Poly(hydroxyalkanoate) Generation from Nonchiral Substrates Using

Article pubs.acs.org/journal/abseba

Poly(hydroxyalkanoate) Generation from Nonchiral Substrates Using Multiple Enzyme Immobilizations on Peptide Nanofibers Nicholas M. Thomson,†,‡ Smith Sangiambut,†,‡ Kazunori Ushimaru,§ Easan Sivaniah,*,‡,⊥ and Takeharu Tsuge*,§ ‡

Cavendish Laboratory, University of Cambridge, J. J. Thomson Avenue, Cambridge CB3 0HE, United Kingdom Department of Innovative and Engineered Materials, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama 226-8502, Japan ⊥ Institute for Integrated Cell-Material Sciences, Kyoto University, Yoshida Ushinomiya-cho, Sakyo-ku, Kyoto 606-8501, Japan §

ABSTRACT: We developed a method for the immobilization of multiple active enzymes, allowing the production of chiral products from nonchiral substrates with recycling of expensive cofactors. Using a rapid, two-step process under nondenaturing conditions, we could preserve enzyme activity by separating the production of an immobilization scaffold from the attachment of the enzymes. The technique is applicable to a wide range of enzymes and will facilitate simple, costeffective enzyme immobilization for research and industrial purposes. An (R)-specific poly(hydroxyalkanoate) synthase (PhaCRe from Ralstonia eutropha), an (S)-specific dehydrogenase (FadB from Pseudomonas putida), and an (R)-specific hydratase (PhaJ4Pa from P. aeruginosa) were immobilized by affinity tag-assisted binding to self-assembled antiparallel type β-sheets with a coiled fiber structure formed from a decapeptide (P-K-F-K-I-I-E-F-E-P). The functionalized scaffolds were capable of producing poly(3-hydroxybutyrate) from β-butyrolactone with the recycling of coenzyme A. Enzyme immobilization was confirmed by fluorescence microscopy using fusion proteins of the enzymes with fluorescent marker proteins, and activity was confirmed by spectroscopic activity assays. KEYWORDS: peptide, fiber, enzyme immobilization, polyhydroxyalkanoate, cofactor recycling, enantioselective

■

INTRODUCTION Immobilization is a common strategy to increase the stability of enzymes during industrial processes. It also allows the separation of biocatalysts from products and reuse of enzymes, both of which lead to cost savings and increase process efficiency.1 The four most common methods of immobilization are entrapment (typically within a polymer network),2 encapsulation within a membrane,3 attachment to a solid support,4−6 and self-aggregation via cross-linking.7−9 Studies of peptide self-assembly into fibrous structures and the uses of those fibers as biomaterials have recently received much attention.10 We recently used poly(hydroxyalkanoate) synthase from Cupriavidus necator (formerly known as Ralstonia eutropha; PhaCRe) to demonstrate enzyme immobilization on self-assembled peptide nanofibers in a rapid, two-step process under nondenaturing conditions.11 PhaCRe is the last of three enzymes in the biochemical pathway for the production of poly(3-hydroxybutyrate) (PHB) from acetyl coenzyme A (acetyl-CoA); (Figure 1A). PHB is a biodegradable and biocompatible polyester that is produced by a wide variety of bacteria, has been extensively studied in vitro, and may be considered the archetype for the wider group of poly(hydroxyalkanoate) bioplastics.12,13 © XXXX American Chemical Society

Although approximately 15% of industrial biotransformations use immobilized enzymes, certain technical challenges prevent their use on a more widespread basis.14 For example, PhaCRe activity is sensitive to some modifications at the C-terminus and therefore immobilization by binding to this domain could reduce enzyme activity.15 Close packing of enzyme molecules, immobilization within porous materials or entrapment within a membrane could also limit diffusion of the 3HB-CoA monomer. Furthermore, purified PhaCRe is unstable in solution, so classic immobilization processes involving harsh conditions such as high temperatures or extremes of pH are likely to damage the enzymes.16−18 Commonly, biotransformations are mediated by the sequential action of more than one enzyme. Therefore, the ability to immobilize multiple enzymes on the same support is desirable to reduce diffusion losses as the substrate moves between different active sites and so to increase catalytic efficiency.19 Unfortunately, the limitations described above for Special Issue: PHA Biomaterials Received: June 15, 2016 Accepted: October 18, 2016 Published: October 18, 2016 A

DOI: 10.1021/acsbiomaterials.6b00329 ACS Biomater. Sci. Eng. XXXX, XXX, XXX−XXX

Article

ACS Biomaterials Science & Engineering

Figure 1. Schematic representations of the enzyme immobilization and substrate recycling systems employed in this work. (A) Natural pathway for production of poly(3-hydroxybutyrate) from acetyl-CoA in C. necator. (B) Engineered pathway for production of poly(3-hydroxybutyrate) from βbutyrolactone via (S)-3HB-CoA with recycling of CoA, using FadB from P. putida, PhaJ4Pa from P. aeruginosa, and PhaCRe from C. necator. (C) Affinity tag-assisted procedure for enzyme immobilization. Each enzyme is transgenically expressed with a short affinity peptide (T-G-V-K-G-P-G) attached. In a one-step self-assembly reaction, hydrophobic peptides (P-K-F-K-I-I-E-F-E-P) form antiparallel β-sheets with a coiled fiber morphology and are decorated with functional enzymes.

Figure 2. (A) Schematic overview of the hybrid proteins used in this study. (B) Elution fraction of each protein from analytical SDS-PAGE gels following expression in E. coli BL21(DE3) and purification by Co2+ IMAC. (1) PhaCRe, (2) Tag::PhaCRe, (3) PhaCRe::GFP, (4) Tag::PhaCRe::GFP, (5) PhaJ4Pa::RFP, (6) Tag::PhaJ4Pa::RFP, (7) FadB::GFP, (8) Tag::FadB::GFP.

(S)-3HB-CoA into crotonyl-CoA before PhaJ4Pa converts the crotonyl-CoA into (R)-3HB-CoA. Polymerization of the (R)3HB-CoA then releases the CoA to react with more βbutyrolactone and so completes the cycle. This new system takes advantage of the simple design and mild processing conditions of the original scaffold, using short affinity tags engineered onto the enzymes to mediate binding with the nanofiber. The recycling system reduces the dependence of PHB polymerization on expensive CoA and provides a method for continuous, large-scale production of PHB in an in vitro system.25 Here, we present our findings with the peptide affinity technique. Using a PHB production pathway with CoA recycling allows us to demonstrate the simplicity and convenience of the peptide affinity technique for the immobilization of multiple enzymes on a single substrate.

single-enzyme immobilization are compounded when it is necessary to consider the conditions required by more than one enzyme, and this limits the present range of immobilized multienzyme reaction systems. Various multienzyme reactions have been coimmobilized. These types of immobilization usually result in only modest increases, or even decreases, in activity but can stabilize the enzymes sufficiently to survive multiple rounds of catalysis where the free enzymes would rapidly become damaged.4,20 We now demonstrate the further practicality of the nanofiber attachment technique by engineering an immobilized, multienzyme system for the production of PHB from βbutyrolactone with recycling of the CoA cofactor (Figure 1B, C). β-butyrolactone and free CoA undergo a transesterification reaction in solution to form a racemic mixture of (R,S)-3HBCoA.21 PhaCRe is known to be an enantioselective enzyme, catalyzing only the (R)-form of 3HB-CoA.22 By adding an (S)specific dehydrogenase, FadB from Pseudomonas putida KT2440,23 and an (R)-specific hydratase from Pseudomonas aeruginosa (PhaJ4Pa),24 it is possible to convert the unused (S)3HB-CoA into (R)-3HB-CoA (Figure 1B).25 FadB dehydrates

■

MATERIALS AND METHODS

Material Procurement. The PKFKIIEFEP peptide was purchased from Biomatik Corporation (Canada). Restriction enzymes were from the FastDigest range from Thermo Fisher (UK), who also supplied PCR primers, Phusion DNA polymerase and T4 DNA ligase.

B


Article

ACS Biomaterials Science & Engineering Table 1. Plasmids and PCR primers used in this study primer no. (F/ R)

source

pBR322 ori, AmpR, T7 promoter, N-terminal His6-tag pET15b expressing phaC

1/3

Novagen 11

pET15b expressing Tag::phaC fusion

2/3

11

plasmid or primer

characteristics or sequence (5′ − 3′)

a

plasmids pET15b pET15bPhaCRe pET15b-TagPhaCRe pRSETEmGFP pRSETPhaCReGFP pRSET-TagPhaCReGFP pRSET-FadBGFP pRSET-TagFadB-GFP pRSET-RFP pRSETPhaJ4-RFP pRSET-TagPhaJ4-RFP

pUC ori, AmpR, T7 promoter, adds C-terminal gfp, N-terminal His6 -tag

Invitrogen

pRSET-EmGFP expressing phaC::gfp fusion

4/6

11

pRSET-EmGFP expressing Tag::phaC::gfp fusion

5/6

11

pRSET-EmGFP expressing fadB::gfp fusion

7/9

this study

pRSET-EmGFP expressing Tag::fadB::gfp fusion

8/9

this study

pRSET-EmGFP with gf p gene replaced by rfp pRSET-RFP expressing phaJ4::rf p fusion

10/11 12/14

this study this study

pRSET-RFP expressing Tag::phaJ4::rfp fusion

13/14

this study

PCR primers (1) NdeIphaC F (2) NdeI-TPphaC F (3) BamHIphaC R (4) BamHIphaC F (5) BamHITP-phaC F (6) EcoRIphaC R (7) BamHIfadB F (8) BamHITP-fadB F (9) EcoRIfadB R (10) EcoRIrfp F (11) HindIIIrfp R (12) BamHIphaJ4 F (13) BamHITP-phaJ4 F (14) EcoRIphaJ4 R a

GGGGCATATGATGGCGACCGGCAAAGGCGC

11

GGGGCATATGGGCAATGGCAATGGCAATACCGGCGTGAAAGGCCCGGGCATGGCGACCGGCAAAGGCGC

11

GGGGGGATCCTCATGCCTTGGCTTTGACGTATCGC

11

ATCAAGGATCCGCGACCGGCAAAGGCGCGG

11

ATCAAGGATCCACCGGCGTGAAAGGCCCGGGCGGCAATGGCAATGGCAATGCGACCGGCAAAGGCGCGG

11

TTGATGAATTCTGCCTTGGCTTTGACGTATCGCC

11

ATGCGGATCCATGGCATTGCAAACCATCCT

this study

ATGCGGATCCACCGGCGTGAAAGGCCCGGGCATGGCGACCGGCAAAG

this study

GCATGAATTCACGGTCCTTGAACTGTGCC

this study

ATGCGAATTCATGGCCTCCTCCGAGG

this study

GCATAAGCTTTTAGGCGCCGGTGGA

this study

ATATGGATCCATGCCATTCGTACCCGTAGCA

this study

ATATGGATCCACCGGCGTGAAAGGCCCGGGCATGCCATTCGTACCCGTAGCA

this study

TATAGAATTCGACGAAGCAGAGGCTGAGGGTCT

this study

Restriction sites are underlined and the Tag sequence is shown in bold. F = forward primer; R = reverse primer.

QIAquick PCR purification kits are manufactured by Qiagen (Germany). All other chemicals were purchased from Sigma-Aldrich (UK). Plasmid Construction. A schematic overview of the fusion proteins necessary for this study is provided in Figure 2A. To construct the plasmids for protein expression (Table 1), standard molecular biology techniques were employed to amplify the appropriate genes by polymerase chain reaction (PCR), digest the plasmid vectors and inserts with complementary restriction enzymes, and ligate them with DNA ligase.26 The Thr-Gly-Val-Lys-Gly-Pro-Gly tag peptide (referred to hereafter as the “Tag”) and appropriate restriction sites were introduced by inclusion in the PCR primers, as shown in Table 1 (restriction sites are underlined in the sequence and the enzyme forms

part of the primer name). All PCR reactions were carried out using 0.2 μL of Phusion DNA polymerase, 1 μM of each primer, 250 μM of each dNTP and 15 ng of template DNA in a total volume of 20 μL. The PCR reaction involved 8 cycles of denaturation for 10 s at 98 °C, annealing for 30 s at an initial temperature of 80 °C (reduced by 1 °C every cycle) and extension for 30 s at 72 °C, followed by 22 cycles of denaturation for 10 s at 98 °C and annealing/extension for 30 s at 72 °C. All restriction digestion reactions were carried out with both enzymes simultaneously. For plasmids, the reaction used 1 μL of each enzyme and 1 μg of DNA in a total volume of 30 μL. For PCR products, 200 μg of DNA were used in a total volume of 50 μL. Digestion proceeded at 37 °C for 60 min, followed by inactivation of C


Article


Figure 3. (A) Activity assays of the nonimmobilized substrate recycling system in solutions containing different concentrations of β-butyrolactone. OD600 provides a measure of the amount of PHB produced because of light scattering by the granules. As more β-butyrolactone was added, the amount of PHB increased, demonstrating that CoA was being recycled. (B) Activity assays of recycling system enzymes bound to peptide nanofibers, tracking PHB synthesis by OD600. Control samples lacking either FadB or PhaJ4Pa accumulated less PHB compared to the complete three-enzyme system. (C−H) Fluorescence microscopy of peptide nanofibers incubated with (C) Tag::FadB::GFP, (D) FadB::GFP, (E) Tag::PhaJ4Pa::RFP, (F) PhaJ4Pa::RFP, (G, H) Tag::FadB::GFP and Tag::PhaJ4Pa::RFP. A green fluorescence filter cube was used for C, D, and G. A red fluorescence filter cube was used for E, F, and H. Scale bars = 10 μm. the enzymes at 80 °C for 10 min. The end fragments and enzymes were then removed using a QIAquick PCR purification kit. pET15b was used as the plasmid backbone for PhaCRe without a fluorescent reporter fusion, while pRSET-EmGFP provided a Cterminal fusion of green fluorescent protein (GFP) for PhaCRe and FadB. The plasmids were cut with the same restriction enzymes as the inserts, then mixed in a 3:1 ratio (insert:vector) with 20 μL total volume and ligated at 22 °C overnight using T4 DNA ligase. To produce PhaJ4Pa with a red fluorescent protein (RFP) fusion, the gf p gene in pRSET-EmGFP was first replaced by a PCR-amplified rf p gene using EcoRI and HindIII restriction sites. The phaJ4 gene was then inserted upstream in the same way as for PhaCRe and FadB. Protein Preparation. All protein expression was carried out in E. coli BL21(DE3). Sterile Luria−Bertani (LB) medium (200 mL) containing 100 μg.mL−1 ampicillin in a 1 L Erlenmeyer flask was inoculated with an overnight culture of each strain taken from individual colonies on agar plates. The cultures were grown at 37 °C with shaking at 200 rpm until the optical density at 600 nm (OD600) reached 0.6. The temperature was then reduced to 30 °C and protein expression was induced by addition of 1 mM isopropyl β-D-1thiogalactopyranoside (IPTG). Incubation continued at 30 °C for a further 6 h before the cells were harvested by centrifugation and the pellets stored at −80 °C until protein purification by immobilized metal affinity chromatography (IMAC). For protein purification, cells were resuspended in binding buffer (50 mM NaPi, 300 mM NaCl, 5% (v/v) glycerol, 0.05% (w/v) 6-O(N-heptylcarbamoyl)-methyl-α-D-glycopyranoside (Hecameg) and 10 mM imidazole). Samples were kept on ice or in a 4 °C refrigerator to minimize enzyme denaturation. Cells were lysed by sonication using a Sonopuls HD2200 sonicator (Bandelin) and MS73 tip. Six cycles at 10% power for 30 s were applied, with 5 min on ice between cycles. The insoluble fraction containing cell debris was removed by centrifugation at 6000 × g for 60 min followed by filtration of the

supernatant using a 0.44 μm pore size cellulose acetate filter, and the soluble proteins loaded onto a gravity flow column (Fisher) containing 2 mL of Talon His-tag Purification Resin (Takara) which had been pre-equilibrated with binding buffer, and gently mixed for 20 min to allow binding of His-tagged protein to the resin. The column was then drained and washed with 5 mL binding buffer. Bound protein was eluted by applying 5 mL elution buffer (identical composition to binding buffer, but with 100 mM imidazole rather than 10 mM) in 0.5 mL fractions. Elution fractions containing over 0.1 mg.mL−1 protein were pooled and concentrated in 10 kDa Mw cutoff Vivaspin centrifugal filter columns (GE Healthcare, USA). Concentrated protein was washed three times with desalting buffer (identical composition to binding buffer, but without NaCl or imidazole), and samples stored at −80 °C. Peptide Fiber Formation and Reaction Completion Analysis. Peptide fibers were formed as described before by dissolving 0.4 μmol in 5 μL of acetonitrile and 45 μL of water, heating to 80 °C, and then cooling slowly to room temperature (approximately 22 °C).11 Tagged enzymes were attached to the fibers, for individual activity assays or to create the three-enzyme system, by incubating a mixture of the appropriate components for 15 min at room temperature. Fiber-bound enzymes were separated from unbound enzymes by centrifugation for 15 min at 17 000 × g followed by resuspension of the pellet in 30 μL of milli-Q water. Individual enzyme activities after attachment to peptide nanofibers were determined by UV absorbance spectrophotometry. Tag::PhaCRe::GFP activity was determined by measuring the decrease in absorbance at 236 nm due to cleavage of the thioester bond of 3HBCoA during polymerization. Assays were carried out using a Cary 300 Bio UV−vis spectrophotometer (Varian, USA) at 30 °C in potassium phosphate buffer (KPi) containing 100 μM 3HB-CoA. Enzyme activity was calculated from the rate of decrease in A236 using the Beer− Lambert equation with an extinction coefficient of 4500 M−1 cm−1. D


Article


CoA was added to all reactions. The final OD600 value does not appear to scale linearly with initial β-butyrolactone concentration, with higher concentrations of 150 and 300 μM βbutyrolactone yielding a higher than expected OD600 when compared with 50 and 100 μM. This may be due to increased aggregation of PHB granules: as more granules are produced, there is a higher likelihood of coalescence to produce larger granules that scatter more light. Multiple Enzyme Immobilization and Reaction on Peptide Nanofibers. The tag-peptide system employed here allows attachment efficiencies of >85% at the enzyme concentrations we used.11 To verify binding of the substrate recycling enzymes to peptide nanofibers, we incubated Tag::FadB::GFP and Tag::PhaJ4Pa::RFP with peptide nanofibers and observed by fluorescence microscopy (Figure 3C− H). Tag::FadB::GFP and Tag::PhaJ4Pa::RFP both yielded fluorescent fibers that were not seen in controls using untagged FadB::GFP and PhaJ4Pa::RFP. Co-incubation with both tagged enzymes resulted in nanofibers with red and green fluorescence, showing that both enzymes were able to bind to the nanofibers simultaneously. The substrate recycling enzymes were bound to preformed PKFKIIEFEP peptide nanofibers via their covalently linked tag peptides. Unbound enzymes were removed by centrifugation. To ensure that enzyme activity was retained during attachment to the peptide, the specific activity of each enzyme-peptide complex was assayed individually. Using the A236 spectrophotometric assay, the specific activity of Tag::PhaCRe::GFP was determined to be 17.5 μmol substrate mg−1 min−1. The specific activities of Tag:FadB::GFP and Tag::PhaJ4Pa::RFP were determined by A263 to be 1490 μmol mg−1 min−1 and 750 μmol mg−1 min−1, respectively. Therefore, because of the significantly lower specific activity, the PhaCRe-catalyzed reaction was the rate-limiting step for PHB production. β-butyrolactone and CoA were added to fibers with all three enzymes attached to enable the production of PHB, which was tracked by measuring OD600. Ideally, the presence of PHB would be confirmed by NMR. However, because of the small amount of starting material and losses during purification, it was not possible to produce sufficient polymer for analysis. Despite this, a similar reaction profile was observed to that of the recycling system in solution, whereas control samples lacking either Tag::FadB::GFP or Tag::PhaJ4Pa::RFP showed little change in absorbance (Figure 3B). The results were also comparable to our previous study of PHB production with only PhaCRe immobilized.11 This demonstrated that all three enzymes were able to retain catalytic activity while binding simultaneously to the peptide fibers and that recycling of CoA allowed more PHB to be produced. The overall specific activity of the CoA recycling system should be determined by the rate-limiting (PhaCRe) step. However, the determination of an accurate PHB formation rate is not possible using the OD600 method because the PHB granules formed are not of equal size, and therefore do not scatter light uniformly. Furthermore, PHB tended to coat peptide fibers, rather than form distinct granules. Therefore, the rate of PHB formation appears lower for the immobilized recycling system compared to when in solution, because of the different light-scattering properties of the PHB as well as the loss of a fraction of unbound enzymes after centrifugation. There have been many previous examples of both PHAs and peptide nanofibers being used as scaffolds for cell culture because of their physical and chemical properties.28,29 The

Activity of Tag::FadB::GFP and Tag::PhaJ4Pa::RFP were measured by following the change in A263, which corresponds to either hydration (decrease in absorbance) or dehydration (increase in absorbance), with an extinction coefficient of 6700 M−1 cm−1.24 The components of the reaction mixture were 200 μM 3HB-CoA for Tag::FadB::GFP or 200 μM crotonyl-CoA for Tag::PhaJ4 Pa::RFP, 50 mM KPi and 1 ng L−1 of enzyme. All assays were carried out at 30 °C in a quartz cuvette. The activity of the PHB production/CoA recycling system immobilized on peptide fibers was assayed by measuring the increase in OD600 during polymerization, which occurs due to light scattering from the newly formed PHB granules.27 It was not possible to measure the enzyme activity based on the breaking of the thioester bond because in the recycling system free CoA reacts with β-butyrolactone to replenish the supply of 3HB-CoA. Tag::PhaCRe, Tag::FadB::GFP and Tag::PhaJ4Pa::RFP (200 nM each) were incubated with 4 mM peptide nanofibers, separated from unbound enzymes and resuspended in 30 μL milli-Q water as described above. The resuspended pellet was then added to a cuvette containing 200 mM KPi (pH 8.0), 1 μM CoA, and 300 μM β-butyrolactone in a total reaction volume of 600 μL at 30 °C, and the change in OD600 was monitored. Control samples containing Tag::PhaCRe, but lacking either Tag::FadB::GFP or Tag::PhaJ4Pa::RFP were prepared for comparison. Sample chambers were prepared by placing a 2 cm × 2 cm piece of Parafilm on a glass slide. A Y-shaped chamber pattern with inlet and outlet channels was cut into the Parafilm with a scalpel, and the chamber sealed by placing a coverslip on top, heating the slide to 60 °C on a heat block and applying pressure. Excitation/detection filters used for fluorescence microscopy were 450−490/510 nm (GFP) and 515−560/580 nm for RFP.

■

RESULTS AND DISCUSSION Protein Expression and Purification. PhaCRe, FadB, and PhaJ4Pa were expressed as fusion proteins with a C-terminal fluorescent protein marker to aid in visualization of their location. The fusion proteins were expressed either with or without an N-terminal Thr-Gly-Val-Lys-Gly-Pro-Gly affinity tag, which was designed to bind specifically to the PKFKIIEFEP nanofibers. To distinguish between coimmobilized enzymes, FadB and PhaCRe were fused with GFP while PhaJ4Pa was fused to RFP. For the coimmobilization experiments, PhaCRe was expressed with and without the affinity tag but not the GFP. This was to avoid confusion between PhaCRe::GFP and FadB::GFP, and because PhaCRe binding to the nanofibers was confirmed in a previous study.11 The proteins were expressed in E. coli BL21(DE3) and purified by Co2+ IMAC. SDS-PAGE analysis of the purified proteins confirmed that in each case, products of the expected sizes were obtained with high purity (Figure 2B). The activity of the CoA recycling system was initially tested in solution by combining Tag::PhaCRe, Tag::FadB::GFP and Tag::PhaJ4Pa::RFP with 1 μM CoA and 0, 50, 100, 150, or 300 μM β-butyrolactone. Without FadB and PhaJ4Pa, half of the free CoA would become trapped in the (S)-form of 3HB-CoA in each reaction cycle, leading to an exponential decrease in the concentration of free CoA. As CoA and β-butyrolactone react in a 1:1 ratio, by limiting the initial concentration of CoA to 1/ 50 or less of β-butyrolactone concentration, recycling of CoA is required if all of the β-butyrolactone added is to be incorporated into PHB. Production of PHB was tracked by measuring the increase in OD600 (Figure 3A).27 The optical density increased initially before reaching a plateau, showing that polymerization had ceased. The final optical density is an indication of the total amount of PHB produced. The final OD600 limit increased when more β-butyrolactone was added, indicating that CoA recycling was indeed taking place, as the same amount of free E


Article


(5) Garcia, J.; Zhang, Y.; Taylor, H.; Cespedes, O.; Webb, M. E.; Zhou, D. Multilayer enzyme-coupled magnetic nanoparticles as efficient, reusable biocatalysts and biosensors. Nanoscale 2011, 3 (9), 3721−3730. (6) Logan, T. C.; Clark, D. S.; Stachowiak, T. B.; Svec, F.; Fréchet, J. M. J. Photopatterning enzymes on polymer monoliths in microfluidic devices for steady-state kinetic analysis and spatially separated multienzyme reactions. Anal. Chem. 2007, 79 (17), 6592−6598. (7) Brady, D.; Jordaan, J. Advances in enzyme immobilisation. Biotechnol. Lett. 2009, 31 (11), 1639−1650. (8) Mateo, C.; Chmura, A.; Rustler, S.; van Rantwijk, F.; Stolz, A.; Sheldon, R. A. Synthesis of enantiomerically pure (S)-mandelic acid using an oxynitrilase−nitrilase bienzymatic cascade: a nitrilase surprisingly shows nitrile hydratase activity. Tetrahedron: Asymmetry 2006, 17 (3), 320−323. (9) Scism, R. A.; Bachmann, B. O. Five-component cascade synthesis of nucleotide analogues in an engineered self-immobilized enzyme aggregate. ChemBioChem 2010, 11 (1), 67−70. (10) Morris, K.; Serpell, L. From natural to designer self-assembling biopolymers, the structural characterisation of fibrous proteins & peptides using fibre diffraction. Chem. Soc. Rev. 2010, 39 (9), 3445− 3453. (11) Sangiambut, S.; Channon, K.; Thomson, N. M.; Sato, S.; Tsuge, T.; Doi, Y.; Sivaniah, E. A robust route to enzymatically functional, hierarchically self-assembled Peptide frameworks. Adv. Mater. 2013, 25 (19), 2661−2665. (12) Philip, S.; Keshavarz, T.; Roy, I. Polyhydroxyalkanoates: biodegradable polymers with a range of applications. J. Chem. Technol. Biotechnol. 2007, 82 (3), 233−247. (13) Thomson, N. M.; Roy, I.; Summers, D.; Sivaniah, E. In vitro production of polyhydroxyalkanoates: achievements and applications. J. Chem. Technol. Biotechnol. 2010, 85 (6), 760−767. (14) Straathof, A. J. J.; Panke, S.; Schmid, A. The production of fine chemicals by biotransformations. Curr. Opin. Biotechnol. 2002, 13 (6), 548−556. (15) Jahns, A. C.; Rehm, B. H. A. Tolerance of the Ralstonia eutropha class I polyhydroxyalkanoate synthase for translational fusions to its C terminus reveals a new mode of functional display. Appl. Environ. Microbiol. 2009, 75 (17), 5461−5466. (16) Jia, F.; Narasimhan, B.; Mallapragada, S. Materials-based strategies for multi-enzyme immobilization and co-localization: A review. Biotechnol. Bioeng. 2014, 111 (2), 209−222. (17) Gerngross, T. U.; Snell, K. D.; Peoples, O. P.; Sinskey, A. J.; Csuhai, E.; Masamune, S.; Stubbe, J. Overexpression and Purification of the Soluble Polyhydroxyalkanoate Synthase from Alcaligenes eutrophus: Evidence for a Required Posttranslational Modification for Catalytic Activity. Biochemistry 1994, 33 (31), 9311−9320. (18) Ushimaru, K.; Sangiambut, S.; Thomson, N.; Sivaniah, E.; Tsuge, T. New insights into activation and substrate recognition of polyhydroxyalkanoate synthase from Ralstonia eutropha. Appl. Microbiol. Biotechnol. 2013, 97 (3), 1175−1182. (19) Schoffelen, S.; van Hest, J. C. M. Multi-enzyme systems: bringing enzymes together in vitro. Soft Matter 2012, 8 (6), 1736− 1746. (20) Wang, Y.; Caruso, F. Mesoporous Silica Spheres as Supports for Enzyme Immobilization and Encapsulation. Chem. Mater. 2005, 17 (5), 953−961. (21) Tomizawa, S.; Yoshioka, M.; Ushimaru, K.; Tsuge, T. Preparative synthesis of poly[(R)-3-hydroxybutyrate] monomer for enzymatic cell-free polymerization. Polym. J. 2012, 44 (9), 982−985. (22) Rehm, B. H. A.; Steinbüchel, A. Biochemical and genetic analysis of PHA synthases and other proteins required for PHA synthesis. Int. J. Biol. Macromol. 1999, 25, 3−19. (23) Santos, P. M.; Benndorf, D.; Sá-Correia, I. Insights into Pseudomonas putida KT2440 response to phenol-induced stress by quantitative proteomics. Proteomics 2004, 4 (9), 2640−2652. (24) Tsuge, T.; Taguchi, K.; Taguchi, S.; Doi, Y. Molecular characterization and properties of (R)-specific enoyl-CoA hydratases from Pseudomonas aeruginosa: metabolic tools for synthesis of

hybrid PHB-coated peptide nanofiber material produced in this study may also be useful in cell culture applications because of their combination of properties. Immobilized PhaCRe has previously been used to pattern and change the surface properties of silicon surfaces.30 It is possible that the interaction of PHB and peptide nanofibers could introduce new and useful mechanical properties and affect the strength and stability of cell scaffolds. Another application might be as an alternative to electrospinning to coat medical stents and other devices with a layer of biocompatible PHA.28,31 The substrate-recycling pathway demonstrated here makes the production of larger scale samples required for mechanical testing and cell culture more feasible.

■

CONCLUSION By fusing the enzymes to an affinity tag peptide that binds to the nanofibers with a high level of specificity, we were able to immobilize a three-enzyme reaction system quickly and easily, without damaging the enzyme activity. In this work, we used a synthetic PHB production system with the recycling of CoA to demonstrate the flexibility of our immobilization technique for combining enzymes from different sources and with different properties. We confirmed the attachment of each enzyme to the self-assembled peptide nanofiber and that the immobilized multiple enzymes worked as a synthetic PHA generation pathway in an enantioconvergent manner from racemic material. The production of peptide supports with a coating of biocompatible and biodegradable PHB could be useful for the design of new cell scaffolds or drug delivery systems. However, we anticipate that the peptide affinity technique will be of broad interest for the immobilization of single or multiple enzymes in a wide variety of situations.

■

AUTHOR INFORMATION

Corresponding Authors

*E-mail: [email protected]. *E-mail: [email protected]. Author Contributions †

N.M.T. and S.S. contributed equally.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank Dr. Kevin Channon (University of Cambridge) for his technical assistance. Moreover, E.S. acknowledges the support of the JSPS World Premier Institute (WPI) Funding Program.

■

REFERENCES

(1) Polizzi, K. M.; Bommarius, A. S.; Broering, J. M.; ChaparroRiggers, J. F. Stability of biocatalysts. Curr. Opin. Chem. Biol. 2007, 11 (2), 220−225. (2) Rupcich, N.; Brennan, J. D. Coupled enzyme reaction microarrays based on pin-printing of sol-gel derived biomaterials. Anal. Chim. Acta 2003, 500 (1−2), 3−12. (3) van Dongen, S. F. M.; Nallani, M.; Cornelissen, J. J. L. M.; Nolte, R. J. M.; van Hest, J. C. M. A three-enzyme cascade reaction through positional assembly of enzymes in a polymersome nanoreactor. Chem. - Eur. J. 2009, 15 (5), 1107−1114. (4) Jia, F.; Narasimhan, B.; Mallapragada, S. K. Biomimetic multienzyme complexes based on nanoscale platforms. AIChE J. 2013, 59 (2), 355−360. F


Article

ACS Biomaterials Science & Engineering polyhydroxyalkanoates via fatty acid ß-oxidation. Int. J. Biol. Macromol. 2003, 31 (4−5), 195−205. (25) Tomizawa, S.; Sato, S.; Lan, J. C.-W.; Nakamura, Y.; Abe, H.; Tsuge, T. In vitro evidence of chain transfer to tetraethylene glycols in enzymatic polymerization of polyhydroxyalkanoate. Appl. Microbiol. Biotechnol. 2013, 97 (11), 4821−4829. (26) Sambrook, J.; Russell, D. W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbour Press: Cold Spring Harbour, NY, 2001. (27) Gerngross, T. U.; Martin, D. P. Enzyme-catalyzed synthesis of poly[(R)-(−)-3-hydroxybutyrate]: formation of macroscopic granules in vitro. Proc. Natl. Acad. Sci. U. S. A. 1995, 92 (14), 6279−6283. (28) Dhandayuthapani, B.; Yoshida, Y.; Maekawa, T.; Kumar, D. S. Polymeric Scaffolds in Tissue Engineering Application: A Review. Int. J. Polym. Sci. 2011, 2011, No. 290602. (29) Woolfson, D. N.; Mahmoud, Z. N. More than just bare scaffolds: towards multi-component and decorated fibrous biomaterials. Chem. Soc. Rev. 2010, 39 (9), 3464−3479. (30) Kim, Y.-R.; Paik, H.-J.; Ober, C. K.; Coates, G. W.; Batt, C. A. Enzymatic surface-initiated polymerization: A novel approach for the in situ solid-phase synthesis of biocompatible polymer poly(3hydroxybutyrate). Biomacromolecules 2004, 5 (3), 889−894. (31) Lee, Y.-F.; Sridewi, N.; Ramanathan, S.; Sudesh, K. The influence of electrospinning parameters and drug loading on polyhydroxyalkanoate (PHA) nanofibers for drug delivery. Int. J. Biotechnol. Wellness Ind. 2016, 4 (4), 103−113.

G


Poly(hydroxyalkanoate) Generation from Nonchiral Substrates Using

Recommend Documents