Phytoremediation of Phenanthrene by Transgenic Plants Transformed

Article pubs.acs.org/est

Phytoremediation of Phenanthrene by Transgenic Plants Transformed with a Naphthalene Dioxygenase System from Pseudomonas Ri-He Peng,† Xiao-Yan Fu,† Wei Zhao,† Yong-Sheng Tian,† Bo Zhu,† Hong-Juan Han,† Jing Xu,† and Quan-Hong Yao*,†,§ †

Agro-Biotechnology Research Institute, Shanghai Academy of Agricultural Sciences, 2901 Beidi Rd, Shanghai, 201106, People’s Republic of China § National Center for Plant Gene Research (Shanghai), 300 Feng Lin Rd, Shanghai, 200032, People’s Republic of China S Supporting Information *

ABSTRACT: Genes from microbes for degrading polycyclic aromatic hydrocarbons (PAHs) are seldom used to improve the ability of plants to remediate the pollution because the initiation of the microbial degradation of PAHs is catalyzed by a multienzyme system. In this study, for the first time, we have successfully transferred the complex naphthalene dioxygenase system of Pseudomonas into Arabidopsis and rice, the model dicot and monocot plant. As in bacteria, all four genes of the naphthalene dioxygenase system can be simultaneously expressed and assembled to an active enzyme in transgenic plants. The naphthalene dioxygenase system can develop the capacity of plants to tolerate a high concentration of phenanthrene and metabolize phenanthrene in vivo. As a result, transgenic plants showed improved uptake of phenanthrene from the environment over wild-type plants. In addition, phenanthrene concentrations in shoots and roots of transgenic plants were generally lower than that of wild type plants. Transgenic plants with a naphthalene dioxygenase system bring the promise of an efficient and environmental-friendly technology for cleaning up PAHs contaminated soil and water.

■

INTRODUCTION

During the last three decades, a large number of bacteria capable of degrading PAHs has been isolated from contaminated soils.21 Naphthalene dioxygenases play a major role in the degradation of PAHs by most bacteria.22 Bacteria, which utilize PAHs as the sole source of carbon and energy, always attack PAHs via dioxygenase primarily in the bay-region to form a cisdihydrodiol (Figure S1, Supporting Information). Here, we tried to introduce four genes encoding for a bacterial dioxygenase into plants to improve plants ability for PAHs metabolism. Phenanthrene was used as a model PAH in this research since it is found in high concentrations in a contaminated environment and has been shown to be toxic to plants.23,24 The selected naphthalene dioxygenase, which comprises an electron transport chain (ETC) and a terminal oxygenase, was from Pseudomonas putida and can metabolize naphthalene and phenanthrene efficiently.25 We found that all four genes were expressed in transgenic plants and assembled to an active naphthalene dioxygenase complex. The transgenic plants are able to tolerate and detoxify phenanthrene.

Polycyclic aromatic hydrocarbons (PAHs) are one of the most widespread environmental pollutants, which are produced during fossil fuel combustion, during waste incineration, or as byproducts of industrial processes.1,2 Many PAHs are often highly toxic, mutagenic, and carcinogenic.3,4 Due to their relationship with environmental health, the removal of PAHs from contaminated ecosystems is of great importance. Phytoremediation presents a potentially low cost and environmentally friendly approach to restore contaminated environments.5,6 Some plants, such as alfalfa,7 switchgrass,8 tall fescue,9 bluestem,10,11 and poplar12 are reported to have the potential to remediate PAHs contaminated soil. Almost all plants can assimilate PAHs from soil or the atmosphere.13 However, a slight portion of the compounds in vivo can be metabolized in plants.14,15 The residual PAHs in plants can subsequently enter the food chains and induce a potential health risk, such as childhood asthma, skin cancer, and lung cancer.16,17 Moreover, the absence of genes for PAHs degradation results in plants suffering from phytotoxicity. PAHs will induce oxidative stress as well as decreased biomass, photosynthetic pigments, and photosynthesis in plants.18,19 Severe oxidative stress can cause lipid peroxidation, DNA damage, and even programmed cell death.20 © 2014 American Chemical Society

Received: Revised: Accepted: Published: 12824

March 28, 2014 September 11, 2014 October 9, 2014 October 9, 2014 dx.doi.org/10.1021/es5015357 | Environ. Sci. Technol. 2014, 48, 12824−12832

Environmental Science & Technology

■

Article

Reverse Transcription (RT) and Quantitative Realtime RT-PCR Analyses. The homozygous genotypes of transgenic plants were obtained from self-fertilization and confirmed by the complementation test. Total RNA was extracted and purified from the seedling with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) together with an RNase-Free DNase Set (Qiagen) to remove DNA contamination. cDNA of the plants was synthesized from total RNA using Reverse Transcription Reagent (Takara, Shiga, Japan). To test the quality of RNA samples, a pair of oligonucleotide primers (AtAc2Z1: 5′-GCACCCTGTTCTTCTTACCGAG-3′; AtAc2F1: 5′-AGTAAGGTCACGTCCAGCAAGG-3′ specific to Arabidopsis actin gene AtAc2 and primers 5′-AAGATCCTGACGGAGCGTGGTTAC-3′; 5′-CTTCCTAATATCCACGTCGCACTTC-3′ specific to rice actin gene RAc1 (GenBank X16280)) were used as positive internal control for PCR analyses. Real-time PCR was performed in a Mini Option Real-time PCR System (Bio-Rad, CA, USA) with conditions of 95 °C for 10 s, 30 cycles of three steps (95 °C for 5 s, 58 °C for 10 s, and 72 °C for 31 s), and a dissociation step with a melting temperature of 58 °C. The reaction mix contained cDNA with 20 ng of total RNA, 0.2 μM of each primer, 0.2 μM SYBR, 3 mM MgCl2, 200 μM each of dATP, dCTP, and dGTP, 400 μM dUTP, and 1 unit of Taq DNA polymerase. All analyses were performed in triplicate. Enzyme Activity Assay. The activity of naphthalene dioxygenase was determined by measuring the formation of cis-naphthalene dihydrodiol from naphthalene. Every compound of the naphthalene dioxygenase system was expressed as fused His-tagged proteins in E. coli and purified with Ni-NTA Agrose (Qiagen). The enzyme activity assay was performed in 500 μL of 50 mM MES buffer, pH 6.8. Reaction mixtures contained 200 μL of protein (each compound with equimolar concentration of 0.5 nmol), 0.4 mM NADH, 1 mM ferrous ammonium sulfate, and 10 mM naphthalene dissolved in acetone. About 5 mg of plant crude protein was added to the reaction mixtures. The plant crude protein was extracted from 10 g of seedling, which was ground under liquid nitrogen and suspended in 2 volumes of grinding buffer, 50 mM Tris (pH 7.5), 10% (wt/vol) glycerol plus 2 mM phenylmethylsulfonyl fluoride. After incubation at 30 °C for 2 h, the reaction sample was extracted with ethyl acetate and dried using a rotary evaporator. Dried residues were dissolved in 200 μL of acetonitrile and silylanized according to Kim et al.’s method30 with 100 μL of silylation reagents (N,O-bistrimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane) and analyzed by gas chromatography−mass spectrometry (GC-MS). GC-MS analyses were performed using a Hewlett-Packard 7890A gas chromatograph, coupled with a Hewlett-Packard mass-selective detector 5973N quadruple mass spectrometer (Agilent Technologies Inc.). The column oven temperature was programmed to rise from an initial temperature of 40 to 250 °C at a rate of 4 °C/min and maintained at 250 °C for 5 min. The injection port temperature and interface temperature were both 250 °C. Helium (99.999%) was used as the carrier gas with a constant flow rate of 1.0 mL/min. Electron ionization (EI) was achieved at 70 eV electron energy and 230 °C ion source temperature. The standard cis-naphthalene dihydrodiol was silylanized completely and used to draw a standard curve for GC-MS quantification, and the limit of detection (LOD) for the standard was 1.5 ng/mL.

MATERIALS AND METHODS Plasmid Construction. The NahAa, NahAb, NahAc, and NahAd genes, encoding the ferredoxin reductase, ferredoxin, the large subunits (α), and the small subunits (β) of terminal dioxygenase from Pseudomonas putida G7, respectively (GenBank M83949), were chemically synthesized according to the bias codons of plant. The chemically synthesized NahAa gene was amplified using primers: P1 (5′-CGGGATCCATGGAATTGTTGATTCAACCAAACAATC-3′)/P2 (5′GCGAGCTCTCAGATTCCACCAGGATAGAAGGCATC3′). Similarly, chemically synthesized NahAb was amplified using primers: P3 (5′-CGGGATCCATGACAGAAAAATGGATTGAAG-3′)/P4 (5′-GCGTCGACTTAGAACTCTCCAGACAAGTCGATC-3′). NahAa was digested with BamHI and Sac I and then cloned into pYP1203E (without tzs and vhb gene expression cassette) instead of the EPSP gene.26 NahAb was digested with BamHI and Sph I and cloned into pYP1203E (without EPSP gene expression cassette). Promoter CaMV 35S/TMV omega (Genbank AY183361) and terminator NOS were inserted into upward and downward positions of the synthesized gene, yielding plasmid pYP1203E-35S-NahAa and pYP1203E-35S-NahAb. The synthesized NahAc and NahAd genes were reamplified using primers: P5 (5′-CGCTCGAGATGAACTACAAGAACAAGATCTTGGTATCTG-3′)/P6 (5′GCGGATCCTTAACGATCAGTAGTCTTCGTCAACTCAG-3′) and P7 (5′-C GGGATCCATGATGATCAACATCCAAGAAGACAAG-3′)/P8 (5′-GCGAATTCTCACAAGAAGACCATCAAGTTGTGCGT-3′). NahAc (using P5 and P6) was digested with BamHI and Sac I and NahAd (using P7 and P8) was digested with BamHI and EcoR I and then cloned into pBBR1MCS-5 (GenBank U25061.1). Following added suitable restriction sites, promoter CaMV 35S/TMV omega and terminator NOS were inserted into the corresponding restriction sites on both ends of NahAc, yielding plasmid pBBR1-35S-NahAc. Similarly, promoter CaMV 35S/TMV omega and terminator NOS were used to construct NahAd expression cassette plasmid pBBR1-35S-NahAd. To remove the duplicate restriction sites in the constructed gene expression cassettes, one base in every restriction sites of EcoRI, SalI, KpnI, XbaI, and HindIII was mutated by a site-directed mutagenesis method.27 At last, the gene expression cassettes for NahAa, NahAb, NahAc, and NahAd were cut with EcoRI and SalI, SalI and KpnI, KpnI and XbaI, and XbaI and HindIII and inserted into a modified pCAMBIA1301 vector step by step, yielding the final constructs, pNahAabcd. Plant Transformation. The plasmid pNahAabcd were introduced into Agrobacterium tumefaciens GV3101 and EHA105, respectively, and then transformed to Arabidopsis thaliana according to the reported flower dip method28 and rice cultivar based on the method of Hiei and Komari.29 The transgenic Arabidopsis was screened in select plates containing 50 mg/L hygromycin. For rice transformation, the immature embryos were dissected aseptically and cultured on solid N6 medium at 25 °C in a dark condition for 5 d. The compact calli were separated with a scalpel and cocultured with Agrobacterium for 3 days at 22 °C in the dark for 3 d and then transferred to selective N6 media containing 30 mg/L hygromycin. After three rounds of selection, the green yellow granular embryos were transferred to a differentiation MS medium (containing 2.5 mg/L 6-BA, 0.2 mg/L NAA). Then, the seedlings were transferred to a rooting medium (containing 0.1 mmol/L glyphosate, 0.2 mg/L NAA and 1/2 MS). 12825

dx.doi.org/10.1021/es5015357 | Environ. Sci. Technol. 2014, 48, 12824−12832


Article

Figure 1. Expression of Pseudomonas naphthalene dioxygenase in transgenic plants and enzyme activity determined. (a, b) Real-time RT-PCR analysis of the four naphthalene dioxygenase gene expression in transgenic Arabidopsis (a) and rice (b). Data are means from analysis of three independent seed batches. Error bars indicate the standard deviation (SD). (c, d) Enzyme activity assay for naphthalene dioxygenase expressed in transgenic Arabidopsis and rice. (c) Ion chromatograms of the metabolites formed from the heteroexpressing protein with naphthalene. The extract protein of wild-type Arabidopsis acted as a control. (d) Comparison of naphthalene dioxygenase activity in different transgenic plant lines.

chlorophyll content analysis. Chlorophyll content was determined according to the Lichtenthaler method.31 Hydrogen peroxide was determined as described by Alexieva et al.32 The seedlings of 15-day-old Arabidopsis and 7-day-old rice were cultured in liquid half-strength MS medium with 0.2 mM phenanthrene for 15 days. Malondialdehyde 4-hydroxyalkenals (MDA) was measured with seedlings from 0.2 mM phenanthrene treated plants according to the method of Zhang et al.33 Phenanthrene Remediation Assay in Closed Environment. The germinated seeds (50 per flask for Arabidopsis and 10 per flask for rice) were transferred aseptically to 50 mL conical flasks containing 0.2 mM phenanthrene in half-strength MS medium. The flasks were covered with plastic material and fastened by a strong rubber band to reduce PAHs lost. The quantity of phenanthrene in medium and seedling was inspected separately after growth for 3 weeks. The shoots and roots were washed with distilled water to remove any particles or absorbed phenanthrene absorbed on the surface of root. Phenanthrene was extracted using 1 mL of dichloromethane/hexane (3:7) per 0.1 g of sample. The extraction was dried in a rotary evaporator and dissolved with 100 μL of acetonitrile. The amounts of PAH in the medium and plant tissue were determined by GC by comparing their peak areas with that of inner standard: phenanthrene-d10. The detection limits of the instrument and the extraction method for

The plant crude protein was also used to examine the formation of cis-phenanthrene dihydrodiol from phenanthrene. Reaction mixtures contained 5 mg of crude protein, 0.4 mM NADH, 1 mM ferrous ammonium sulfate, and 10 mM phenanthrene. Metabolites were extracted, dried, dissolved, and then silylanized for GC analysis with the same method for naphthalene. To determine the special ion chromatogram of phenanthrene degradation products, the metabolites were purified with an HPLC system (Hewlett-Packard 1100) and then detected with GC-MS. The gradient elution for HPLC was performed at a flow rate of 1.0 mL/min using a mobile phase of methanol/water (from 45:55 to 95:5 [vol/vol]).30 Plant Resistance Assay. To observe the plants growth under the stress of phenanthrene, seeds of Arabidopsis and rice were sown and grown in 50 mL flasks containing 20 mL of solid half-strength MS medium with a concentration of 0.2 mM phenanthrene. Phenanthrene was initially dissolved in acetone and then added to the culture medium to get the final concentration (acetone/medium, v/v = 1:1000). Arabidopsis was incubated at a 16/8 h day and night photoperiod at 22−25 °C for 30 d, and rice was grown at 28−30 °C for 15 days. To determine the chlorophyll content of plants, the seedlings of 15-day-old Arabidopsis and 7-day-old rice were cultured in a liquid half-strength MS medium with 0.2 mM phenanthrene for 15 days. Leaves three to five (in order of appearance) in Arabidopsis and leaves two to three in rice were used for 12826



Article

Figure 2. Overexpression of the Pseudomonas naphthalene dioxygenase system enhanced transgenic Arabidopsis tolerance against phenanthrene and reduced phenanthrene accumulation in plants and the environment. (a) Comparison of transgenic and wild-type plants growth exposed to 0.2 mM phenanthrene stress for 30 d. (b) The weight of seedling was affected by phenanthrene. (c) Ion chromatograms of the metabolites formed from the plant crude extraction with phenanthrene. (d) Average chlorophyll content of 15-day-old seedlings grown under 0.2 mM phenanthrene stress for 15 d. Malondialdehyde 4-hydroxyalkenal (MDA) (e) and H2O2 content (f) in 15-day-old seedlings grown under 0.2 mM phenanthrene stress for 15 d. (g, h) GC-MS analysis of phenanthrene degradation by transgenic Arabidopsis. (g) Relative phenanthrene residue in the culture medium containing 0.2 mM phenanthrene for wild-type and transgenic seedlings after 30 d. (h) Phenanthrene content in plants grown on 0.2 mM phenanthrene medium for 30 d. Data are the means of three independent experiments. Bars with ∗ showed the significant difference (p < 0.05) with WT (three different tests). FW, fresh weight.

phenanthrene were 0.48 pg and 0.25 ng/mL, respectively. The mean recoveries and the relative standard deviations of this

method for phenanthrene were in the ranges of 85−98% and 0.82−0.95%, respectively. 12827



Article

Phytoremediation of Phenanthrene in Soil or Water. To investigate the in situ phytoremediation potential of transgenic plants, the mature plants were tested to remove the phenanthrene from soil (Arabidopsis) or water (rice). The experiment to evaluate transgenic plants contribution to phytoremediation removal was designed according to the Van Dillewijn et al. method.34 For Arabidopsis, seedlings of uniform size were transplanted to synthetic soil, a mixture of peat/ vermiculite/perlite (1:8:1, v/v/v). The organic matter content in soil was 3.2% and the pH was 5.4. After achieving growth of 4−5 leaves per seedling, the robust seedlings were transferred to new assay pots containing phenanthrene and grown for 30 days. Soils were spiked with different amounts of phenanthrene dissolved in acetone. When acetone was evaporated off, the spiked soils (10% of the total quantity of soil) were mixed with unpolluted soils. The treated soils were packed into pots (200 g) and equilibrated in a glass greenhouse for 2 d. Then, the soils were fertilized with 1.64 g of KH2PO4 and 2.28 g of NH4NO3 /kg dry wt of soil and kept at 60% of water holding. For rice, seedlings of 15-day-old were transfer to liquid half-strength MS medium containing phenanthrene and grown for 30 days. Initial total concentrations of phenanthrene in the soil and water were 20, 50, and 100 mg/kg soil or water. To prevent biological degradation of phenanthrene, the unspiked soil and liquid medium was sterilized, and then, a mixture of 0.01% CaCl2 and 0.2 g/L NaN3 was added. The soil and water samples were collected at different intervals (5, 15, 30 days) for extracting phenanthrene with three replicates each. The plants were harvested after 30 days. The shoots were removed by cutting, and the roots were obtained by washing with deionized water and 20% methanol for three times to remove phenanthrene absorbed to the root surface. All the shoots and roots of different plant types in three replicates were collected, respectively, and extracted with dichloromethane/hexane (3:7). Statistical Analysis. All experiments were carried out using three replicates. The results between treatments were analyzed by one-way analysis of variance (ANOVA). Statistical significance was evaluated by the F-test at the 5% level (95% confidence level).

Arabidopsis and R1, R12, and R5 in transgenic rice. However, the electron transport chain NahAa and NahAb showed the highest expression levels in A3 and R12, respectively. All transgene-derived mRNA, as expected, was not observed in wild-type plants (Figure 1a,b). As the protein was expressed in E. coli, the crude proteins extracted from transgenic lines had significant activity to transform naphthalene to cis-naphthalene dihydrodiols (Figure 1c; Figures S3 and S4a, Supporting Information). Of the 3 transgenic Arabidopsis lines, the A7 showed the highest enzyme activity and produced up to 38.4 μg of cis-naphthalene dihydrodiols/mg of solution protein per hour. In contrast, no cis-naphthalene dihydrodiols were detected in extracts from wild-type plants. The rice transgenic line R1, which showed high level expression of the terminal oxidase NahAc and NahAd, produced the most amounts of cis-naphthalene dihydrodiols too (Figure 1d). These results indicated that the subunits of terminal oxidase NahAc and NahAd were assembled correctly in plants and showed enzyme activity toward naphthalene with the help of NahAa and NahAb. The activity of the dioxygenase was associated with the expression level of terminal oxidase. Naphthalene Dioxygenase Transgenic Arabidopsis Increase Phenanthrene Tolerance. The transgenic Arabidopsis exhibited more resistance to phenanthrene than wildtype plants (WT). Under phenanthrene stress for 30 d, the surface area of comparable leaves in transgenic lines was 3.2− 8.5 times larger than that in WT plants (Figure S5a, Supporting Information); the number of root hairs of the transgenic lines was 10 times more than that of the WT (Figure 2a), and the fresh weight of WT was only 21.7−26.8% of transgenic plants (Figure 2b). GC-MS analysis revealed that transgenic seedling extracted proteins can metabolize phenanthrene to two specific compounds, which had the same GC-MS properties (molecular ion at m/z 356) with trimethylsiylated derivative of phenanthrene cis-dihydrodiol (Figure 2c; Figure S4b, Supporting Information). NahA transgenic seedlings showed significantly higher chlorophyll levels than WT plants after treatment with 0.2 mM phenanthrene (Figure 2d). WT plants also exhibited a more significant increase in MDA than the transgenic lines (Figure 2e). A similar change in H2O2 content in WT and transgenic lines was observed in response to phenanthrene stress (Figure 2f). All these results indicate that the introduced dioxygenase system can improve Arabidopsis tolerance to phenanthrene. Naphthalene Dioxygenase Increase Phenanthrene Uptake but Not Accumulation in Arabidopsis. After growing for 3 weeks in a closed environment, GC-MS analysis indicated that all plants can remove phenanthrene from the surrounding media, but transgenic plants removed phenanthrene more quickly than WT plants. About 23.5−42.7% phenanthrene was removed from the medium by different transgenic lines, while only 7.8% phenanthrene was removed by WT plants (Figure 2g). In addition, the phenanthrene concentration in transgenic lines was significantly lower than that of WT plants grown on the same medium (Figure 2h). These results indicated that the rate of absorption is associated with plant biomass and the transformation of phenanthrene. Naphthalene Dioxygenase Improve Rice Phenanthrene Tolerance and Uptake. The enzyme components expressed in transgenic rice can transform phenanthrene to cisphenanthrene dihydrodiols as in Arabidopsis (Figure 3a; Figure

■

RESULTS Genetic Transformation of Arabidopsis. The synthesized genes have avoided plant scarce codons, XCG and XUA, the mean values of which in dicots are 1.8% and 3.2%, respectively, and 6.3% and 1.4% in monocots, respectively. The resulting plasmid pNahAabcd harbored a 9 kb DNA fragment, which contained four gene expression cassettes in a tandem manner, with every gene surrounded by the double CaMV 35S promoter and the NOS terminator (Figure S2, Supporting Information). By PCR assay, 12 Arabidopsis and 18 rice NahA transgenic individuals were confirmed to harbor all of the four genes. Among the transgenic plants, three Arabidopsis transgenic lines (A3, A7, and A9) and three rice transgenic lines (R1, R5, and R12) were conformed to be single insertion and used for further study. Expression of the Naphthalene Dioxygenases System in Transgenic Plants. Real-time RT-PCR revealed that the expression levels of the individual transgenes were not associated with the lines. The rank order of expression of transgenes for the terminal oxidase NahAc and NahAd, from the highest to the lowest was A7, A3, and A9 in transgenic 12828



Article

Figure 3. Overexpression of the Pseudomonas naphthalene dioxygenase system enhanced rice tolerance against phenanthrene and phenanthrene degradation. (a) Ion chromatograms of the metabolites formed from the crude extraction of rice seedlings with phenanthrene. (b, c) Comparison of the plant growth under 0.2 mM phenanthrene stress. (b) Wild-type (WT) and transgenic rice seedlings were exposed to phenanthrene and grown at 28−30 °C for 15 days. (c) Chlorophyll content of 7-day-old seedlings grown on medium with or without phenanthrene for 15 d. (d) Average fresh weight of rice seedlings grown on medium containing 0.2 mM phenanthrene for 15 d. Malondialdehyde 4-hydroxyalkenal (MDA) (e) and H2O2 content (f) in 7-day-old seedlings grown on medium with or without phenanthrene stress for 15 d. (g, h) GC-MS analysis of phenanthrene removal by transgenic rice. (g) Relative phenanthrene residue in the phenanthrene containing culture medium for wild-type and transgenic rice after 30 d. (h) Phenanthrene content in vivo of seedlings exposed to 0.2 mM phenanthrene stress for 15 d. Bars with ∗ showed the significant difference (p < 0.05) with WT. FW, fresh weight.

associated with lower MDA and H2O2 levels than in WT plants (Figure 3e,f). NahA transgenic rice plants contained significantly low levels of phenanthrene in vivo than WT plants. However, transgenic rice plants can remove phenanthrene from the medium more quickly than WT plants after 3 weeks of growth. The residue of phenanthrene in the medium for WT plants was almost 4 times as much as that in the medium for transgenic rice plants (Figure 3g,h). Phytoremediation of Phenanthrene Pollution in Soil and Water by Transgenic Plants. The temporal changes of concentrations of phenanthrene in soil and water under the

S5b, Supporting Information). Transgenic rice also showed improved tolerance to phenanthrene. As shown in Figure 3b, addition of 0.2 mM phenanthrene to the incubation medium inhibited shoot growth for both WT and transgenic rice plants, while the NahA transgenic lines showed longer shoots and roots than WT. Therefore, a greater reduction in fresh weight of WT plants was observed (Figure 3c). In addition, most of the transgenic seedlings retained higher chlorophyll levels than WT, which showed severe chlorosis under 0.2 mM phenanthrene (Figure 3d). The enhanced resistance of NahA transgenic rice to a high concentration of phenanthrene was 12829



Article

Table 1. Residual Concentrations of Extractable Phenanthrene in Soil and Water for Arabidopsis and Rice over Time and Phenanthrene Concentrations in Shoots and Roots at the End of the Experimenta plants Phe spiked (mg/kg) 20

0 day Arabidopsis

rice

50

Arabidopsis

rice

100

Arabidopsis

rice

a

Phe concentration (mg/kg) in plants

Phe concentration (mg/kg) soil or water unplanted wild type A3 A7 A9 unplanted wild type R1 R5 R12 unplanted wild type A3 A7 A9 unplanted wild type R1 R5 R12 unplanted wild type A3 A7 A9 unplanted wild type R1 R5 R12

18.5 18.5 18.5 18.5 18.5 19.3 19.3 19.3 19.3 19.3 48.8 48.8 48.8 48.8 48.8 49.5 49.5 49.5 49.5 49.5 97.2 97.2 97.2 97.2 97.2 98.5 98.5 98.5 98.5 98.5

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

5 day

2.21 2.21 2.21 2.21 2.21 1.15 1.15 1.15 1.15 1.15 2.06 2.06 2.06 2.06 2.06 1.04 1.04 1.04 1.04 1.04 2.82 2.82 2.82 2.82 2.82 1.66 1.66 1.66 1.66 1.66

18.1 16.6 16.2 15.8 16.2 18.9 16.5 16.1 16.2 16.2 48.2 44.9 43.5 43.2 44.1 49.0 44.2 42.8 43.1 43.3 96.8 87.5 86.8 86.2 87.5 97.2 84.5 83.2 84.0 83.2

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

1.68 0.76 1.24 0.85 1.07 1.33 0.75 0.82 1.02 0.85 1.69 1.74 0.89 1.22 1.66 1.12 1.56 1.17 1.61 1.08 1.36 1.56 1.72 1.28 1.06 1.79 1.17 1.75 1.44 1.58

15 day

30 day

shoots

roots

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

1.12 0.78 1.24 0.95 1.84 1.63 1.36 0.65 1.12 1.83 1.25 1.41 1.22 0.75 1.58 1.02 1.72 1.05 1.14 0.84 1.17

± ± ± ± ± ± ± ±

1.44 1.06 1.21 1.61 1.25 1.25 1.12 1.26

17.6 ± 1.65 13.9 ± 1.06 11.6 ± 0.72 11.2 ± 1.14 12.4 ± 1.06 17.2 ± 1.02 13.5 ± 0.88 7.9 ± 1.13 10.2 ± 1.04 9.6 ± 0.75 46.5 ± 1.74 41.6 ± 1.04 35.2 ± 1.36 32.4 ± 1.08 38.6 ± 1.22 44.9 ± 1.06 37.5 ± 1.31 22.7 ± 1.02 30.2 ± 1.18 25.3 ± 1.72 92.4 ± 1.87 ND 65.3 ± 1.17 60.6 ± 1.24 ND 92.6 ± 2.03 77.6 ± 1.42 52.4 ± 1.91 61.2 ± 1.22 58.5 ± 1.36

− 0.21 0.12 0.09 0.16 − 0.05 0.03 0.04 0.04 − 0.26 0.15 0.12 0.20 − 0.06 0.03 0.05 0.04 − ND 0.34 0.30 ND − 0.09 0.05 0.07 0.05

− 1.58 0.96 0.71 1.30 − 1.28 0.66 0.92 0.87 − 2.04 1.16 0.85 1.69 − 1.26 0.68 1.05 0.96 − ND 3.45 2.66 ND − 2.43 1.35 1.98 1.82

17.7 15.2 14.4 13.7 14.8 17.9 14.8 12.5 13.4 12.8 47.6 43.1 39.4 36.6 41.5 47.1 40.5 34.2 38.8 35.6 95.3 ND 77.5 73.8 84.4 95.1 80.3 66.5 72.6 70.4

Data represents mean values ± standard error, based on three independent determinations. ND means not detected.

■

DISCUSSION In this paper, we have successfully assembled a cassette with four genes for the naphthalene dioxygenases system into a large plant expression vector and introduced the system into Arabidopsis and rice. The results of real-time PCR showed clearly that all four genes were expressed in transgenic plants (Figure 1). In vitro assays also showed that the crude protein of transgenic plants can catalyze the dioxygenation of naphthalene and phenanthrene. Prior to our study, Mohammadi et al.35 had individually transformed each single gene of another four-genes dioxygenase system, biphenyl dioxygenase, to tobacco. The complex of those components purified from transgenic plants could catalyze the oxygenation of 4-chlorobiphenyl. Unfortunately, they failed to create a transgenic plant expressing simultaneously all four genes. Constructing a large multicassette plant expression vector poses a significant challenge. One of the major drawbacks for multiple genes expression vector construction is that only conventional type II endonucleases can be used in the cloning of DNA fragments.36 So far, only a few successful experiments have been conducted in plant multigene engineering, including the famous golden rice37 and polyhydroxybutyrate polyester Arabidopsis.38 To overcome this limitation, we eliminated the common restriction sites with degenerate codons in all transgenes and assembled the cassette in different clone vectors.

treatments with different types of plants are shown in Table 1. Throughout the 30-day experiment, the removal of phenanthrene in the soil and water cultivated with NahA transgenic plants was faster than that in WT plants. The concentration of phenanthrene was reduced to 32.4 mg/kg when cultivated with NahA transgenic Arabidopsis line A7 from 50 mg/kg phenanthrene spiked soil, while it was 41.6 mg/kg phenanthrene in the same concentration of soil cultivated with WT plants. Uptake of phenanthrene by plants was faster at the first 15 days than at the last 15 days. In addition, the plant uptake and accumulation of phenanthrene were correlated with the spiked PAH concentration. Root or shoot accumulation of phenanthrene in contaminated soils was elevated with the increase of the PAH concentrations in soil, but the phenanthrene concentration in transgenic plants is lower than wild-type plants. Similar results were shown in the liquid medium for rice growth. In liquid medium spiked with 50 mg/ kg phenanthrene, about 37.5 mg/kg phenanthrene was reserved in media for wild plants, while there was only 22.7−30.2 mg/kg phenanthrene in the media for transgenic rice lines after 30 days (Table 1). These results demonstrated that NahA transgenic plants have a great potential to accelerate the bioremediation process of phenanthrene-contaminated soil or water conditions. 12830



Article

ment transformation fund (133919N1300), National Natural Science Foundation (31200212), and Basic research in the field of science and technology project of Science and Technology Commission of Shanghai Municipality (14JC1403602).

PAHs can exhibit toxicities to plants, such as inhibiting seed germination, arresting leaf and root growth, reducing photosynthetic efficiency,39,40 and inducing accumulation of H2O2, oxidative stress, and even cell death.19,41 In this study, transgenic plants expressing naphthalene dioxygenase showed improved tolerance to phenanthrene over wild-type plants. They produced more roots, biomass, and chlorophyll but contained a lower level of lipid peroxidation and H2O2. It may be a consequence of low concentrations of phenanthrene accumulated in plant shoots because naphthalene dioxygenase can transform PAHs to dihydrodiol, which may be further transformed to glycol-conjugates. There are two benefits for breeding transgenic plants expressing naphthalene dioxygenase. One is that transgenic plants can be used to restore the areas contaminated with high concentration PAHs. Phytoremediation was largely dependent on microbes colonized in growing roots.42 In the PAHs highly contaminated region, plants themselves have to suffer from phytotoxicity and plant biomass was finally reduced.43 Naphthalene dioxygenase helps transgenic plants increase tolerance to high PAHs, and in turn, living plants will promote the microbe’s growth and degrade PAHs more quickly. The other benefit was that naphthalene dioxygenase can decrease PAHs residues in food commodities. Evidence of PAH contamination of agricultural crops is rapidly rising with the development of industry. For example, vegetables collected an average value of 1173 μg/kg PAHs in the Pearl River Delta of southern China.44 In conclusion, we have shown that transferring the Pseudomonas naphthalene dioxygenase into plants can improve the ability of plants to tolerate and uptake phenanthrene. To the best of our knowledge, this is the first report to express all four genes of naphthalene dioxygenase in the plants and assemble them in a way to metabolize PAHs. For large-scale and more effective PAHs phytoremediation or food safety, the naphthalene dioxygenase system could be transferred into more robust plant species and perennial grasses.

■

■

(1) Samanta, S. K.; Singh, O. V.; Jain, R. K. Polycyclic aromatic hydrocarbons: Environmental pollution and bioremediation. Trends Biotechnol. 2002, 20, 243−248. (2) Menzie, C. A.; Potocki, B. B.; Santodonato, J. Exposure to carcinogenic PAHs in the environment. Environ. Sci. Technol. 1992, 26 (7), 1278−1284. (3) Sato, H.; Aoki, Y. Mutagenesis by environmental pollutants and bio-monitoring of environmental mutagens. Curr. Drug Metab. 2002, 3, 311−319. (4) Armstrong, B.; Hutchinson, E.; Unwin, J.; Fletcher, T. Lung cancer risk after exposure to polycyclic aromatic hydrocarbons: A review and meta-analysis. Environ. Health Perspect. 2004, 112, 970− 978. (5) Doty, S. L. Enhancing phytoremediation through the use of transgenics and endophytes. New Phytol. 2008, 179, 318−333. (6) Ruiz, O. N.; Alvarez, D.; Torres, C.; Roman, L.; Daniell, H. Metallothionein expression in chloroplasts enhances mercury accumulation and phytoremediation capability. Plant Biotechnol. J. 2011, 9, 609−617. (7) Liu, S. L.; Luo, Y. M.; Cao, Z. H. Degradation of benzo[a]pyrene in soil with aebuscular mycorrhizal alfalfa. Environ. Geochem. Health 2004, 26, 285−293. (8) Reilley, K. A.; Banks, M. K.; Schwab, A. P. Organic chemicals in the environment: Dissipation of polycyclic aromatic hydrocarbons in the rhizosphere. J. Environ. Qual. 1996, 25, 212−219. (9) Cheema, S. A.; Khan, M. I.; Shen, C.; Tang, X.; Farooq, M.; Chen, L.; Zhang, C.; Chen, Y. Degradation of phenanthrene and pyrene in spiked soils by single and combined plants cultivation. J. Hazard. Mater. 2010, 177, 384−389. (10) Parrish, Z. D.; Banks, M. K.; Schwab, A. P. Assessment of contaminant liability during phytoremediation of polycyclic aromatic hydrocarbon impacted soil. Environ. Pollut. 2005, 137, 187−197. (11) Aprill, W.; Sims, R. C. Evaluation of the use of prairie grasses for stimulating polycyclic aromatic hydrocarbon treatment in soil. Chemosphere 1990, 20, 253−265. (12) Widdowson, M.; Shearer, S.; Andersen, R. G.; Novak, J. T. Remediation of polycyclic aromatic hydrocarbon compounds in groundwater using poplar trees. Environ. Sci. Technol. 2005, 39, 1598−1605. (13) Gao, Y.; Zhu, L. Plant uptake, accumulation and translocation of phenanthrene and pyrene in soils. Chemosphere 2004, 55, 1169−1178. (14) Gao, Y.; Li, Q.; Ling, W.; Zhu, X. Arbuscular mycorrhizal phytoremediation of soils contaminated with phenanthrene and pyrene. J. Hazard. Mater. 2011, 185, 703−709. (15) Dixit, P.; Mukherjee, P. K.; Sherkhane, P. D.; Kale, S. P.; Eapen, S. Enhanced tolerance and remediation of anthracene by transgenic tobacco plants expressing a fungal glutathione transferase gene. J. Hazard. Mater. 2011, 192, 270−276. (16) Isabel, M.; Gemma, P.; Roser, M.; Victòria, C.; Juan, M. L.; José, L. D. Polycyclic aromatic hydrocarbons (PAH) in foods and estimated PAH intake by the population of Catalonia, Spain: Temporal trend. Environ. Int. 2010, 36 (5), 424−432. (17) Kim, H.; Hwang, J. Y.; Ha, E. H.; Park, H.; Ha, M.; Lee, S. H.; Hong, Y. C.; Chang, N. Fruit and vegetable intake influences the association between exposure to polycyclic aromatic hydrocarbons and a marker of oxidative stress in pregnant women. Eur. J. Clin. Nutr. 2011, 65, 1118−1125. (18) Liu, H.; Weisman, D.; Ye, Y. B.; Cui, B.; Huang, Y. H.; ColonCarmona, A.; Wang, Z. H. An oxidative stress response to polycyclic aromatic hydrocarbon exposure is rapid and complex in Arabidopsis thaliana. Plant Sci. 2009, 176, 375−382.

ASSOCIATED CONTENT

S Supporting Information *

Details for PCR; catabolic pathway for degradation of PAHs; schematic representation of the T-DNA regions of the plasmids harboring the four gene cassettes utilized for transformation of rice and Arabidopsis; expression and purification of each compound of the naphthalene dioxygenase system in E. coli; mass spectra of the PAH cis-dihydrodiol; overexpression of the Pseudomonas naphthalene dioxygenase system enhanced transgenic plant tolerance against phenanthrene. This material is available free of charge via the Internet at http://pubs.acs.org.

■

REFERENCES

AUTHOR INFORMATION

Corresponding Author

*Tel: 086-021-62203180; fax: 086-021-62203180; e-mail: yao. [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS The research was supported by the Key Project Fund of the Shanghai Municipal Committee of Agriculture (No. 2014D-2, 2013D-8), International Scientific and Technological Cooperation (13440701700), Agriculture science technology achieve12831



Article

(19) Ahammed, G. J.; Yuan, H. L.; Ogweno, J. O.; Zhou, Y. H.; Xia, X. J.; Mao, W. H.; Shi, K.; Yu, J. Q. Brassinosteroid alleviates phenanthrene and pyrene phytotoxicity by increasing detoxification activity and photosynthesis in tomato. Chemosphere 2012, 86, 546− 555. (20) Weisman, D.; Alkio, M.; Colón-Carmona, A. Transcriptional responses to polycyclic aromatic hydrocarbon-induced stress in Arabidopsis thaliana reveal the involvement of hormone and defense signaling pathways. BMC Plant Biol. 2010, 10, 1−13. (21) Habe, H.; Omori, T. Genetic of polycyclic aromatic hydrocarbon metabolism in diverse aerobic bacteria. Biosci. Biotechnol. Biochem. 2003, 67, 225−243. (22) Peng, R. H.; Xiong, A. S.; Xue, Y.; Fu, X. Y.; Gao, F.; Zhao, W.; Tian, Y. S.; Yao, Q. H. Microbial biodegradation of polyaromatic hydrocarbons. FEMS Microbiol. Rev. 2008, 32, 927−955. (23) Alkio, M.; Tabuchi, T. M.; Wang, X.; Colón-Carmona, A. Stress responses to polycyclic aromatic hydrocarbons in Arabidopsis includes growth inhibition and hypersensitive response-like symptoms. J. Exp. Bot. 2005, 56, 2983−2994. (24) Zhao, H.; Wu, Q.; Wang, L.; Zhao, X.; Gao, H. Degradation of phenanthrene by bacterial strain isolated from soil in oil refinery fields in Shanghai China. J. Hazard. Mater. 2009, 164, 863−869. (25) Simona, M. J.; Osslunda, T. D.; Saundersa, R.; Ensleya, B. D.; Suggsa, S.; Harcourta, A.; Wen-chenb, S.; Cruderb, D. L.; Gibsonb, D. T.; Zylstra, G. J. Sequences of genes encoding naphthalene dioxygenase in Pseudomonas putida strains G7 and NCIB 9816-4. Gene 1993, 127, 31−37. (26) Cao, M.; Huang, J.; Wei, Z.; Yao, Q.; Wan, C.; Lu, J. Agrobacterium-mediated multiple gene transformation in rice using a single vector. J. Integr. Plant Biol. 2005, 47, 233−242. (27) Peng, R. H.; Xiong, A. S.; Yao, Q. H. A direct and efficient PAGE-mediated overlap extension PCR method for gene multiple-site mutagenesis. Appl. Microbiol. Biotechnol. 2006, 73, 234−240. (28) Zhang, X.; Henriques, R.; Lin, S. S.; Niu, Q. W.; Chua, N. H. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 2006, 1, 641−646. (29) Hiei, Y.; Komari, T. Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nat. Protoc. 2008, 3, 824−834. (30) Kim, S. J.; Kweon, O.; Freeman, J. P.; Jones, R. C.; Adjei, M. D.; Jhoo, J. W.; Edmondson, R. D.; Cerniglia, C. E. Molecular cloning and expression of genes encoding a novel dioxygenase involved in low- and high-molecular-weight polycyclic aromatic hydrocarbon degradation in Mycobacterium vanbaalenii PYR-1. Appl. Environ. Microbiol. 2006, 72, 1045−1054. (31) Lichtenthaler, H. K. Chlorophylls and carotenoids: Pigments of photosynthetic biomembranes. Methods Enzymol. 1987, 148, 350−382. (32) Alexieva, V.; Sergiev, I.; Mapelli, S.; Karanov, E. The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant Cell Environ. 2001, 24, 1337−1344. (33) Zhang, L.; Tian, L. H.; Zhao, J. F.; Song, Y.; Zhang, C. J.; Guo, Y. Identification of an apoplastic protein involved in the initial phase of salt stress response in rice root by two-dimensional electrophoresis. Plant Physiol. 2009, 149, 916−928. (34) Van Dillewijn, P.; Couselo, J. L.; Corredoira, E.; Delgado, A.; Wittich, R. M.; Ballester, A.; Ramos, L. J. Bioremediation of 2,4,6trinitrotoluene by bacterial nitroreductase expressing transgenic aspen. Environ. Sci. Technol. 2008, 42, 7405−7410. (35) Mohammadi, M.; Chalavi, V.; Novakova-Sura, M.; Laliberté, J. F.; Sylvestre, M. Expression of bacterial biphenyl-chlorobiphenyl dioxygenase genes in tobacco plants. Biotechnol. Bioeng. 2007, 97, 496−505. (36) Dafny-Yelin, M.; Tzfira, T. Delivery of multiple transgenes to plant cells. Plant Physiol. 2007, 145, 1118−1128. (37) Ye, X.; Al-Babili, S.; Kloti, A.; Zhang, J.; Lucca, P.; Beyer, P.; Potrykus, I. Engineering the provitamin A (beta-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 2000, 287, 303−305.

(38) Slater, S.; Mitsky, T. A.; Houmiel, K. L.; Hao, M.; Reiser, S. E.; Taylor, N. B.; Tran, M.; Valentin, H. E.; Rodriguez, D. J.; Stone, D. A.; Padgette, S. R.; Kishore, G.; Gruys, K. J. Metabolic engineering of Arabidopsis and Brassica for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer production. Nat. Biotechnol. 1999, 17, 1011−1016. (39) Keith, L. H.; Telliard, W. A. Priority pollutants. I. A perspective view. Environ. Sci. Technol. 1979, 13, 416−423. (40) Peng, R. H.; Xu, R. R.; Fu, X. Y.; Xiong, A. S.; Zhao, W.; Tian, Y. S.; Zhu, B.; Jin, X. F.; Chen, C.; Han, H. J.; Yao, Q. H. Microarray analysis of the phytoremediation and phytosensing of occupational toxicant naphthalene. J. Hazard. Mater. 2011, 189, 19−26. (41) Burritt, D. J. The polycyclic aromatic hydrocarbon phenanthrene causes oxidative stress and alters polyamine metabolism in the aquatic liverwort Riccia f luitans L. Plant Cell Environ. 2008, 31, 1416− 1431. (42) Teng, Y.; Shen, Y.; Luo, Y.; Sun, X.; Sun, M.; Fu, D.; Li, Z.; Christie, P. Influence of Rhizobium meliloti on phytoremediation of polycyclic aromatic hydrocarbons by alfalfa in an aged contaminated soil. J. Hazard. Mater. 2011, 186, 1271−1276. (43) Culbertson, J. B.; Valiela, I.; Pickart, M.; Peacock, E. E.; Reddy, C. M. Long-term consequences of residual petroleum on salt marsh grass. J. Appl. Ecol. 2008, 45, 1284−1292. (44) Mo, C. H.; Cai, Q. Y.; Tang, S. R.; Zeng, Q. Y.; Wu, Q. T. Polycyclic aromatic hydrocarbons and phthalic acid esters in vegetables from nine farms of the Pearl River Delta, South China. Arch. Environ. Contam. Toxicol. 2009, 56, 181−189.

12832


Phytoremediation of Phenanthrene by Transgenic Plants Transformed

Recommend Documents