneration in diseased Achilles were examined.

2. Methods and materials 2.1 Human tendon and tendon stem/progenitor cells (TSPCs) preparation and isolation Human diseased tendon samples were surgical waste that obtained from patients with rotator cuff calcification during arthroscopic shoulder surgery(n=3). The patient’s consent and approval of the local ethics committee were obtained (Ethics Committee of the 2nd Affiliated Hospital, School of Medicine, Zhejiang University, code: 2015-404). Human healthy tendons were obtained from flexor tendons of patients with finger amputation caused by traffic accidents(n=3), as kindly gifts from the Department of Pathology, School of Medicine, Zhejiang University. The tissues were cut off into fragments and digested with 0.2% collagenase (Gibco, #17100017) overnight at 37 ℃. Cells were then collected and cultured in low-glucose Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS; Invitrogen) and 1% penicillin streptomycin (Gibco). TSPCs were selected from the clonal forming cells in multiple clones under low seeding density. After starvation treatment for 3 hours to synchronize cell cycle and improve cell sensitivity, TSPCs were either untreated or treated with IL-1β (5 ng/ml) and NSC23766 (5 μM, 10 μM) for indicated time periods.


Page 6 of 39

Page 7 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


2.2 Cell proliferation assay Cell proliferation was determined by Cell Counting KIT-8 (CCK-8, Dojindo), according to the manufacturer’s protocol. We planted TSPCs at a concentration of 1000 cell/well in 96-well plate under the basic culture medium (10% FBS, low-glucose DMEM). At desired time points, TSPCs were incubated in 10% CCK-8 solution at 37 °C for 2 h. The absorbance of the culture medium was measured by a microplate reader (Molecular Devices, SpectraMax 190) and the wave length at 450 nm is specific for the cell metabolic products formazan. Cell number was positive correlated with the OD value.

2.3 TSPCs differentiation assays To test the effects of Rac1 signaling in pathological differentiation, the teno- and osteo-genesis potency of the TSPCs was examined as described previously19. TSPCs were either untreated or treated with IL-1β (5 ng/ml) and NSC23766 (5 μM, 10 μM) during induction. Tenogenesis differentiation was induced in near-confluent TSPCs cultures by treating with ascorbic acid (50 ug/ml), 10% FBS and high-glucose DMEM for 7 days. Osteogenic differentiation was induced with ascorbic acid (50 ug/ml), dexamethasone (10-8 M), β-glycerol phosphate (10 mM), 10% FBS and high-glucose DMEM. After 1 week, alkaline phosphatase (ALP) activity was examined using a BCIP/NBT Kit (Beyotime, #C3206), and the ALP activity staining was normalized to the total cell nuclei number, which was counterstained by DAPI (Beyotime, #C1002). Alizarin red staining (Sigma, #A5533) was used to detect the calcium deposition after 2 weeks of the osteogenic induction culture. For further quantitative analysis, the stained nodules were dissolved in 5 % sodium dodecyl sulfate (SDS) in 0.5 N HCl for 30 minutes at room temperature and the OD value of solution was



measured at 405 nm.

2.4 Protein extraction from tissues and cells 20 mg of dissected human or rat tendons tissues were mixed in 200 μl of RIPA lysis buffer, 2 ul of protease inhibitors and 2 ul of phenylmethylsulfonyl fluoride (PMSF). Primary cultured cells (~ 1 million) were mixed in 1ml of RIPA lysis buffer with protease inhibitors and PMSF. The mixture was next dispersed by ultrasonic (Cole-Parmer, #04714-51) , and then centrifuged at 12,000 rpm for 10 min at 4 ℃. The supernatant was collected for further analysis.

2.5 Western blot analysis Electrophoretic analysis of the extracted proteins was carried out on SDS-PAGE. After proteins being transferred to a polyvinylidene fluoride (PVDF) membrane, the membrane was taken out, washed by Tris-buffered saline with Tween (TBST), and blocked with 1% bovine serum albumin (BSA) on a rotary shaker for 1 h at room temperature. Next, the membrane was incubated with mouse anti-RAC1 antibody (Thermo, #16118) or mouse anti-GAPDH antibody (Beyotime, #AG019) on a rotary shaker overnight at 4°C. After the membrane being washed with TBST again, horseradish peroxidase (HRP)-labeled goat anti-mouse IgG (Beyotime, #A0216) was diluted 1000 times with 1% BSA and used to incubate with the membrane on a rotary shaker for 2 h at room temperature. Finally, the protein bands were visualized by chemiluminescent color reaction (ECL, Beyotime).

2.6 Rac1 activity detection


Page 8 of 39

Page 9 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Rac1 activity assay was detected using an Active Rac1 Pull-Down and Detection Kit (Thermo, #16118), according to the manufacturer’s protocol.

2.7 Quantitative polymerase chain reaction Transcriptional level of genes was evaluated with quantitative polymerase chain reaction (Q-PCR). SYBR Green Mix (Takara, RR420A) was used in the reaction system and the fluorescent signal was acquired using a detection apparatus (Roche, Light Cycler 480). The following primer sequences were used in this study: Genes

5′-3′

Primers

Human

Forward

CTGGCCTCCAGCTACATTTCT

SCX

Reverse

GTCACGGTCTTTGCTCAACTT

Human

Forward

TTCAAGGCAATGCTGAACGG

MKX

Reverse

CTCCCGCTTTGATGACCGAA

Human

Forward

AGCGAACGCACATCAAGAC

SOX9

Reverse

CTGTAGGCGATCTGTTGGGG

Human

Forward

GTTGCTGCTTGCAGTAACCTT

COL1

Reverse

Human

Forward

TGGACGCCATGAAGGTTTTCT

COL2

Reverse

TGGGAGCCAGATTGTCATCTC

Human

Forward

ATGCTGCCACAAATACCCTTT

COLX

Reverse

GGTAGTGGGCCTTTTATGCCT

Human

Forward

GGGGCTTTGATGTACCCTAGC

MMP1

Reverse

CAGTAGAATGGGAGTC

Human

Forward

CAGTAGAATGGGAGTC

MMP2

Reverse

GGCTTGCGAGGGAAGAAGTT

AGGGCCAAGTCCAACTCCTT



Genes

5′-3′

Primers

Human

Forward

GAACATCGACCAACTCTACTCCG

ADAMTS5

Reverse

CAATGCCCACCGAACCATCT

Human

Forward

GGCGTCCTGGAAGCCAATGTG

OCN

Reverse

GACCAGGAGGACCAGGAAGCCACGT

Human

Forward

AGGGCAGAATCATCACGAAGT

VEGF

Reverse

AGGGTCTCGATTGGATGGCA

Human

Forward

GCAAGTTCAACGGCACAG

GAPDH

Reward

CGCCAGTAGACTCCACGAC

2.8 Preparation of chitosan/β-glycerophosphate hydrogel We firstly dissolved 90 or 110 mg of chitosan powders (200-300 kD, Shanghai BioScience and Technology) in 4 mL of 0.1 M acetic acid (Sinopharm Chemical Reagent) and stirred overnight to make the homogeneous chitosan solution. To load the drug, 40 ul of NSC23766 (3.125 mg/ml) or isometric phosphate buffer solution (PBS) was added to the chitosan solution to continue stirring for another 4 h. Then we dissolved 300 mg, 450 mg or 600 mg of β-glycerophosphate (Sigma) in 1 ml of distilled water to get β-glycerophosphate solution. The solutions were stored in an ice bath for 10 min and next mixed in different concentrations by drop-wise adding 1 ml of β-glycerophosphate solution to 4 ml of chitosan solution and uniformly stirred for 10 min at the same time. The resulting solution was composed of 1.8% (w/v) or 2.2% (w/v) chitosan, 6%, 9% or 12% β-glycerophosphate, and 25 ug/ml of NSC23766. To test the sol-gel transition time, 1 ml of chitosan/β-glycerophosphate solution were added to a vial, placed at 37°C and tilted every minute until the solution changing into solidification state. As for the drug release efficiency, we incubated 1ml of the NSC23766 loaded chitosan/β-glycerophosphate hydrogel in 100 ml of PBS, and the 450 ul of the solution was taken


Page 10 of 39

Page 11 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for assay at 1, 2, 3, 4, 8, 12 hours, respectively, while the same volume of PBS was put back each time. The controlled release capacity of the hydrogel was measured using a microplate reader (Molecular Devices, SpectraMax 190), for that the absorbance of the extracts at 360 nm is specific for the small molecule NSC23766 and the OD value was normalized to the standard curve to calculate the concentration of NSC2376616.

2.9 Animal experiment All animal experiments were approved by the Experiment Animal Welfare Ethics Committee of Zhejiang University (ZJU20160428). 18 Sprague Dawley rats (8 weeks old, 200~220 g) were used in this study. Type I collagenase (Gibco, #17100017) was injected into the midpoint of Achilles’ tendon in SD rats (50 U/leg) to create a rapid degenerative tendinopathy model. After 1 week of type I collagenase injection, the Rac1 inhibitor NSC23766 (1.25 μg/leg, Selleck, S8031) encapsulated in 50 μl of the chitosan/β-glycerophosphate gel was injected subcutaneously into the degenerated areas in the right legs twice a week for up to 12 weeks, and the left legs were given PBS chitosan/β-glycerophosphate gel as controls. The rear ankles’ diameter was evaluated with a vernier caliper at weeks of 4, 8 and 12. Samples were collected after 4 weeks, 8 weeks and 12 weeks of treatments (i.e. 6 rats at each time point). Upon animal sacrifice at the indicated time, the legs and Achilles tendons were isolated and processed for X-ray analysis, histological analysis, immunohistochemistry, and western blot analysis.

2.10 X-ray analysis The whole legs were collected from rats, fixed in 4% paraformaldehyde and then photographed by



small animal X-ray imaging system (Faxitron Model MX-20).

2.11 Histological analysis and immunohistochemistry The isolated human and rat tendons were processed for histological analysis. First, tissues were fixed in 4% paraformaldehyde for 24 h, decalcified in 10% EDTA solution for 14 days at room temperature. Followed by dehydration with graded ethanol, clearing and wax immersion, samples were embedded in paraffin blocks. The sections (7 μm) were then prepared using a microtome, subsequently stained with H&E, Safranin O or Masson trichrome, eventually photographed under a microscope (Pannoramic MIDI, 3DHISTECH). The histological score was performed based on H&E staining according to the scoring system that is modified from a previous study20. Briefly, the six parameters (cell population, roundness of nuclei, inflammation, vascularity, fiber structure and arrangement,) were semi-quantitatively assessed with a score range 0-18. The lower score indicates better tissue quality. Safranin O staining and Bonar score21 were performed to examine and describe the tendon destruction. Briefly, the Bonar score was decided by tenocytes morphology, staining of the ground substance, collagen arrangement, and vascularity in the tissue. The higher score indicates severer tendon degeneration. For immunohistochemistry, human and rat tendons were fixed in paraformaldehyde and dehydrated with 30% sucrose for another 24 h. The sections (7 μm) were prepared using freezing microtome, subsequently blocked with 1% bovine serum albumin and incubated overnight with mouse anti-Rac1 antibody (Thermo, #16118), rabbit anti-SCX antibody (Abcam, ab84038), rabbit anti-MKX antibody (LifeSpan, LS-B8063), mouse anti-SOX9 antibody (Abcam, ab76997), rabbit anti-COL2 antibody (Abcam, ab116242), goat anti-VEGF antibody (R&D, AF-493-NA). After washed with TBST, the sections were incubated with HRP linked


Page 12 of 39

Page 13 of 39 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


secondary antibodies for 1.5 h. Finally, DAB 3, 30-diaminobenzidine solutions were used to visualize the immunoreactive proteins.

2.12 Statistical analysis Statistic differences among groups were assayed by one-way analysis of variance or student’s t test (GraphPad Prism 6.01). P values

Pharmacological inhibition of Rac1 activity prevents pathological

Recommend Documents