Polyketides from the Cultured Lichen Mycobiont of ... - ACS Publications

Jun 13, 2014 - ABSTRACT: A spore-derived mycobiont of a crustose. Pyrenula sp. lichen collected in Vietnam was cultivated on a malt-yeast extract medi...
0 downloads 0 Views 872KB Size
Download PDF
Article pubs.acs.org/jnp

Polyketides from the Cultured Lichen Mycobiont of a Vietnamese Pyrenula sp. Duy Hoang Le,† Yukiko Takenaka,† Nobuo Hamada,‡ Yoshiyuki Mizushina,§ and Takao Tanahashi*,† †

Kobe Pharmaceutical University, Kobe 658-8558, Japan Osaka City Institute of Public Health and Environmental Sciences, Osaka 543-0026, Japan § Laboratory of Food & Nutritional Sciences, Faculty of Nutrition, Kobe Gakuin University, Kobe 651-2180, Japan ‡

S Supporting Information *

ABSTRACT: A spore-derived mycobiont of a crustose Pyrenula sp. lichen collected in Vietnam was cultivated on a malt-yeast extract medium supplemented with 10% sucrose. Chemical investigation of the cultivated colonies led to the isolation of eight new alkylated decalin-type polyketides (1−8) along with three known compounds. The structures of these compounds were elucidated by spectroscopic and chemical means. This is the first instance of this type of polyketide being isolated from a cultured lichen mycobiont. The isolated polyketides 1 and 7 exhibited inhibitory activities against mammalian DNA polymerases α and β with IC50 values ranging from 8.1 to 19.5 μM. Compound 1 showed cytotoxic effects against the HCT116 human colon carcinoma cultured cell line with an IC50 value of 6.4 ± 0.7 μM.

L

eight new compounds (1−8) along with three known compounds: 1,8-dihydroxy-3-methylanthraquinone (chrysophanol), 1,6,8-trihydroxy-3-methylanthraquinone (emodin), and 1,5,8-trihydroxy-3-methylxanthone. The latter two compounds have been isolated from the cultured mycobionts of Pyrenula japonica.11,12 Chrysophanol has been isolated from the thalli of the lichen Asahinae chrysantha,13 but was isolated for the first time from the cultured mycobiont of a Pyrenula sp. Compound 1 was isolated as a colorless solid. The molecular formula of 1 was established as C26H36O3 by HRESIMS, implying nine degrees of unsaturation. Its UV spectrum showed a strong absorption at 300 nm, and its IR spectrum displayed absorption bands at 3431 (O−H) and 1687 (CO) cm−1. The 1 H NMR spectrum of 1 exhibited the signals for eight olefinic protons, six methine protons including an oxygenated methine, three pairs of methylene protons, and five methyl groups (Table 1). The 13C NMR spectrum of 1 showed the signals for a carboxyl carbon at δC 172.1, eight olefinic methines, and two quaternary olefinic carbons, as well as five CH3, three CH2, six CH, and an oxygenated quaternary sp3 carbon (Table 3). All proton and carbon signals were assigned by COSY, HSQC, and HMBC experiments to formulate the partial structures as a trienoic acid moiety with all-trans configurations, a tetradehydrodecalin system with two methyl groups, and a trisubtituted epoxy ring connected with a methyl group and a sec-butyl group. The presence of a carboxyl group in 1 was confirmed by its methylation to 1a. These structural features of 1 were very

ichens are symbiotic organisms, composed of a fungus (mycobiont) and one or more algae and/or cyanobacteria (phytobiont).1 Lichens are well known to produce a wide range of characteristic secondary metabolites, namely, lichen substances, some of which are potentially useful and biologically active compounds.2−5 The majority of lichen substances are secondary metabolites of the fungal component, in symbiosis or in the aposymbiotic state. Our previous studies indicated that aposymbiotically cultivated lichen mycobionts under axenic conditions produce novel substances that differ from the secondary metabolites of intact lichens, but are structurally similar to fungal metabolites.6 Vietnam has a tropical monsoon climate and a number of diverse crustose lichens that are widespread, but only a few Vietnamese lichens have been chemically studied.7 Continuing our pursuit of novel bioactive metabolites from Vietnamese lichen-derived fungi,8−10 we cultivated spore-derived mycobionts of a crustose Pyrenula sp. lichen collected in Vietnam to isolate eight new polyketides from the cultures. Details of the structure elucidation of the metabolites and evaluation of their mammalian DNA polymerase inhibitory activity and cytotoxicity against the HCT116 human colon carcinoma cultured cell line are presented here.

■

RESULTS AND DISCUSSION The polyspore-derived mycobiont of a Pyrenula sp. was cultivated on MY10 (malt-yeast extract medium supplemented with 10% sucrose) for 3 months at 18 °C in the dark. After cultivation, the colonies were harvested and extracted with Et2O, Me2CO, and then MeOH. The extracts were separated by a combination of chromatographic procedures to afford © XXXX American Chemical Society and American Society of Pharmacognosy

Received: February 18, 2014

A

dx.doi.org/10.1021/np500143k | J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Table 1. 1H NMR Data (500 MHz, CDCl3) for Compounds 1−4

H 2 3

1

2

3

4

δH, mult. (J in Hz)

δH, mult. (J in Hz)

δH, mult. (J in Hz)

δH, mult. (J in Hz)

5.81, d (15.0) 7.37, dd (15.0, 11.0) 6.23, dd (15.0, 11.0) 6.71, dd (15.0, 10.0) 6.12, dd (15.0, 10.0) 6.20, dd (15.0, 10.0) 2.32, ddd (12.0, 10.0, 6.0) 1.68, m 1.47, br t (15.0)

5.91, d (15.5) 7.40, dd (15.5, 11.0) 6.57, ddd (15.5, 11.0, 1.0) 6.38, dd (15.5, 4.5) 4.37, br dd (10.0, 4.5) 4.12, d (10.0)

5.89, d (15.0) 7.35, dd (15.0, 11.0) 6.51, dd (15.0, 11.0) 6.31, dd (15.0, 5.0) 4.34, br dd (10.0, 5.0) 4.24, br d (10.0) 2.09, m

2.04, m 2.13, m

2.01, m 2.00, m

2.27, br d (17.0)

2.33, m

5.39, br d (4.0)

5.38, br s

1.92, br t (15.0)

2.22, m 5.60, br s 2.16, br s

1.82, br t (16.0) 1.96, br d (16.5) 2.05, m 5.38, br s 2.17, br s

3.57, d (6.5)

3.46, d (6.0)

2.15, m 1.40, br d (13.0)

2.12, m 1.38, br d (13.0) 1.89, m 3.42, dd (12.0, 5.0) 3.64, br t (12.0) 1.09, d (7.5) 1.22, s 1.77, br s 1.66, br s

11

5.37, br d (3.0)

13

1.76, m

14 15 17

2.02, br dd (17.0, 3.0) 1.96, m 5.45, br s 1.79, d (6.0)

19

2.48, d (8.5)

20 21

1.31, m 1.29, m

5.84, d (15.0) 7.38, dd (15.0, 11.0) 6.24, dd (15.0, 11.0) 6.54, dd (15.0, 11.0) 6.13, dd (15.0, 11.0) 5.71, dd (15.0, 11.5) 2.25, td (11.5, 6.0) 1.50, m 1.46, br t (13.0) 1.89, br d (15.5) 5.35, br d (3.0) 1.77, br t (14.0) 2.01, br dd (16.0, 4.5) 1.96, m 5.39, br s 2.61, br d (6.0) 4.93, dd (9.5, 1.0) 2.29, m 1.17, m

22

1.66, m 0.94, t (7.5)

1.33, m 0.83, t (7.5)

23 24 25 26

0.96, 1.30, 1.73, 1.67,

0.91, 1.56, 1.57, 1.66,

4 5 6 7 8 9 10

1.99, m

similar to those of cladobotric acid C (9) isolated from the fermentation broth of the fungus of the Cladobotryum genus.14 The only structural difference was that the hydroxymethyl group of C-26 in 9 was replaced by a methyl in 1. This deduction was confirmed by HMBC correlations from the methyl signal at δH 1.67 to C-11, C-12, and C-13. The relative configuration of 1 was determined from the 1 H−1H coupling constants, NOESY correlations, and 13C NMR data. The coupling constants J8,9 (12.0 Hz) and J8,17 (6.0 Hz) suggested a trans diaxial relationship between H-8 and H-9 and a quasi-equatorial orientation of H-17. The NOESY spectrum of 1 showed correlations between H-9 and H3-24 and between H-17 and H-19, but no interaction between H-9 and H-14 and between H-19 and H3-24 (Figure 1), suggesting a trans-decalin system and a trans configuration for the epoxide ring.14 Furthermore, the 13C NMR data of 1 were in good agreement with those of 9 and cladobotric acid A (10), whose relative configuration was established via X-ray crystallography, except for the signals due to carbons around C-26 and C-17, respectively. Thus, the relative configuration of 1 was established to be identical to 9. The absolute configuration of

d (7.0) s br s br s

d (6.5) s br s br s

2.04, m

1.86, m 3.44, dd (12.5, 5.0) 3.63, td (13.0, 2.0) 1.11, d (7.5) 1.19, s 1.80, br s 1.66, br s

1 was tentatively assigned to be the same as 9 from the negative sign of their specific rotations ([α]D for 9: −43.3 (c 0.39, CHCl3)). Accordingly, compound 1 was characterized as shown and designated pyrenulic acid A. Compound 2, pyrenulic acid B, had a molecular formula of C26H36O2, namely, one oxygen atom less than for 1. The NMR spectroscopic features of 2 closely resembled those of 1, except that 2 showed an olefinic proton signal at δH 4.93 and two sp2 carbon signals at δC 134.4 (C-18) and 136.8 (C-19), instead of the oxygenated methine proton at C-19 and oxygenated sp3 carbon signals due to C-18 and C-19 as seen in 1 (Tables 1 and 3). The HMBC interactions from an olefinic proton at δH 4.93 (H-19) to C-17, 18, 20, and 21 and from H3-24 to C-17, 18, and 19 confirmed that 2 possessed a double bond at C-18/C-19 instead of the epoxy ring in 1. The geometry of the double bond was determined to be E by the NOESY cross-peak observed between H-17 and H-19. The relative configuration of 2 was deduced to be 8S*, 9R*, 14R*, and 17R* from the similarity of the coupling constants of H-8/H-9 (11.5 Hz) and B

dx.doi.org/10.1021/np500143k | J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Table 2. 1H NMR Data (500 MHz, CDCl3) for Compounds 5−8

H 2 3 4 5 6 7 8 9

a

5

6a

7

8a

δH, mult. (J in Hz)

δH, mult. (J in Hz)

δH, mult. (J in Hz)

δH, mult. (J in Hz)

5.94, d (15.0) 7.39, dd (15.0, 11.0) 6.50, dd (15.5, 11.0) 6.26, dd (15.5, 7.5) 4.30, dd (10.0, 7.5) 4.16, dd (10.0, 1.5) 2.08, ddd (11.0, 5.5, 1.5) 1.99, m

5.96, d (15.5) 7.27, dd (15.5, 11.0) 6.53, dd (15.0, 11.0) 6.25, dd (15.0, 7.0) 4.18, dd (10.0, 7.0) 3.90, d (10.0)

5.93, d (15.5) 7.40, dd (15.5, 11.0) 6.50, ddd (15.5, 11.0, 1.0) 6.36, dd (15.5, 6.0) 4.68, br t (6.0)

5.91, d (15.0) 7.27, dd (15.0, 11.0) 6.42, dd (15.0, 11.0) 6.24, dd (15.0, 8.0) 4.20, br t (8.0) 4.67, br d (8.0) 2.05, br d (11.0) 1.82, m

10

2.04, m 2.35, br d (13.0)

11 13

5.39, br d (4.5) 1.80, br t (16.0) 1.97, br d (16.0)

14

2.06, m

15 17 19

5.43, br s 2.17, br d (3.5) 3.22, d (3.0)

1.96, td (11.0, 4.0) 2.09, m 2.18, br d (16.0) 5.40, br s 1.84, m 2.00, br d (16.0, 4.0) 2.25, br t (14.0) 5.47, br s 2.10, br s 3.36, d (2.0)

20 21 22 23 24

1.72, 0.96, 1.64, 0.87, 0.99, 1.19,

1.80, 0.96, 1.63, 0.87, 0.98, 1.07,

25 26

1.88, br s 1.66, br s

m m m t (7.0) d (6.5) s

m m m t (7.5) d (7.5) s

1.89, br s 1.65, br s

4.08, dd (6.0, 5.0) 1.88, ddd (11.0, 7.0, 5.0) 1.70, br qd (11.0, 4.0) 1.80, m 2.41, br d (15.5) 5.41, br s 1.77, m 2.02, m 2.04, m 5.42, br s 2.68, br d (7.0) 3.63, d (9.0) 1.90, 1.19, 1.93, 0.93, 0.88, 5.09, 5.29, 1.56, 1.67,

m m m t (7.0) d (6.5) br s br s br s br s

quaternary carbons to C-8 and C-18. Moreover, the key HMBC interactions from H-6 to C-8 and C-19 (δC 74.6) and from H222 to C-18 (δC 78.4) established a 3,4,6-trioxygenated oxepane and a 3-oxygenated-4-methyltetrahydro-2H-pyran ring. The relative configuration of 3 was determined on the basis of the coupling constants and significant NOESY cross-peaks. The coupling constant J6,7 (10.0 Hz) suggested that H-6 and H7 were oriented in an anti-arrangement. Moreover, the coupling constant J19,20 (6.5 Hz) and the NOESY correlations of H-6/H10eq (δH 2.13), H-7/H-17, H-7/H-19, H-17/H-19, H-9/H3-24, H-22ax (δH 3.63)/H3-24, and H3-23/H3-24 indicated that H-7, H-17, and H-19 were oriented axially on the upward face, and on the other hand, H-9, H3-23, and H3-24 were directed downward (Figure 2). Further information was obtained from the 1H NMR spectrum of 3a, which was prepared from 3 through methylation followed by acetylation. The signals of a carbomethoxy and two acetyl groups in its 1H NMR spectrum indicated the presence of a carboxyl and two hydroxy groups in 3. The coupling constant J9,14 (11.5 Hz) and NOESY correlation of 8-OAc/H-14 indicated a trans-decalin system and an anti-arrangement of 8-OAc/H-9. In addition, the coupling constants J6,7 (10.0 Hz) and J19,20 (6.0 Hz) and the NOESY correlations of H-6/H-10eq, H-7/H-19, H-17/H-19, H-22ax/H3-24, and H3-23/H3-24 suggested the plausible conformation of 3a, as illustrated for 3 (Figure 2). Consequently, the relative configuration of 3 was determined to be 6R*, 7R*, 8R*, 9R*, 14S*, 17R*, 18S*, 19R*, and 20R*. The molecular formula of compound 4, pyrenulic acid D, was determined by HRESIMS as C26H36O5, which was 16 mass units less than that of 3. Its UV, IR, and NMR spectroscopic features were similar to those of 3, except that the oxygenated quaternary carbon C-8 (δC 75.97) in 3 was replaced by a methine carbon in 4 (δH 2.09 and δC 49.6). These findings, together with its molecular formula, implied that 4 possessed a proton instead of the hydroxy group at C-8. This was confirmed by the COSY cross-peaks of H-8 (δH 2.09)/H-7 (δH 4.24) and H-8/H-17 (δH 2.17) and HMBC interactions from H-8 to C-7 (δC 75.5) and C-18 (δC 80.0). The coupling constants J6,7 (10.0 Hz), J7,8 (100 26.1 >100 9.0 >100

± 0.7 ± 8.2 ± 2.8 ± 0.9

a

The cells were incubated for 24 h, and the rate of proliferation inhibition was determined by WST-1 assay. Data are shown as mean ± SD of five independent experiments.

■

Figure 4. Dose−response curves of compounds 1 and 7. The enzymes used (0.05 unit each) were immune-affinity-purified thymus pol α (white symbols) and rat recombinant pol β (black symbols). Pol activity in the absence of the compound was taken as 100%. Data are shown as mean ± SD of three independent experiments.

Table 4. IC50 Values of Compounds 1, 3, 4, 6−8, Aphidicolin, and DideoxyTTP on Mammalian Pol α and β Activitiesa IC50 value (μM) compound 1 3 4 6 7 8 aphidicolin dideoxyTTP

calf pol α 8.1 >100 47.2 >100 17.3 >100 19.6 >100

± 0.4 ± 2.6 ± 0.9 ± 1.0

rat pol β 9.5 >100 37.9 >100 19.5 >100 >100 30.8

EXPERIMENTAL SECTION

General Experimental Procedures. Melting point was measured on a Yanaco micromelting apparatus and is reported uncorrected. The specific rotations were measured on a Jasco DIP-370 digital polarimeter. The UV spectra were recorded on a Shimadzu UV-240 spectrophotometer, and the IR spectra on a Shimadzu FTIR-8200 infrared spectrophotometer. The NMR experiments were performed with Varian VXR-500, Varian Gemini-300, and Varian Gemini-200 spectrometers, with tetramethylsilane as an internal standard. HRESIMS and HRSIMS were obtained with a Hitachi M-4100 mass spectrometer. HPLC was performed using a Waters system (600E multisolvent delivery system, 2487 dual λ absorbance detector). Silica gel 60 (Merck) was used for column chromatography. Thin-layer chromatography was performed on precoated Kieselgel 60F254 plates (Merck), and spots were visualized under UV light. Fungal Material. Specimens of Pyrenula sp. were collected from tree bark in BiDoup-Nui Ba, Dalat City, Vietnam (ca. 1500 m alt.), in November 2008 by one of the authors (D.H.L.). The voucher specimens were identified by Prof. H. Miyawaki (Saga University, Japan) and deposited at Saga University, Japan (registration no. LHD210). Mycobionts were obtained from the spores discharged from apothecia of a thallus and were cultivated in test tubes containing modified MY10 medium (malt extract 10 g, yeast extract 4 g, sucrose 100 g, agar 15 g, H2O 1 L, pH 7) at 18 °C in the dark. For molecular identification of the culture strain V210, DNA extraction, PCR, and sequencing were done by the Hokkaido System Science, Co., Ltd., Sapporo, Japan. DNA was isolated from the culture using PrepMan Ultra Reagent (Applied Biosystems). The ITS region of the rDNA was amplified and sequenced using the PCR primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (ATTTGAGCTGTTGCCGCTTCA). The sequence data of V210 were deposited in DDBJ (accession number AB935436). The ITS sequence indicated similarities to sequences of Pyrenula massariospora (JQ927457; identities = 87.3%), P. mamillana (JQ927456; identities = 86.8%), and P. fetivica (JQ927454; identities = 85.5%). Furthermore, the ITS sequence of V210 suggested 62.5% and 62% sequence similarities with Cladobotryum tchimbelense (FN859419) and C. protrusum (FN859414), respectively. Extraction and Isolation. After cultivation for 3 months, the harvested colonies (111 test tubes, dry weight 31.7 g) were extracted with Et2O, Me2CO, and then MeOH (3 × 100 mL, each) at room temperature (rt), and the combined extracts were concentrated under reduced pressure to give Et2O (2.64 g), Me2CO (1.23 g), and MeOH (5.76 g) residues, respectively. The MeOH residue was dissolved in H2O and then extracted with n-BuOH to obtain an n-BuOH extract (2.70 g). The Et2O, Me2CO, and n-BuOH extracts were subjected separately to silica gel CC and eluted by the solvent system CHCl3− MeOH with increasing MeOH ratios. The Et2O extract gave five fractions: E1 (132 mg), E2 (202 mg), E3 (183 mg), E4 (1.91 g, 1% MeOH), and E5 (203 mg, 2−5% MeOH). The Me2CO extract also gave five fractions: A1 (67.8 mg), A2 (99.6 mg), A3 (44.6 mg), A4

± 0.5 ± 2.0 ± 1.1

± 1.6

a

The enzymes used (0.05 unit each) were immune-affinity-purified thymus pol α (gray bars) and rat recombinant pol β (black bars). Aphidicolin and dideoxyTTP are known inhibitors of mammalian pols α and β, respectively. Data are shown as mean ± SD of three independent experiments.

ranking was as follows: 1 > 7 > 4 > 3 > 8 > 6 (Figure S17, Supporting Information). The inhibitory strength of these compounds on pol α was similar to that on pol β. Compounds 1 and 7 showed stronger inhibition than aphidicolin and dideoxyTTP, which are known inhibitors of mammalian pols α and β, respectively21 (Table 4). Compounds 1, 3, 4, and 6−8 were also assayed for their cytotoxic effect against the HCT116 human colon carcinoma cultured cell line (Figure S18, Supporting Information). Compound 1 was the strongest suppressor of HCT116 cell growth in the tested compounds (Table 5). These results suggest that a trans-tetradehydrodecalin system with an enoic acid moiety must be essential and the number of hydroxy groups is important for the activity. Compound 1 showed stronger suppression than aphidicolin, suggesting that the suppression of human cancer cell proliferation by compound 1 might be related to inhibition of the activities of DNA replicative pol α. F

dx.doi.org/10.1021/np500143k | J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

(761 mg, 1% MeOH), and A5 (109 mg, 2−5% MeOH). From the nBuOH extract, four fractions, B1 (196 mg), B2 (320 mg), B3 (1.28 g, 1% MeOH), and B4 (205 mg, 2−5% MeOH), were obtained. These fractions were combined based on TLC examination to give five fractions: I (E1, A1, B1), II (E2, A2, B2), III (E3, A3), IV (E4, A4, B3), and V (E5, A5, B4). Fraction I (396 mg) was purified by preparative TLC (n-hexane−Et2O, 4:1 or 1:1; n-hexane−Et2O−HOAc, 75:75:1) to give chrysophanol (3.9 mg) and fatty compounds (214 mg). Fraction II (622 mg) was purified by preparative TLC (n-hexane− Et2O, 1:1; n-hexane−Et2O−HOAc, 75:75:1, 75:75:2; CHCl3−MeOH, 19:1; CHCl3−MeOH−HOAc, 19:1:0.1, 9:1:0.1) and preparative HPLC (Waters 5SL-II 20 × 250 mm, n-hexane−EtOAc, 7:3), giving emodin (4.0 mg), 1,5,8-trihydroxy-3-methylxanthone (2.2 mg), 1 (38.1 mg), 2 (10.2 mg), and fatty compounds (194.0 mg). Fraction III (228 mg) was separated by preparative TLC (CHCl3−MeOH− HOAc, 19:1:0.1, 9:1:0.1) and preparative HPLC (Waters 5SL-II 20 × 250 mm, n-hexane−Et2O, 3:2), giving 7 (32.7 mg). Fraction IV (3.95 g) was subjected to silica gel CC using CHCl3−MeOH with increasing MeOH ratios to give two subfractions, subfr IV-1 (1.15 g, 0−1% MeOH) and subfr IV-2 (3, 2.65 g, 1−2% MeOH). Subfr IV-1 was purified by preparative TLC (n-hexane−Et2O−HOAc, 5:5:0.5, 4:6:0.5) to afford 3 (721 mg) and 4 (206 mg). Fraction V (517 mg) was subjected to preparative TLC (n-hexane−Et2O−HOAc, 4:6:0.5, 3:7:0.5) and preparative HPLC (Waters 5SL-II 20 × 250 mm, n-hexane−Et2O, 7:3) to afford 3 (15.4 mg), 5 (3.5 mg), 6 (95.3 mg), and 8 (30.4 mg). Pyrenulic acid A (1): colorless solid; [α]22D −82 (c 0.85, CHCl3); UV (EtOH) λmax (log ε) 300 (4.29) nm; IR (KBr) νmax 3431, 2963, 2927, 1687, 1636, 1615, 1434 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 395.2601 [M − H]− (calcd for C26H35O3, 395.2588). Pyrenulic acid B (2): colorless solid; [α]21D −225 (c 0.95, CHCl3); UV (EtOH) λmax (log ε) 300 (4.21) nm; IR (KBr) νmax 3423, 2961, 1688, 1614, 1378, 1272 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 379.2651 [M − H]− (calcd for C26H35O2, 379.2639). Pyrenulic acid C (3): colorless solid; [α]22D −10.7 (c 0.92, CHCl3); UV (EtOH) λmax (log ε) 254 (4.36) nm; IR (KBr) νmax 3446, 2923, 1692, 1641, 1614, 1434, 1383, 1246 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 443.2445 [M − H]− (calcd for C26H35O6, 443.2435). Pyrenulic acid D (4): colorless solid; [α]23D −7.9 (c 0.86, CHCl3); UV (EtOH) λmax (log ε) 254.5 (4.38) nm; IR (KBr) νmax 3442, 2926, 1693, 1641, 1614, 1433, 1381, 1246 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 427.2493 [M − H]− (calcd for C26H35O5, 427.2486). Pyrenulic acid E (5): colorless solid; [α]22D +5.2 (c 0.30, CHCl3); UV (EtOH) λmax (log ε) 252 (4.29) nm; IR (KBr) νmax 3436, 2966, 2927, 1694, 1642, 1620, 1450, 1380, 1259 cm−1; 1H and 13C NMR data, see Tables 2 and 3; HRESIMS m/z 429.2660 [M − H]− (calcd for C26H37O5, 429.2643). Pyrenulic acid F (6): colorless solid; [α]24D −11.2 (c 0.85, CHCl3); UV (EtOH) λmax (log ε) 252.5 (4.38) nm; IR (KBr) νmax 3439, 2962, 2927, 1694, 1644, 1620, 1434, 1380, 1269 cm−1; 1H and 13C NMR data, see Tables 2 and 3; HRESIMS m/z 445.2612 [M − H]− (calcd for C26H37O6, 445.2592). Pyrenulic acid G (7): colorless solid; [α]23D −8.2 (c 0.60, CHCl3); UV (EtOH) λmax (log ε) 256.5 (4.37) nm; IR (KBr) νmax 3420, 2964, 1692, 1639, 1614, 1434, 1380, 1237 cm−1; 1H and 13C NMR data, see Tables 2 and 3; HRESIMS m/z: 411.2548 [M − H]− (calcd for C26H35O4, 411.2537). Pyrenulic acid H (8): colorless needles; mp 146−147 °C (CHCl3− MeOH); [α]22D +86 (c 1.03, MeOH); UV (EtOH) λmax (log ε) 256 (4.39) nm; IR (KBr) νmax 3423, 2695, 1693, 1643, 1614, 1434, 1382, 1309, 1264 cm−1; 1H and 13C NMR data, see Tables 2 and 3; HRESIMS m/z 427.2503 [M − H]− (calcd for C26H35O5, 427.2486). Methylation of 1. To a solution of 1 (5.5 mg) in MeOH (0.5 mL) was added excess TMS-CHN2 in n-hexane, and the mixture was stirred at rt for 30 min. After quenching using diluted HOAc in MeOH, the reaction mixture was concentrated in vacuo and the residue was

purified by preparative TLC (n-hexane−Et2O, 1:1) to yield methyl ester 1a (4.1 mg). 1a: 1H NMR (300 MHz, CDCl3) δ 0.94 (3H, t, J = 7.2 Hz, H3-22), 0.96 (3H, d, J = 7.0 Hz, H3-23), 1.23−1.33 (m), 1.28 (3H, s, H3-24), 1.40−1.62 (m), 1.67 (3H, br s, H3-26), 1.70 (m), 1.73 (3H, br s, H3-25), 1.77 (1H, d, J = 6.0 Hz, H-17), 1.90−2.06 (m), 2.31 (1H, m, H-8), 2.45 (1H, d, J = 8.4 Hz, H-19), 3.74 (3H, s, −OCH3), 5.36 (1H, br s, H-11), 5.44 (1H, br s, H-15), 5.83 (1H, d, J = 15.6 Hz, H-2), 6.14 (1H, m, H-6), 6.17 (1H, m, H-7), 6.21 (1H, dd, J = 15.0, 11.4 Hz, H-4), 6.67 (1H, dd, J = 15.0, 9.9 Hz, H-5), 7.30 (1H, dd, J = 15.3, 11.4 Hz, H-3); HRESIMS m/z 411.2892 [M + H]+ (calcd for C27H39O3, 411.2901). Methylation and Acetylation of 3. Treatment of 3 (60.2 mg) in MeOH (2.0 mL) with excess TMS-CHN2 as described above, for 45 min and purification by preparative TLC (n-hexane−Me2CO, 6:4) furnished the methyl ester of 3 (50.3 mg). To a stirred mixture of the methyl ester (7.4 mg) and isopropenyl acetate (0.12 mL) at 85−90 °C was added iodine (2.1 mg) with continued stirring at the same temperature for 5 min. After completion of the reaction, the mixture was cooled to rt, then supplemented with a 5% aqueous solution of Na2S2O3 (4.0 mL) and extracted with CHCl3 (3 × 10 mL). The CHCl3 layer was washed with a saturated solution of NaHCO3 (6.0 mL), dried over MgSO4, and concentrated in vacuo. The residue was purified by preparative TLC (CHCl3−EtOAc, 9:1) to yield 3a (4.3 mg). 3a: 1H NMR (500 MHz, CDCl3) δ 1.05 (3H, d, J = 7.5 Hz, H323), 1.20 (3H, s, H3-24), 1.38 (1H, br dd, J = 13.5, 1.5, H-21eq), 1.69 (3H, br s, H3-26), 1.72 (3H, br s, H3-25), 1.86 (3H, s, 8-OCOCH3), 1.91 (1H, m, H-13), 1.95 (1H, m, H-21ax), 1.97 (3H, s, 7-OCOCH3), 2.02 (1H, m, H-13), 2.13 (1H, m, H-20), 2.17 (1H, m, H-9), 2.25 and 2.27 (each 1H, m, H2-10), 2.35 (1H, br t, J = 11.5 Hz, H-14), 3.43 (1H, br dd, J = 12.0, 5.0 Hz, H-22eq), 3.59 (1H, td, J = 12.5, 2.0 Hz, H-22ax), 3.746 (3H, s, COOCH3), 3.752 (1H, br s, H-17), 3.87 (1H, d, J = 6.0 Hz, H-19), 4.32 (1H, dd, J = 10.0, 7.5 Hz, H-6), 5.40 (1H, br s, H-11), 5.47 (1H, br q, J = 1.5 Hz, H-15), 5.87 (1H, d, J = 15.5 Hz, H-2), 6.16 (1H, dd, J = 15.0, 7.5 Hz, H-5), 6.32 (1H, dd, J = 15.0, 11.0 Hz, H-4), 6.38 (1H, d, J = 10.0 Hz, H-7), 7.24 (1H, dd, J = 15.0, 11.0 Hz, H-3); 13C NMR (125 MHz, CDCl3) δ 13.6 (C-23), 15.6 (C-24), 20.9 (8−OCOCH3), 21.8 (7−OCOCH3), 23.3 (C-26), 25.4 (C-25), 28.9 (C-10), 31.4 (C-21), 32.1 (C-20), 36.8 (C-13), 38.3 (C-9), 38.4 (C-14), 51.6 (COOCH3), 54.7 (C-22), 56.8 (C-17), 73.1 (C-7), 74.5 (C-19), 76.3 (C-6), 78.3 (C-18), 86.5 (C-8), 121.4 (C-11), 122.0 (C2), 127.5 (C-15), 130.6 (C-4), 132.2 (C-16), 134.4 (C-12), 139.5 (C5), 143.7 (C-3), 167.1 (C-1), 168.6 (7-OCOCH3), 169.4 (8OCOCH3); HRESIMS m/z 565.2773 [M + Na]+ (calcd for C31H42O8Na, 565.2779). Preparation of (R)- and (S)-MPA Esters of 4. Treatment of 4 (10.0 mg) with TMS-CHN2 gave a methyl ester (8.2 mg). To a solution of the methyl ester (4.5 mg) in dry CH2Cl2 (2.0 mL) was added (R)-MPA (7.7 mg), 1-ethyl-3-(3-(dimethylamino)propyl)carbodiimide (12.4 mg), and a catalytic amount of 4-pyrrolidinopyridine, and the mixture was stirred at rt for 23 h. The reaction mixture was poured into 1 N HCl and extracted with CHCl3. The CHCl3 layer was washed with H2O, dried, and concentrated in vacuo. The residue was purified by preparative TLC (n-hexane−Et2O−HOAc, 4:6:0.4) and preparative HPLC (n-hexane−Et2O, 6:4) to give 4a (3.3 mg). The methyl ester of 4 (3.6 mg) was treated with (S)-MPA (8.0 mg) as described above to yield 4b (1.8 mg). Compound 4a: 1H NMR (500 MHz, CDCl3) δ 1.052 (3H, d, J = 7.5 Hz, H3-23), 1.150 (1H, m, Hax-10), 1.161 (3H, s, H3-24), 1.380 (1H, br d, J = 13.0 Hz, H-21eq), 1.616 (3H, br s, H3-26), 1.728 (3H, br s, H3-25), 1.731 (1H, m, H-14), 1.747 (1H, m, H-13), 1.809 (1H, ddd, J = 12.0, 4.0, 2.0 Hz, H-8), 1.850 (1H, m, H-13), 1.882 (1H, m, H-21ax), 1.871 (1H, m, H-9), 1.997 (1H, br d, J = 16.5 Hz, H-10eq), 2.063 (1H, br q, J = 6.0 Hz, H-20), 2.254 (1H, d, J = 4.0 Hz, H-17), 3.347 (3H, s, MPA-OCH3), 3.406 (1H, dd, J = 12.0, 4.5 Hz, H-22eq), 3.531 (1H, d, J = 6.0 Hz, H-19), 3.604 (1H, td, J = 12.5, 2.0, H-22ax), 3.760 (3H, s, COOCH3), 4.366 (1H, dd, J = 10.0, 6.0 Hz, H-6), 4.629 (1H, s, MPA-CH), 5.222 (1H, br d, J = 5.5 Hz, H-11), 5.285 (1H, br s, H-15), 5.525 (1H, dd, J = 10.0, 2.0 Hz, H-7), 5.804 (1H, d, J = 15.5 Hz, H-2), 5.995 (1H, dd, J = 15.5, 6.0 Hz, H-5), 6.195 (1H, dd, J = 15.5, 11.0 Hz, H-4), 7.162 (1H, dd, J = 15.5, 11.0 Hz, H-3), 7.311− G

dx.doi.org/10.1021/np500143k | J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

7.366 (5H, m, MPA-Ph); 13C NMR (125 MHz, CDCl3) δ 13.6 (C23), 16.1 (C-24), 23.3 (C-26), 25.6 (C-25), 31.8 (C-21), 32.1 (C-10), 32.3 (C-20), 33.3 (C-9), 37.3 (C-13), 41.8 (C-14), 46.1 (C-8), 51.6 (COOCH3), 54.5 (C-22), 55.7 (C-17), 57.4 (MPA-OCH3), 74.7 (C19), 75.2 (C-6), 76.0 (C-7), 79.6 (C-18), 82.9 (MPA-CH), 121.6 (C11), 121.9 (C-2), 127.5 (7-MPA-Ph), 128.1 (C-15), 128.7, 129.0 (MPA-Ph), 130.2 (C-4), 133.8 (C-12), 135.3 (C-16), 135.6 (MPAPh), 139.6 (C-5), 143.6 (C-3), 167.1 (C-1), 169.5 (MPA-CO); HRESIMS m/z 613.3132 [M + Na]+ (calcd for C36H46O7Na, 613.3143). Compound 4b: 1H NMR (500 MHz, CDCl3) δ 1.031 (3H, d, J = 7.0 Hz, H3-23), 1.177 (3H, s, H3-24), 1.355 (1H, br d, J = 14.0 Hz, H21eq), 1.674 (3H, br s, H3-26), 1.754 (3H, br s, H3-25), 1.797 (1H, m, H-10ax), 1.820 (1H, m, H-13), 1.850 (1H, m, H-21ax), 1.960 (1H, m, H-13), 1.990 (1H, m, H-14), 2.010 (1H, m, H-9), 2.031 (1H, m, H20), 2.080 (1H, ddd, J = 12.0, 4.0, 2.0 Hz, H-8), 2.230 (1H, br d, J = 15.0 Hz, H-10eq), 2.300 (1H, d, J = 4.0 Hz, H-17), 3.373 (3H, s, MPA-OCH3), 3.380 (1H, m, H-22eq), 3.479 (1H, d, J = 6.0 Hz, H19), 3.601 (1H, td, J = 13.0, 2.0, H-22ax), 3.760 (3H, s, COOCH3), 4.245 (1H, dd, J = 10.0, 6.0 Hz, H-6), 4.654 (1H, s, MPA-CH), 5.354 (1H, br s, H-15), 5.400 (1H, br d, J = 5.0 Hz, H-11), 5.442 (1H, dd, J = 10.5, 2.0 Hz, H-7), 5.604 (1H, d, J = 15.0 Hz, H-2), 5.652 (1H, dd, J = 15.5, 6.0 Hz, H-5), 5.787 (1H, dd, J = 15.5, 11.0 Hz, H-4), 6.914 (1H, dd, J = 15.5, 10.5 Hz, H-3), 7.320−7.352 (5H, m, MPA-Ph); 13C NMR (500 MHz, CDCl3) δ 13.5 (C-23), 16.1 (C-24), 23.3 (C-26), 25.6 (C-25), 31.8 (C-21), 32.3 (C-20), 32.9 (C-10), 33.5 (C-9), 37.3 (C-13), 42.0 (C-14), 46.4 (C-8), 51.6 (COOCH3), 54.5 (C-22), 55.6 (C-17), 57.4 (MPA-OCH3), 74.7 (C-19), 75.2 (C-6), 76.3 (C-7), 79.6 (C-18), 82.7 (MPA-CH), 121.4 (C-11), 121.7 (C-2), 127.2 (MPAPh), 128.0 (C-15), 128.7, 128.9 (MPA-Ph), 129.9 (C-4), 134.5 (C12), 135.5 (C-16), 135.8 (MPA-Ph), 139.3 (C-5), 143.6 (C-3), 167.1 (C-1), 169.4 (MPA-CO); HRESIMS m/z 613.3135 [M + Na]+ (calcd for C36H46O7Na, 613.3143). Preparation of (R)- and (S)-MPA Esters of 7. Compound 7 (8.2 mg) was methylated with TMS-CHN2 to yield a methyl ester (6.4 mg). Portions of the methyl ester (3.2 and 2.3 mg) were separately esterified to afford (R)-MPA ester 7a (1.7 mg) and (S)-MPA ester 7b (1.2 mg). Compound 7a: 1H NMR (500 MHz, CDCl3) δ 0.812 (3H, d, J = 6.5 Hz, H3-23), 0.878 (3H, t, J = 7.0 Hz, H3-22), 1.089 (1H, m, H-21), 1.150 (1H, m, H-10), 1.590 (3H, br s, H3-25), 1.609 (3H, br s, H3-26), 1.671 (1H, m, H-13), 1.750 (1H, m, H-9), 1.750 (1H, m, H-20), 1.770 (2H, m, H-10, H-14), 1.781 (1H, m, H-21), 1.854 (1H, m, H-8), 1.891 (1H, m, H-13), 2.763 (1H, d, J = 5.0 Hz, H-17), 3.351 (3H, s, MPAOCH3), 3.667 (1H, d, J = 9.0 Hz, H-19), 3.768 (3H, s, COOCH3), 4.333 (1H, m, H-6), 4.602 (1H, s, MPA-CH), 5.041 (1H, s, H-24), 5.188 (1H, br s, H-11), 5.245 (1H, s, H-24), 5.330 (1H, br s, H-15), 5.417 (1H, br d, J = 8.0 Hz, H-7), 5.852 (1H, d, J = 15.5 Hz, H-2), 5.982 (1H, dd, J = 15.5, 7.0 Hz, H-5), 6.245 (1H, dd, J = 15.5, 11.0 Hz, H-4), 7.158 (1H, dd, J = 15.5, 11.0 Hz, H-3), 7.312−7.348 (5H, m, MPA-Ph); 13C NMR (125 MHz, CDCl3) δ 10.9 (C-22), 16.2 (C-23), 22.1 (C-25), 23.3 (C-26), 25.3 (C-21), 30.8 (C-10), 32.0 (C-9), 37.1 (C-20), 37.6 (C-13), 39.2 (C-14), 43.7 (C-8), 51.0 (C-17), 51.6 (COOCH3), 57.5 (MPA-OCH3), 74.3 (C-6), 76.1 (C-7), 82.3 (C-19), 82.9 (MPA-CH), 117.0 (C-24), 121.45 (C-11), 121.50 (C-2), 127.4 (MPA-Ph), 128.0 (C-15), 128.6, 128.9 (MPA-Ph), 129.9 (C-4), 132.8 (C-16), 133.2 (C-12), 135.6 (MPA-Ph), 139.7 (C-5), 143.9 (C-3), 145.6 (C-18), 167.3 (C-1), 169.4 (MPA-CO); HRESIMS m/z 597.3187 [M + Na]+ (calcd for C36H46O6Na, 597.3194). Compound 7b: 1H NMR (500 MHz, CDCl3) δ 0.802 (3H, d, J = 6.5 Hz, H3-23), 0.849 (3H, t, J = 7.0 Hz, H3-22), 1.040 (1H, m, H-21), 1.617 (3H, br s, H3-25), 1.669 (3H, br s, H3-26), 1.726 (1H, m, H-21), 1.738 (1H, m, H-20), 1.760 (1H, m, H-13), 1.800 (1H, m, H-10), 1.850 (1H, m, H-9), 1.980 (1H, m, H-14), 1.990 (1H, br d, J = 14.0 Hz, H-13), 2.080 (1H, br d, J = 14.0 Hz, H-10), 2.110 (1H, ddd, J = 11.0, 5.5, 2.5 Hz, H-8), 2.812 (1H, d, J = 5.5 Hz, H-17), 3.362 (3H, s, MPA-OCH3), 3.654 (1H, d, J = 9.0 Hz, H-19), 3.779 (3H, s, COOCH3), 4.213 (1H, t, J = 7.5 Hz, H-6), 4.630 (1H, s, MPA-CH), 5.074 (1H, s, H-24), 5.249 (1H, s, H-24), 5.346 (1H, dd, J = 7.5, 2.5 Hz, H-7), 5.393 (1H, br s, H-11), 5.400 (1H, br s, H-15), 5.594 (1H,

dd, J = 15.5, 7.5 Hz, H-5), 5.681 (1H, d, J = 15.5 Hz, H-2), 5.977 (1H, dd, J = 15.5, 11.0 Hz, H-4), 6.836 (1H, dd, J = 15.5, 11.0 Hz, H-3), 7.325−7.345 (5H, m, MPA-Ph); 13C NMR (125 MHz, CDCl3): δ 10.9 (C-22), 16.2 (C-23), 22.0 (C-25), 23.3 (C-26), 25.2 (C-21), 31.5 (C10), 32.2 (C-9), 37.2 (C-20), 37.7 (C-13), 39.3 (C-14), 43.8 (C-8), 51.0 (C-17), 51.5 (COOCH3), 57.3 (MPA-OCH3), 73.9 (C-6), 76.6 (C-7), 82.6 (C-19), 82.7 (MPA-CH), 117.1 (C-24), 121.2 (C-2), 121.9 (C-11), 127.2 (MPA-Ph), 127.9 (C-15), 127.9, 128.7 (MPAPh), 129.5 (C-4), 133.0 (C-16), 133.9 (C-12), 135.7 (MPA-Ph), 139.3 (C-5), 144.1 (C-3), 145.4 (C-18), 167.3 (C-1), 169.2 (MPA-CO); HRESIMS m/z 597.3191 [M + Na]+ (calcd for C36H46O6Na, 597.3194). DNA Polymerase Assay. Pol α was purified from calf thymus by immuno-affinity column chromatography, as described by Tamai et al.22 Recombinant rat pol β was purified from E. coli JMpβ5, as described by Date et al.23 The reaction mixtures for these pols have been described previously.24,25 For pols, poly(dA)/oligo(dT)18 (A/T = 2:1) (Sigma-Aldrich Inc.) and [3H]-deoxythymidine 5′-triphosphate (dTTP) (43 Ci/mmol) (Moravek Biochemicals Inc.) were used as the DNA template-primer substrate and nucleotide (i.e., dNTP) substrate, respectively. Each compound was dissolved in distilled DMSO at a final concentration of 100 μM and sonicated for 30 s. Aliquots of 4 μL sonicated samples were mixed with 16 μL of each enzyme (final amount 0.05 unit) in 50 mM Tris-HCl (pH 7.5) containing 1 mM dithiothreitol, 50% glycerol, and 0.1 mM EDTA and kept at 0 °C for 10 min. These inhibitor−enzyme mixtures (8 μL) were added to each of 16 μL enzyme standard reaction mixtures, and incubation was carried out at 37 °C for 60 min. Activity without the inhibitor was considered 100%, and the activity at each inhibitor concentration was determined relative to this value. One unit of pol activity was defined as the amount of enzyme that catalyzed the incorporation of 1 nmol of dNTP (i.e., dTTP) into synthetic DNA template-primers in 60 min at 37 °C under normal reaction conditions for each enzyme.24,25 Cell Culture and Measurement of Cell Viability. To investigate the effects of each compound on cultured human cancer cells, HCT116 human colon carcinoma cells were used. This human cancer cell line was obtained from the American Type Culture Collection. HCT116 cells were cultured in McCoy’s 5A medium supplemented with 10% fetal bovine serum, penicillin (100 units/mL), and streptomycin (100 μg/mL) at 37 °C in a humid atmosphere of 5% CO2/95% air. For the cell viability assay, cells were plated at 1 × 104 into each well of a 96-well microplate with 10 and 100 μM compound and incubated for 24 h. Cell viability was determined by the WST-1 assay.26

■

ASSOCIATED CONTENT

S Supporting Information *

NMR spectra for compounds 1−8 and biological activities of compounds 1, 3, 4, and 6−8 are available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel: +81 78 441 7545. Fax: +81 78 441 7547. E-mail: [email protected]. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We are grateful to the Vietnamese Government (Project 322, Ministry of Education and Training) for the fellowship to D.H.L. We thank Prof. H. Miyawaki (Saga University, Japan) for identification of the lichen specimens. Thanks are also due to Drs. M. Sugiura and C. Tode (Kobe Pharmaceutical University) for 1H and 13C NMR spectra, and to Dr. A. Takeuchi (Kobe Pharmaceutical University) for mass spectral measurements. We thank Dr. S. Nadanaka and Prof. H. H

dx.doi.org/10.1021/np500143k | J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Kitagawa (Kobe Pharmaceutical University) and Dr. K. Hara (Akita Prefectural University, Japan) for their valuable suggestions on DNA sequence analysis. This research was financially supported in part by Kobe Pharmaceutical University Collaboration Fund and a Grant-in-Aid for Scientific Research (C) (No. 26460137) from the Japan Society for the Promotion of Science (JSPS).

■

REFERENCES

(1) Ahmadjian, V. The Lichen Symbiosis; John Wiley and Sons, Inc.: New York, 1993. (2) Huneck, S. In Progress in the Chemistry of Organic Natural Products; Herz, W.; Falk, H.; Kirby, G. W.; Moore, R. E., Eds.; Springer Verlag: Wien, 2001; Vol. 81, pp 1313. (3) Molnár, K.; Frakas, E. Z. Naturforsch. 2010, 65c, 157−173. (4) Müller, K. Appl. Microbiol. Biotechnol. 2001, 56, 9−16. (5) Shukla, V.; Joshi, G. P.; Rawat, M. S. M. Phytochem. Rev. 2010, 9, 303−314. (6) Tanahashi, T.; Kuroishi, M.; Kuwahara, A.; Nagakura, N.; Hamada, N. Chem. Pharm. Bull. 1997, 45, 1183−1185. (7) Aptroot, A.; Sparrius, B. L. Bryologist 2006, 109, 358−371. (8) Le, D. H.; Takenaka, Y.; Hamada, N.; Tanahashi, T. Phytochemistry 2013, 72, 1431−1435. (9) Le, D. H.; Takenaka, Y.; Hamada, N.; Miyawaki, H.; Tanahashi, T. Chem. Pharm. Bull. 2013, 61, 358−362. (10) Takenaka, Y.; Naito, Y.; Le, D. H.; Hamada, N.; Tanahashi, T. Heterocycles 2013, 87, 1897−1902. (11) Tanahashi, T.; Takenaka, Y.; Ikuta, Y.; Tani, K.; Nagakura, N.; Hamada, N. Phytochemistry 1999, 52, 401−405. (12) Takenaka, Y.; Tanahashi, T.; Nagakura, N.; Hamada, N. Z. Naturforsch. 2000, 55c, 910−914. (13) Mishchenko, N. P.; Stepanenko, L. S.; Krivoshchekova, O. E.; Maksimov, O. B. Khim. Prir. Soedin. 1980, 2, 160−165. (14) Mitova, M. I.; Lang, G.; Blunt, J. W.; Cummings, N. J.; Cole, A. L. J.; Robinson, W. T.; Munro, M. H. G. J. Org. Chem. 2006, 71, 492− 497. (15) Latypov, Sh.K.; Seco, J. M.; Quiñoá, E.; Riguera, R. J. Org. Chem. 1996, 61, 8569−8577. (16) Takenaka, Y.; Tanahashi, T.; Nagakura, N.; Itoh, A.; Hamada, N. Phytochemistry 2004, 65, 3119−3123. (17) Takenaka, Y.; Nagakura, N.; Hamada, N.; Tanahashi, T. Heterocycles 2010, 81, 1931−1935. (18) Kuramoto, M.; Yamada, K.; Shikano, M.; Yazawa, K.; Arimoto, H.; Okamura, T.; Uemura, D. Chem. Lett. 1997, 26, 885−886. (19) Mizushina, Y. Biosci. Biotechnol. Biochem. 2009, 73, 1239−1251. (20) Loeb, L. A.; Monnat, R. J., Jr. Nat. Rev. Genet. 2008, 9, 594−604. (21) Kornberg, A.; Baker, T. A. DNA Replication, 2nd ed.; W. H. Freeman and Co.: New York, 1992; Chapter 6, pp 197225. (22) Tamai, K.; Kojima, K.; Hanaichi, T.; Masaki, S.; Suzuki, M.; Umekawa, H.; Yoshida, S. Biochim. Biophys. Acta 1988, 950, 263−273. (23) Date, T.; Yamaguchi, M.; Hirose, F.; Nishimoto, Y.; Tanihara, K.; Matsukage, A. Biochemistry 1988, 27, 2983−2990. (24) Mizushina, Y.; Tanaka, N.; Yagi, H.; Kurosawa, T.; Onoue, M.; Seto, H.; Horie, T.; Aoyagi, N.; Yamaoka, M.; Matsukage, A.; Yoshida, S.; Sakaguchi, K. Biochim. Biophys. Acta 1996, 1308, 256−262. (25) Mizushina, Y.; Yoshida, S.; Matsukage, A.; Sakaguchi, K. Biochim. Biophys. Acta 1997, 1336, 509−521. (26) Ishiyama, M.; Tominaga, H.; Shiga, M.; Sasamoto, K.; Ohkura, Y.; Ueno, K. Biol. Pharm. Bull. 1996, 19, 1518−1520.

I

dx.doi.org/10.1021/np500143k | J. Nat. Prod. XXXX, XXX, XXX−XXX