Post-PEGylation of siRNA Lipo-oligoamino Amide Polyplexes Using

Article pubs.acs.org/molecularpharmaceutics

Post-PEGylation of siRNA Lipo-oligoamino Amide Polyplexes Using Tetra-glutamylated Folic Acid as Ligand for Receptor-Targeted Delivery Katharina Müller,† Eva Kessel,†,‡,§ Philipp M. Klein,†,§ Miriam Höhn,† and Ernst Wagner*,†,‡ †

Pharmaceutical Biotechnology, Center for System-Based Drug Research, Ludwig-Maximilians-Universität München, Butenandtstrasse 5-13, 81377 Munich, Germany ‡ Nanosystems Initiative Munich, Schellingstrasse 4, D-80799 Munich, Germany S Supporting Information *

ABSTRACT: For efficient and receptor-specific siRNA delivery, a new post-PEGylation strategy was established to provide siRNA polyplexes with targeting and shielding agents. For this purpose, core nanoparticles were formed by complexing siRNA with sequence-defined cationic lipo-oligomers. The T-shaped bis-oleoyl-oligoethanamino amides 454 and 595, containing stabilizing tyrosine and cysteine residues, were applied. These core nanoparticles were surface-shielded by reaction with maleimido-polyethylene glycol (Mal-PEG) reagents, optionally containing the targeting ligand folic acid (FolA). The PEGylation had two unpredicted consequences. First, FolA-PEG surface-modified polyplexes agglomerated due to the hydrophobicity of folic acid, resulting in ligand-independent gene silencing. This problem was solved by the use of tetra-γ-glutamyl folic acid (gE4-FolA) as targeting ligand. Post-PEGylated gE4-FolA siRNA polyplexes displayed sizes of 100−200 nm and mediated receptor specific uptake and effective gene silencing. Second, PEGylation triggered a destabilization of polyplexes, which was uncritical in cell culture but a limiting factor in vivo, as revealed by biodistribution studies in mice. This problem was partially overcome by selecting 595 (containing two CRC stability motifs) for polyplex core formation and an optimized lower degree of gE4-FolA PEGylation reagent. Biodistribution in L1210 tumor bearing mice demonstrated a significantly reduced lung signal and extended persistence of siRNA polyplexes (up to 8 h), with moderate delivery into the tumor. Further polyplex stabilization will be required for effective tumor-targeted delivery. KEYWORDS: post-PEGylation, sequence defined oligomers, siRNA, folic acid, targeting ligand, polyglutamylation

■

INTRODUCTION The treatment of cancer is still a major challenge for research, considering the obstacles associated with the malignancy and diversity of this disease. The downregulation of essential proteins using small interfering RNA (siRNA) emerged as hopeful therapeutic modality also against cancer.1−4 The design of effective, targeted in vivo siRNA delivery methods has been the focus of numerous efforts considered as most critical for medical translation.5−7 Approaches include chemically modified and stabilized siRNA in free or conjugated form, liposome-based formulations, lipo-polymer micelles, and polymer-based complexes.8−20 Recently solid phase-supported polymer synthesis21 has been adopted in several laboratories to generate defined and precise oligomers and lipo-oligomers with various functional moieties to enhance the stability, binding affinity, and targeting ability of siRNA and other nucleic acid polyplexes.16,22−29 Especially the introduction of ligands is necessary for specific binding of polyplexes to their target cells.30 Folic acid (FolA) is a widely used drug targeting ligand with high affinity to the folate receptor (FR).31−35 FR is a favorable target because of its overexpression in many tumor tissues including ovarian, breast, colon, and kidney cancer.36−38 The incorporation of polyethylene glycol (PEG) into targeted systems is an effective method for nanoparticle © XXXX American Chemical Society

shielding, reducing toxicity, and undesirable interactions with blood component and nontarget tissues.39,40 Despite the advantages offered by PEG, a high degree of PEGylation may reduce polyplex compaction and stability, cellular uptake, and endosomal escape of nanoparticles.41−46 This might be critical, as the smaller siRNA often forms also less stable polyplexes than the larger pDNA.47 In our recent work a newly designed FolA-PEG-linked oligo(ethanamino) amide (356)27 formed very small (6 nm) unimolecular siRNA polyplexes that were well-shielded and displayed target receptor specificity. Polyplexes, however, required conjugation of siRNA with endosomolytic Inf7 peptide for gene silencing activity and, because of their small size, were rapidly cleared from blood circulation through renal filtration. The current work aimed at the design of new FR-targeted siRNA polyplexes with sizes and stability well compatible with systemic circulation but no dependency on additional endosomolytic agents. Instead of using PEG-containing oligomers for polyplex formation (pre-PEGylation),27,44 a post-PEGylation Received: February 4, 2016 Revised: April 6, 2016 Accepted: May 13, 2016

A

DOI: 10.1021/acs.molpharmaceut.6b00102 Mol. Pharmaceutics XXXX, XXX, XXX−XXX

Article

Molecular Pharmaceutics strategy48,49 was chosen to avoid problems with siRNA packaging into the polyplex core. From our existing oligomer library, two T-shaped cationic lipo-oligomers (454 and 595)28,50 were selected for core polyplex formation, as they appear to fulfill these requirements at least in the nontargeted version. They assemble into 100−150 nm siRNA polyplexes with high potency in gene silencing. Furthermore, their stability is improved by tyrosine trimers (454, 595) and optionally also CRC motifs (595). These core polyplexes were further modified with maleimide-PEG-FolA reagents via reacting with free 454 or 595 cysteines of the polyplexes. As alternative to standard FolA, a new, less hydrophobic tetra-glutamylated folate molecule, gE4-FolA, was synthesized and tested as FR targeting ligand. The following sections describe the benefits of post-PEGylation with the new targeting ligand, resulting in efficient and FRspecific gene silencing in vitro. The less predictable consequences of PEGylation were a reduced polyplex core stability as revealed by in vivo biodistribution studies.

(sense: 5′-GGAuGAAGuGGAGAuuAGudTsdT-3′, antisense: 5′-ACuAAUCUCcACUUcAUCCdTsdT-3′); Cy7 labeled AHA1-siRNA was labeled at the sense strand ((Cy7) (NHC6)GGAuGAAGuGGAGAuuAGudTsdT), and EG5-siRNA (sense: ucGAGAAucuAAAcuAAcudTsdT, antisense: AGUuAGUUuAGAUUCUCGAdTsdT). Peptide modified sequences Inf7-siGFP (sense: Inf7-ss-C6−5′-AuAucAuGGccGAcAAGcAdTsdT-3′; antisense: 5′-UGCUUGUCGGCcAUGAuAUdTsdT-3′) and its control Inf7-siCtrl (sense: Inf7-ss-C6−5′AuGuAuuGGccuGuAuuAGdTsdT-3′; antisense: 5′-CuAAuAcAGGCcAAuAcAUdTsdT-3′) were synthesized as published.27 Polyplex Formation and Post-PEGylation. siRNA (500 ng) and the calculated amount of oligomer at N/P10 were diluted in separate tubes (10 μL each) in HBG pH 7.4 (with an ionic strength leading to small particles: 20 mM HEPES, 5% glucose). An N/P of 10 was selected because it is sufficiently high to form stable polyplexes, but sufficiently low to keep the fraction of free oligomer low. The polymer solution was added to the siRNA solution, mixed by pipetting and incubated for 45 min at RT. After polyplex formation, postPEGylation reagent calculated at indicated molar equivalents of the amount of oligomer was added in 5 μL HBG and incubated for 15 min at RT. Particle Size and Zeta Potential. For dynamic light scattering (DLS) measurements post-PEGylated polyplex solution was measured in a folded capillary cell (DTS 1070) using a Zetasizer Nano ZS with backscatter detection (Malvern Instruments, Worcestershire, UK). Polyplex solution was prepared as described above (500 ng siRNA, N/P10) with a 3-fold approach in order to have enough material for measurements. For size measurements, the equilibration time was 0 min, the temperature was 25 °C, and an automatic attenuator was used. The refractive index of the solvent was 1.330, and the viscosity was 0.8872 mPa·s. For calculation of the number size distribution the refractive index of polystyrene latex (1.590) was used. Each sample was measured 3 times. For zeta potential measurements, the sample was diluted 1:16 with 20 mM HEPES buffer. Zeta potentials were calculated by the Smoluchowski equation. Ten to 15 sub-runs lasting 10 s each at 25 °C (n = 3) were measured. Cell Culture. Human KB/eGFPLuc cells stably expressing luciferase (eGFP-luciferase fusion gene under the control of the CMV promoter) and L1210 cells were cultivated in folate free RPMI-1640 medium, supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin. Gene Silencing with siRNA. Gene silencing experiments were performed in KB/eGFPLuc cells. Used siRNAs were either siRNA against eGFP for silencing the eGFPLuc fusion protein or its control sequence siCtrl. For the positive control 356 siGFP-Inf7 conjugated with the lytic peptide Inf7 and its control sequence siCtrl-Inf7 was used.27 Silencing experiments were performed in triplicates in 96-well plates. One day prior to transfection, plates were coated with collagen and 4000 cells/ well were seeded. Before transfection the medium was replaced by 80 μL of fresh medium for polyplexes without PEGylation or 75 μL for post-PEGylated polyplexes. In receptor blocking experiments, cells were incubated with the same volume of folic acid saturated media 30 min before transfection at 37 °C. Twenty microliters of polyplexes containing 500 ng of siRNA or 25 μL of post-PEGylated polyplexes containing 500 ng of siRNA (prepared as described above) were added to each well and incubated at 37 °C. Medium was replaced after the

■

MATERIALS AND METHODS Materials. Oligomers 454 and 595 were synthesized as described before.28,50 All cell culture consumables were obtained from NUNC (Langenselbold, Germany) or TPP (Trasadingen, Switzerland). Resins and fmoc-Glu-OtBu were purchased from Novabiochem GmbH (Hohenbrunn, Germany), N10(trifluoroacetyl) pteroic acid was obtained from Niels ClausonKaas A/S (Farum, Denmark), and Fmoc-NH-(PEG)27-COOH (28 ethylene glycol monomer units, approximately 1.3 kDa) was purchased from Polypure (Oslo, Norway). Benzotriazol-1-yloxy-tris-pyrrolidino-phosphonium hexafluorophosphate (Pybop) and syringe reactors (PP reactor with PE frit) from Multisyntech GmbH (Witten, Germany). Peptide grade dimethylformamide (DMF), dichloromethane (DCM), N,N-diisopropylethylamine (DIPEA), piperidine, trifluoroacetic acid (TFA), and all other Fmoc-protected amino acids were purchased from Iris Biotech (Marktredwitz, Germany). Hydrazine, p. a. grade methanol (MeOH), triisopropylsilane (TIS), 1-hydroxy-benzotriazole (HOBt), 6-maleimidohexanoic acid, ethidium bromide (EtBr), 1,8-diazabicycloundec-7-ene (DBU), 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide (MTT), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (Munich, Germany). Acetonitrile (ACN) HPLC grade was from VWR International GmbH (Darmstadt, Germany), and ammonia solution 25% was from Carl Roth GmbH (Karlsruhe, Germany). The SDHB matrix (mixture of 2,5-dihydroxybenzoic acid (2,5-DHB) and 2-hydroxy-5-methoxybenzoic acid) for MALDI mass measurements was purchased from Bruker Daltonics (Bremen, Germany). Fetal bovine serum (FBS) and folate free RPMI-1640 were purchased from Life Technologies (Carlsbad, USA) and heparin-sodium-25000 (source: pig) from Ratiopharm (Ulm, Germany). Luciferase cell culture 5× lysis buffer and D-luciferin sodium were obtained from Promega (Mannheim, Germany), antibiotics and collagen from Biochrom (Berlin, Germany), DAPI from Sigma-Aldrich (München, Germany), and HEPES from Biomol GmbH (Hamburg, Germany). peqGOLD TriFastTM was obtained from PEQLAB Biotechnology GmBH (Erlangen, Germany). siRNA duplexes were purchased from Axolabs GmbH (Kulmbach, Germany): GFP-siRNA (sense: 5′-AuAucAuGGccGAcAAGcAdTsdT-3′, antisense: 5′-UGCUUGUCGGCcAUGAuAUdTsdT-3′; small letters: 2′-methoxy; s: phosphorothioate) for silencing of eGFPLuc; control-siRNA (sense: 5′-AuGuAuuGGccuGuAuuAGdTsdT-3′, antisense: 5′-CuAAuAcAGGCcAAuAcAUdTsdT-3′), AHA1-siRNA B


Article

Molecular Pharmaceutics

were mixed in a total volume of 200 μL for non-PEGylated polyplexes and 250 μL for PEGylated polyplexes. Mice were anesthetized with 3% isoflurane in oxygen, and polyplexes were injected into the tail vein. Distribution of polyplexes was measured after 0 min, 15 min, 30 min, 1 h, 4 h, and 8 h using a CCD camera and analyzed via Living Image software. Experiments were performed in triplicates. RT-qPCR of AHA1-siRNA in Organs. RNA was extracted from organs using peqGOLD TriFastTM (PEQLAB Biotechnology GmBH, Germany) according to the manufacturer’s protocol. RNA (1 μg) was transcribed with qScript microRNA cDNA synthesis kit (Quanta BioScience, USA) into cDNA. RT-qPCR was performed using PerfecTa SYBR Green SuperMix (Quanta BioScience, USA) on a LightCycler 480 system (Roche, Germany) with miR-191 as a housekeeper. Following primers were used: miR-191 forward, GCGCAACGGAATCCCAAAAG, and AHA1 forward, GAGACTAATCTCCACTTC (SigmaAldrich, Germany). Results were analyzed using the ΔCT method.

indicated incubation time. At 48 h after initial transfection cells were treated with 100 μL cell lysis buffer. Luciferase activity in 35 μL of cell lysate was measured using a Centro LB 960 plate reader luminometer (Berthold Technologies, Bad Wildbad, Germany) and a luciferin-LAR (1 M glycylglycine, 100 mM MgCl2, 500 mM EDTA, DTT, ATP, coenzyme A) buffer solution. The relative light units (RLU) were presented as percentage of the luciferase gene expression obtained with buffer treated control cells. Cellular Internalization Determined by Flow Cytometry. KB/eGFPLuc cells were seeded 24 h before transfection in 24-well plates coated with collagen with a density of 5 × 104 cells/well in 1000 μL of growth media. After 24 h, media was replaced by 400 μL of fresh media for polyplexes without PEGylation or 375 μL for post-PEGylated polyplexes. For receptor blocking experiments, the cells were incubated with the same volume of folic acid saturated media 30 min before transfection at 37 °C. Afterward, polyplex solution containing 2.5 μg of siRNA (10% Cy5 labeled) in 100 μL (non-PEGylated polyplexes) or 125 μL (PEGylated polyplexes) was added and incubated for 45 min at 37 °C. After incubation, cells were washed twice with 500 μL of PBS and incubated with 500 IU/mL of heparin (source: pig) in PBS for 15 min on ice, to remove noninternalized polyplexes from the cell surfaces. After an additional PBS washing step, cells were detached with trypsin/EDTA and taken up in growth medium, centrifuged and taken up in PBS with 10% FBS. Cellular internalization was assayed by flow cytometry at a Cy5 excitation wavelength of 635 nm and detection of emission at 665 nm. Cells were appropriately gated by forward/sideward scatter and pulse width for exclusion of doublets. DAPI (4′,6-diamidino-2-phenylindole) was used to discriminate between viable and dead cells. Data were recorded by Cyan ADP flow Cytometer (Dako, Hamburg, Germany) using Summit acquisition software (Summit, Jamesville, NY, USA) and analyzed by FlowJo 7.6.5 flow cytometric analysis software. All experiments were performed in triplicates. Laser Scanning Microscopy. KB/eGFPLuc cells were seeded 24 h before transfection in an 8-well Labtek chamber slide coated with collagen with a density of 2 × 104 cells/well in 300 μL of media 24 h before treatment. After 24 h, media was replaced by 280 μL for polyplexes without PEGylation or 275 μL for post-PEGylated polyplexes. Afterward, polyplexes containing 500 ng of siRNA were formed as described above, added to the cells and incubated for 45 min at 37 °C. Twenty percent of siRNA was used in Cy5-labeled form, and the post-PEGylation reagent was spiked with 0.2 mol equiv of a maleimide-PEG28-Alexa488. Afterward cells were washed twice with 500 μL of PBS and fixed with a 4% paraformaldehyde solution for 30 min at RT. After two washing steps, cells were incubated with DAPI in PBS (1:500). A Leica TCS SP8 confocal microscope was used for image acquisition. In Vivo Experiments. All in vivo experiments were performed in female NMRI nu/nu mice (Janvier, Le Genest-StIsle) housed in isolated ventilated cages with a 12 h day/night interval and food and water ad libitum. For biodistribution in tumor bearing mice 1 × 106 L1210 cells were injected subcutaneously into the left flank of animals. Animals were treated after tumors reached an appropriate volume of 500−700 mm3. Animal experiments were performed according to guidelines of the German law of protection of animal life and were approved by the local animal experiments ethical committee. Biodistribution of Polyplexes. Polyplexes containing 50 μg of AHA1-siRNA, 50% Cy7-labeled and 50% nonlabeled,

■

RESULTS Design of Post-PEGylated Polyplexes. For siRNA polyplex formation two precise T-shaped cationic oligomers, 454 and 595, were selected (Figure 1A, Supplementary Scheme 1).

Figure 1. Schematic overview of (A) structures of oligomers 454 and 595 and post-PEGylation reagents. gE4, γ-carboxamide linked tetraglutamate. (B) Formation and post-PEGylation of polyplexes.

These structures were generated by solid phase assisted synthesis and contain four units of the artificial oligoamino acid succinoyl tetraethylene pentamine (Stp), two lysines for C


Article


Figure 2. Nanoparticle sizes (Z-average, in nm) of 454 polyplexes (A,C) and 595 polyplexes (B,D) post-PEGylated with increasing molar equivalents of gE4-FolA (A,B) or FolA (C,D) as determined with DLS. Core polyplexes were formed at N/P10 with a siRNA concentration of 25 μg/mL and a final siRNA concentration of 20 μg/mL after PEGylation.

polymers had confirmed the beneficial effect of such an oligoglutamylation in FR-targeted delivery.56,57 Post-PEGylation of siRNA Polyplexes. The equivalents of added post-PEGylation reagents are defined as relative molar ratios to the oligomer molecules 454 or 595 applied in the polyplex formation. As each oligomer contains two (454) or four (595) cysteines, in theory maximum 2 or 4 equiv of PEG-reagent for 454 or 595, respectively, might be coupled to bind all cysteines. However, the number of mercapto groups available after siRNA polyplex formation is reduced because of the intended, stabilizing oxidative disulfide cross-linkage of oligomers. The coupling reaction between oligomer cysteines and ligand-free maleimide-PEG (Supplementary Scheme 2) was verified by an Ellman’s assay (Supplementary Figure 1). The percentage of residual free cysteine mercapto groups after polyplex formation, but before PEGylation (Supplementary Figure 1, “0 equiv Mal-PEG”) was 36% (0.72 mol equiv of mercapto groups) in the case of 454 and 37% (1.48 mol equiv of mercapto groups) in the case of 595, demonstrating that the majority of mercapto groups had already reacted during the 45 min polyplex formation. After reaction with PEGylation reagent for further 15 min a PEG equivalent-dependent decrease of free cysteines could be observed, demonstrating successful post-PEGylation of polyplexes. A difference in 454 and 595 polyplex reactivity toward PEG within this short 15 min time period was observed. For 454 polyplexes, one

branching and linkage with the two central oleic acids, two hydrophobic tyrosine trimers, and two terminal cysteine (454) or CRC units (595). Stp contains four repeats of the protonatable aminoethane motif; therefore, it provides positive charges for nucleic acid complexation and capacity for endosomal protonation.24 Incorporation of oleic acids into oligomers improves stability of polyplexes via hydrophobic interactions and enhances endosomal escape due to endosomolytic activity.26,51 Tyrosine trimers improve polyplex stability via hydrophobic interactions28 and cysteines, especially the twin disulfide forming CRC motif, via disulfide bridge formation.50,52 The two chosen oligomers combine foresaid moieties and were previously reported as efficient and stable carriers for nontargeted siRNA delivery.28,50 For polyplex formation the N/P ratio (ratio between protonatable amines of oligomers and phosphates of siRNA) of 10 was used. After 45 min of polyplex formation, the particles were incubated for another 15 min with the post-PEGylation reagents, consisting of maleimide linked with PEG28 and a FolA ligand (Figure 1B). Maleimide reacts with free cysteine thiols of polyplexes that are not engaged in internal disulfide bridge formation. In addition to standard hydrophobic53 FolA as targeting ligand, an alternative tetra-γglutamyl folic acid ligand (gE4-FolA) with four additional negative charges was applied (Figure 1A). This biomimetic modification resembles the natural cellular polyglutamylation of FolA.54,55 Our recent work with methotrexate-containing D


Article


Figure 3. Zeta potential [mV] of 454 polyplexes (A,C) and 595 polyplexes (B,D) post-PEGylated with increasing molar equivalents of gE4-FolA (A,B) or FolA (C,D). Core polyplexes were formed at N/P10 with a siRNA concentration of 25 μg/mL and a final siRNA concentration of 20 μg/mL after PEGylation.

molar equivalent (1 equiv) of Mal-PEG resulted in a consumption of mercapto groups to residual 17% (0.34 molar equiv of mercapto groups) and did not further reduce unless an excess of more than 5 equiv of PEG was applied. Most likely, mercapto groups hidden within the polyplex but not engaged in disulfide bridges are sterically hindered and not available for PEGylation. Zeta potential measurements (see below) indicate further PEGylation beyond 1 equiv, most probably by maleimide reaction with the oligomer amines.58 In contrast 595 polyplexes reacted more avidly, reducing the mercapto equivalent from 1.48 (non-PEGylated) to 17%/0.68 molar mercapto equivalents (by 1 equiv of Mal-PEG) and to 0.7%/0.03 molar mercapto equivalents by 3 equiv of Mal-PEG. Particle sizes and zeta potentials of post-PEGylated polyplexes modified with Mal-PEG-FolA reagents were examined via dynamic light scattering (DLS) and via application of an electric field using a Zetasizer Nano ZS (Figures 2 and 3, and Supplementary Figure 2). At low molar equivalents the size of FolA ligand-PEG modified 454 and 595 particles ranged around 100−150 nm in all cases (Figure 2). With increasing amount of PEGylation reagent, the particles started to agglomerate. These findings are consistent with earlier reports describing the tendency of polymer-conjugated hydrophobic FolA to agglomerate.53 PEGylation with ligand-free Mal-PEG did not display such an agglomeration phenomenon over a broad range of PEG equivalents, unless a very high excess of >5 equiv was applied (Supplementary Figure 2E,F). In case of the tetra-glutamylated folic acid ligand (gE4-FolA) and 454, the agglomeration started at 0.1 equiv (Figure 2A), and in the case of 595, gE4-FolA at

0.5 equiv (Figure 2B). The same situation was found with maleimide-PEG28-folic acid (FolA), where particles agglomerated at 0.5 equiv with 454 (Figure 2C) and at 1 equiv with 595 (Figure 2D). Beyond one equivalent of gE4-FolA, the size of particles decreased again to an appropriate size of around 150 nm for both oligomers (Figure 2A,B). This demonstrates an improved repulsion of polyplexes modified with the tetraglutamylated PEGylation reagent. Additionally, particles may repel each other due to their highly negative surface charge (Figure 3). Particles with suitable sizes also showed a PDI ≤ 0.2 (Supplementary Figures 2). In the case of standard FolA ligand, the agglomeration was observed also at higher degrees of PEGylation equivalents, into heterogeneous particles with sizes between 2000 and 8000 nm for both oligomers (Figure 2C,D, Supplementary Figures 2C,D and 3). The effect of post-PEGylation on the surface charge of polyplexes is shown in Figure 3 and Supplementary Figure 2. With no or low equivalents of PEGylation reagents (≤0.05 equiv for 454; ≤0.1 equiv for 595) the zeta potential was around +20 to +30 mV. In the case of gE4-FolA the zeta potential was neutral at 0.1 equiv for 454 (+1.43 mV) and 0.5 equiv for 595 (−3.07 mV). At these equivalents polyplexes formed agglomerates (Figure 2A,B). With higher molar equivalents of gE4-FolA the zeta potential decreased to around −20 mV for both oligomers. Zeta potentials for particles post-PEGylated with FolA did not decrease as fast as with gE4-FolA and could not fall below −12 mV, as FolA only contains one negative charge, while gE4-FolA has five negative charges due to the tetra-glutamylation. Considering these findings particles with E


Article


Figure 4. Gene silencing (n = 3) of 454 polyplexes (A,C) and 595 polyplexes (B,D) post-PEGylated with increasing molar equivalents of gE4-FolA (A,B) or FolA (C,D). Polyplexes were transfected in KB-eGFP/Luc cells with 500 ng of siRNA targeting eGFP (GFP siRNA) and 500 ng of control siRNA. Particles were incubated on cells for 45 min at 37 °C. Oligomer 356 is a folate-PEG containing oligomer serving as positive control. For endosomal escape, 356 polyplexes, in contrast to 454 or 595, depend on Inf7 peptide-conjugated (GFP or control) siRNAs.27

suitable sizes and zeta potentials were obtained with molar equivalents of gE4-FolA of ≥2 equiv. Supplementary Figure 4 shows siRNA compaction within the PEGylated polyplexes determined with an ethidium bromide (EtBr) assay. Polyplexes formed with oligomers without PEGylation showed 80% reduction of EtBr fluorescence, demonstrating good compaction of siRNA within the polyplex. For FolA-PEGylation, the siRNA compaction did not change (Supplementary Figure 4C,D). PEGylation with gE4-FolA led to a higher EtBr fluorescence (only 60% reduction), indicating a reduction of siRNA compaction. Gene Silencing and Transfection Specificity. The transfection efficiency was determined in human cervix carcinoma KB eGFP/Luc cells overexpressing the folic acid receptor (Figure 4). Cells were incubated with formulations for a short period of only 45 min at 37 °C to avoid unspecific uptake of particles. Polyplexes were transfected with GFP siRNA targeting the eGFP-luciferase fusion gene construct stably expressed in the test cell line. A control siRNA with no gene silencing capacity was included as specificity control. At low ratios of molar equivalents (0.01−0.05 equiv) of both gE4-FolA and FolA PEG reagents, a moderate gene silencing comparable with non-PEGylated polyplexes (0 equiv) was observed. PEGylated 454 polyplexes with gE4-FolA ligand (Figure 4A) showed potent gene silencing of about 90% for ≥1 equiv PEG

reagent. The knockdown remained high until 7 equiv of applied PEG reagent. The transfections with control siRNA indicated some nonspecific effects for 1 equiv (40%), which however resolved with a higher PEGylation. The transfection efficiency of PEGylated 595 polyplexes with gE4-FolA was highest for 1 equiv (Figure 4B), but decreased with increasing equivalents of >1. At 4 equiv gene silencing was not observed anymore. The reasons remain unclear; possibly free ligand-PEG reagent or ligand-PEG reacted with free polymer could block the FR, making it inaccessible for targeted polyplexes; alternatively endosomal escape of polyplexes might have been hampered by abundant PEGylation. Toxic effects were not observed for 595 at any ratio of gE4-FolA. Encouragingly, extended incubation of cells for one and 2 days (instead of 45 min only) with 595 PEGylated with 1.5 equiv of gE4-FolA demonstrated a still retained receptor specificity of silencing (Supplementary Figure 5) and lack of cytotoxicity (Supplementary Figure 6). Polyplexes post-PEGylated with standard FolA ligand (Figure 4C,D) led to efficient gene silencing with higher molar equivalents (≥1 equiv) both for 454 and 595. In the case of 595 a heterogeneous gene silencing for 1 to 3 equiv (50%, 83%, 50%) and a robust knockdown for 4−6 equiv (about 86%) was observed. This heterogeneity in transfection efficiency might be explained with the tendency of these FolA-PEGylated particles to agglomerate (Figure 2) leading to heterogeneous structures F


Article


Figure 5. Gene silencing (n = 3) of 454 polyplexes (A,C) and 595 polyplexes (B,D) post-PEGylated with increasing molar equivalents of gE4-FolA (A,B) or FolA (C,D). Polyplexes were incubated on KB-eGFP/Luc cells with 500 ng of siRNA targeting eGFP (GFP siRNA) and 500 ng of control siRNA for 45 min. Cells were incubated 30 min before transfection with saturated folic acid media to block the folate receptor. Oligomer 356, applied with 200 ng of Inf7 peptide-conjugated (GFP or control) siRNAs, serves as positive control.27

saturating the Cy5 fluorescence channel (Supplementary Figure 7). Folic acid competition could only partly block internalization of these polyplexes (Figure 6C,D). This finding is consistent with the presence of particle agglomerates (Supplementary Figure 3), resulting partly in receptor-independent uptake and gene silencing (Figure 5). Confocal laser scanning microscopy provided information on the intracellular distribution of PEGylated polyplexes (Figure 7 and Supplementary Figure 8). Fluorescently labeled siRNA (red) and Mal-PEG (green) were used for spiking the siRNA and the PEGylation reagent, respectively. Without PEGylation (0 equiv) considerable unspecific uptake was observed for both 454 and 595 lipo-oligomers. For 454 polyplexes with 1 equiv of gE4-FolA, big yellow punctuated structures were detectable (Figure 7), based on polyplex agglomeration. The yellow color, resulting from the overlay of siRNA and PEGylation agent, confirms a successful PEGylation. With higher molar equivalents of gE4-FolA (avoiding aggregate formation) instead of the big punctuate structures a more even cell binding with smaller yellow structures (Figure 7, 3 to 7 equiv and Supplementary Figure 8B, 4 equiv) and uptake into cells (Figure 7, 3 and 7 equiv and Supplementary Figure 8B, 3 and 4 equiv) was observed, consistent with transfections and flow cytometry data. The red dots in the cytoplasm indicate free siRNA after separation from

(Supplementary Figure 3). To evaluate receptor specificity of transfections, folate receptors were blocked by incubating cells with folic acid-saturated medium at 30 min before transfection (Figure 5). Gene silencing of gE4-FolA-PEGylated 454 and 595 polyplexes was completely lost at PEGylation >1 equiv (Figure 5 A,B). This, together with the data presented in Figure 4 verifies a folic acid receptor-dependent gene silencing process, similar as for the 356 positive control polyplexes. Figure 5 also revealed for both polymers a receptor-independent transfection of 454 and 595 polyplexes when PEGylated with only 1 equiv of gE4-FolA or when PEGylated with FolA at any equivalent (Figure 5C,D). The known agglomeration of these polyplexes (Figure 2) obviously reduces the folate receptor specificity. Cellular Internalization. Internalization of post-PEGylated particles into KB cells was investigated by flow cytometry (Figure 6 and Supplementary Figure 7). The uptake experiments were performed without or with blockade of the folic acid receptor, to examine receptor specificity. Cellular uptake of non-PEGylated polyplexes was high for both oligomers. For 100−200 nm, small 454 or 595 polyplexes, which were PEGylated with >1 equiv of gE4-FolA, the uptake could be completely blocked with free folic acid (Figure 6A,B). For agglomerated particles formed with 1 equiv of gE4-FolA or with PEG-FolA at any PEGylation ratio, cellular uptake was extremely high, G


Article


Figure 6. Cellular internalization of Cy5-labeled siRNA determined by flow cytometry (n = 3) of 454 polyplexes (A,C) and 595 polyplexes (B,D) post-PEGylated with increasing molar equivalents of gE4-FolA (A,B) or FolA (C,D) with and without receptor blockade. Core polyplexes were formed at N/P10 with a siRNA concentration of 25 μg/mL and a final siRNA concentration of 20 μg/mL after PEGylation. Control presents buffer treated cells. The percentage of Cy5-siRNA positive cells refers to internalized polyplexes. Flow cytometry histograms of individual transfection groups are presented in Supplementary Figure 7.

the polyplex or polyplex without PEGylation reagent. For 595 polyplexes (Supplementary Figure 8B,D) with 1 equiv of gE4FolA, the yellow structures were not as big as for 454. For 4 equiv, free ligand (green) was located at the cell membrane, and for equivalents ≥5 equiv, only a few particles were observed in cells (Supplementary Figure 8B, 5 and 6 equiv), both findings explain the insufficient transfection efficiency of 595 polyplexes at higher PEGylation degrees. For particles post-PEGylated with FolA a similar result was found for 454 and 595 for all ratios (Supplementary Figure 8A,C). Small particles, but no agglomerates, that were sufficiently post-PEGylated (yellow) could be found again supporting the hypothesis of a heterogeneous size distribution. As agglomerates are washed away in the process, only small particles could be found in cells. In Vivo Biodistribution. Biodistribution of PEGylated 454 and 595 polyplexes was examined in NMRI nu/nu mice after intravenous tail vein administration. Cy7 labeled siRNA against human AHA1 (without gene target in mice) was detected via near-infrared (NIR) fluorescence imaging. First experiments were carried out with rather high degree of 3 equiv of gE4FolA-PEGylation for both oligomers, as these formulations showed convincing sizes, zeta potentials, and targeting effect in vitro. We did not perform in vivo experiments with standard PEG-FolA, as post-PEGylated polyplexes with this reagent

formed agglomerates. It quickly became apparent that the selected gE4-FolA PEGylated 454 and 595 siRNA polyplexes were highly labile in vivo, showing a high bladder signal of siRNA already after 15 min, similar as for free siRNA, and no detectable signal after 4 h (Supplementary Figure 9). Therefore, in further studies a lower degree of PEGylation (2 and 1.5 equiv) was tested for both oligomers. DLS measurements showed suitable sizes between 130 and 300 nm for all polyplexes prepared at the 10-fold higher concentration that has to be used for in vivo studies (Supplementary Figure 10). PEGylation of 595 with 1.5 equiv of gE4-FolA provided polyplexes with full in vitro gene silencing potency even at elevated serum concentration up to 90% FBS (Supplementary Figure 11). This PEGylation degree led to a longer persistence of siRNA in livers of mice for both oligomers, which still could be detected after 8 h when livers were examined ex vivo. A lower PEGylation degree could not be tested in vivo because of the tendency of polyplexes to agglomerate. Further biodistribution experiments were performed in mice bearing L1210 tumors. L1210 cells overexpress the FR as well and are able to bind FolA even to a higher degree compared to KB cells (Supplementary Figure 12). We selected 595 polyplexes PEGylated with 1.5 equiv of gE4-FolA, as they showed favorable stability and targeted gene silencing in comparison with H


Article


Figure 7. Intracelluar distribution of 454 with increasing molar equivalents of gE4-FolA acquired by confocal laser scanning microscopy. Polyplexes were tested in KB-eGFP/Luc cells with 500 ng of control siRNA. Nuclei were stained with DAPI (blue), actin cytoskeleton was stained with rhodamine phalloidin (orange), siRNA was spiked with 10% Cy5 labeled siRNA (red), and the incorporated PEGylation agent was spiked with a defined amount (0.2 equiv) of Alexa 488-PEG-Mal (green). Please note that at 0 equiv only siRNA (red) is visible, as no PEGylation reagent was used. At 1 to 15 equiv, yellow presents the binding of PEGylation reagent to the siRNA polyplex (overlay of Cy5-siRNA (red) and Alexa 488-PEGMal (green)), green presents free PEGylation reagent probably due to used excess over polyplexes, and red presents siRNA either free or in polyplexes without PEGylation reagent. The images show the overlay of the different channels. Scale bars present 25 μm.

454 (Supplementary Figure 13). Control groups were 595 polyplexes without PEGylation or with PEGylation but without targeting ligand (Mal-PEG), and free siRNA (Figure 8). In vitro experiments using 595 polyplexes PEGylated with 1.5 equiv of gE4-FolA demonstrated specific uptake by L1210 cells compared to 595 PEGylated with Mal-PEG or 595 without PEGylation by flow cytometry (Supplementary Figure 14) and silencing of endogenous EG5 gene (as chosen reporter) by RT-qPCR (Supplementary Figure 15). In vivo, Figure 8A clearly shows the rapid clearance of free siRNA by the kidney. After 4 h no signal could be detected anymore, meaning a total removal of siRNA. In contrary, all 595 groups revealed persistence of NIR-labeled siRNA up to 8 h in mice, when animals had to be sacrificed to analyze their organs. PEGylated 595 polyplexes with gE4-FolA largely accumulated in the liver after initial distribution. Similar results were obtained for PEGylated polyplexes without ligand and non-PEGylated polyplexes. A short-term L1210 tumor-associated signal was detected for all 595 groups, however disappearing after 15 min for PEG polyplexes, after 30 min for gE4-FolA, and after 1 h for non-PEGylated polyplexes (Supplementary Figure 16). Interestingly, PEGylation of 595 polyplexes led to a reduced lung signal (Supplementary Figure 17). To verify this observation, a more quantitative RT-qPCR analysis, detecting intact AHA1-siRNA present in the tissue at the end of the experiment (8 h), was performed (Figure 8B). The highest relative siRNA amount in lung was detected for 595 polyplexes without PEGylation, followed by PEGylated particles, the lowest abundance

in lung was found for the gE4-FolA particles. No siRNA was found in lungs from animals treated with free siRNA and in untreated animals (control). Additionally, qPCR analysis of AHA1-siRNA was performed in the subcutaneous FR-positive L1210 tumors (Supplementary Figure 18). As expected from imaging results only a low siRNA amount was found as compared to the lungs and livers. Nevertheless, when normalized to lung accumulation, the siRNA quantity in tumors of gE4-FolA particles was higher as for ligand-free PEGylated 595 polyplexes and in the same range as for the more stable non-PEGylated particles (Figure 8C).

■

DISCUSSION

Tumor-targeted delivery of siRNA is still a major challenge. Several obstacles including biodegradation and a fast renal clearance, unspecific distribution, poor cellular uptake, and ineffective cytosolic delivery have to be addressed. siRNA and nanoparticles with a size below 5.5 nm are rapidly cleared by the urinary tract and eliminated from the body,59 whereas agglomerates block fine capillaries.60 Folate receptor (FR) is a favorable tumor target receptor because of its overexpression in many tumor tissues.36−38 Folic acid (FolA) has been proven as a potent ligand for targeting drugs to cancer.31−33,61,62 Not surprisingly, first targeted siRNA formulations have already been reported by either direct conjugation of FolA with siRNA constructs63−67 or incorporating FolA as ligand into lipid68−70 or polymer-based formulations.27,44,71−74 I


Article


Figure 8. Biodistribution of siRNA polyplexes after intravenous administration into NMRI nu/nu mice bearing subcutaneous L1210 tumors (n = 3 mice, one-way ANOVA, p < 0.05). (A) Time-dependent distribution of 50 μg of free siRNA, 595 polyplexes PEGylated with 1.5 equiv of gE4-FolA, 595 polyplexes PEGylated with 1.5 equiv of Mal-PEG, and 595 polyplexes without PEGylation. Core polyplexes were formed at N/P10 with a siRNA concentration of 0.25 μg/μL and a final siRNA concentration of 0.20 μg/μL after PEGylation. Dorsal position of one representative mouse of each group is shown. The orange arrow represents a lung signal, the blue one a liver signal, and the green one a bladder signal. (B,C) Experiments with AHA-1 siRNA remaining intact in various organs after 8 h as quantitated by qPCR analysis. (B) Amounts of siRNA in lungs after delivery with 595 PEGylated with 1.5 equiv of gE4-FolA, 595 PEGylated with 1.5 equiv of Mal-PEG, and 595 without PEGylation. (C) Normalized tumor to lung distribution ratio of siRNA from the groups presented in B.

Unexpectedly, FolA-PEG surface-modified polyplexes agglomerated, probably due to the hydrophobicity of folic acid,53 resulting in ligand-independent gene silencing. This problem was not observed in ligand-free PEGylation and was overcome by the use of tetra-γ-glutamyl folic acid (gE4-FolA) as targeting ligand. This modification can be considered as a biomimetic step, as polyglutamylation of folate by folyl-polyglutamate synthetase takes place in most organisms to increase its cellular retention and binding to DHFR enzyme.54,75,76 Post-PEGylated gE4-FolA siRNA polyplexes displayed biophysical advantages, with sizes between 100 and 200 nm favorable for in vivo application, a receptor-specific uptake and effective gene silencing for a broad range of formulations. An additional advantage of the polyglutamylation might be the negative surface charge of

In our current work a post-PEGylation strategy was established to provide siRNA polyplexes with FR targeting and PEG shielding. For this purpose, siRNA core nanoparticles were formed by reacting siRNA with small sequence-defined cationic lipo-oligomers 454 and 595.28,50 These T-shaped bis-oleoyloligoethanamino amides were designed to contain stabilizing tyrosine and cysteine residues because nanoparticle stability was known to present a far more critical parameter for siRNA than for pDNA complexes.47 The core nanoparticles were surfaceshielded by reaction with maleimido-PEG reagents, optionally containing the targeting ligand FolA. The successful PEGylation was shown through an Ellman’s assay monitoring reaction of PEG-maleimide with the cysteines of lipo-oligomers and by a decrease in zeta potential of polyplexes. J


Article

Molecular Pharmaceutics resulting particles (around −20 mV). The negative zeta potential prevents interactions with negatively charged serum proteins like albumin or negatively charged molecules such as HSPG on cell surfaces,77−79 and therefore might reduce adverse effects.80 Receptor-mediated and effective gene silencing of gE4-FolAPEGylated polyplexes was shown on human cervical carcinoma KB cells overexpressing the FR. A high knockdown efficiency could be obtained demonstrating the potency of the siRNA delivery system. Within an optimal degree of PEGylation, no reduced efficacy was found. Therefore, additional strategies to enhance the endosomal escape, as observed for other related polyplex systems, were not needed.27,51,81−83 The FR specificity of transfections was proven via receptor blockade using folatesaturated medium; 100−200 nm small siRNA particles containing the polyglutamylated FolA ligand lost their gene silencing ability upon FR blockade, whereas undefined agglomerates resulting from core polyplex modification with PEG-FolA still transfected KB cells in a receptor-independent manner. Flow cytometry measurements additionally proved the receptor specific uptake of siRNA polyplexes shielded with PEG-gE4-FolA. gE4-FolA PEGylated polyplexes were used to examine the biodistribution in mice after systemic circulation. These studies revealed destabilization of polyplexes by PEGylation as a critical factor limiting their in vivo application. A PEGylation of 3 mol equiv led to immediate instability for 454 and 595 polyplexes in vivo, with most siRNA cleared via kidney and bladder already after 15 min. This problem was partially overcome by selecting the 595 oligomer (containing two CRC stability motifs)50 for polyplex core formation and an optimized lower degree of 1.5 equiv of gE4-FolA PEGylation reagent. For this formulation persistence in mice up to 8 h as visualized by NIR fluorescence bioimaging could be seen, with a preferential accumulation in liver as typical for nanoparticles.84 In previous in vivo biodistribution studies in mice, FR targeting 356 polyplexes circulated for only 15 min and were then cleared rapidly by the kidney due to their small size of only 5.8 nm.27 Here, 454 and 595 polyplexes with a size of about 200 nm are far less affected by renal clearance. In contrast to 356, a signal could be detected after 8 h in the liver and lung for 454, which was even higher for 595. Even PEGylated 595 polyplexes having a lower stability revealed persistence in mice after 8 h in lung, liver, and spleen. These results demonstrate the importance of sizes of nanoparticles for a successful in vivo biodistribution and arrival at their site of action. After 8 h mice were sacrificed to analyze the siRNA distribution of 595 formulations in organs. The lung accumulation noticed for the non-PEGylated particles was significantly reduced with PEGylation, especially for gE4-FolA polyplexes. Positively charged and lipid particles are likely to be taken up by endothelial cells in the lung.85 This might have been avoided with the negatively charged gE4-FolA particles. With the current formulations, only a moderate transient delivery into the tumor of mice was demonstrated. This is not surprising at all, when considering the low systemic polyplex stability. The destabilization of siRNA polyplexes by PEGylation came to us as an initial surprise but is consistent with our recent parallel findings using pre-PEGylated oligomers.44,86 Notably, a recent library study revealed that incorporating a PEG block destroys the polyplex-stabilizing effect of tyrosine trimers, probably by shifting the oligomer hydrophilicity/hydrophobicity balance.86 Additional introduction of histidine residues improved stability again. Thus, analogous further stabilization of the siRNA polyplex

core will be required for effective systemic tumor-targeted delivery in vivo. In sum, the current work presents important insights for further investigations and post-PEGylation with gE4-FolA as a very useful tool for the further development of FR targeted polyplexes.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.molpharmaceut.6b00102. Supplementary methods, scheme and figures, and mass spectra (PDF)

■

AUTHOR INFORMATION

Corresponding Author

*Phone: +49(0)89 2180-77841. E-mail: [email protected]. Author Contributions §

Authors E.K. and P.M.K. contributed equally. First author K.M. made the major contribution in nanoparticle formulation, characterization, cell biology and molecular biology studies, and manuscript writing; E.K. performed the animal studies, P.M.K. the chemical syntheses, M.H. the confocal microscopy; and E.W, supervised all studies and contributed to manuscript writing. All authors have given approval to the final version of the manuscript. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS We thank the Deutsche Forschungsgemeinschaft (DFG) for financial support (SFB 1032 project B4 and Cluster of Excellence NIM). We thank Olga Brück for secretarial assistance and Wolfgang Rödl for technical support. We thank Prof. Philip S. Low (Department of Chemistry, Purdue University) for providing L1210 cells.

■

ABBREVIATIONS Mal-PEG, maleimido-polyethylene glycol; FolA, folic acid; gE4FolA, tetra γ-glutamyl folic acid; siRNA, small interfering RNA; FR, folate receptor; PEG, polyethylene glycol; HBG, HEPES buffered glucose; DLS, dynamic light scattering; FBS, fetal bovine serum; NIR, near-infrared

■

REFERENCES

(1) Kacsinta, A. D.; Dowdy, S. F. Current views on inducing synthetic lethal RNAi responses in the treatment of cancer. Expert Opin. Biol. Ther. 2016, 2, 1−12. (2) Aleku, M.; Schulz, P.; Keil, O.; Santel, A.; Schaeper, U.; Dieckhoff, B.; Janke, O.; Endruschat, J.; Durieux, B.; Roder, N.; Loffler, K.; Lange, C.; Fechtner, M.; Mopert, K.; Fisch, G.; Dames, S.; Arnold, W.; Jochims, K.; Giese, K.; Wiedenmann, B.; Scholz, A.; Kaufmann, J. Atu027, a liposomal small interfering RNA formulation targeting protein kinase N3, inhibits cancer progression. Cancer Res. 2008, 68, 9788−98. (3) Davis, M. E. The first targeted delivery of siRNA in humans via a self-assembling, cyclodextrin polymer-based nanoparticle: from concept to clinic. Mol. Pharmaceutics 2009, 6 (3), 659−68. (4) Müller, K.; Wagner, E. RNAi-Based Nano-Oncologicals: Delivery and Clinical Applications. In Nano-Oncologicals: New Targeting and Delivery Approaches; Alonso, M. J., Garcia-Fuentes, M., Eds.; Controlled Release Society and Springer, 2014; pp 245−268.

K


Article

Molecular Pharmaceutics (5) Whitehead, K. A.; Langer, R.; Anderson, D. G. Knocking down barriers: advances in siRNA delivery. Nat. Rev. Drug Discovery 2009, 8 (2), 129−38. (6) Meade, B. R.; Dowdy, S. F. The road to therapeutic RNA interference (RNAi): Tackling the 800 pound siRNA delivery gorilla. Discov Med. 2009, 8 (43), 253−6. (7) Hobel, S.; Aigner, A. Polyethylenimines for siRNA and miRNA delivery in vivo. Wiley Interdiscip Rev. Nanomed Nanobiotechnol 2013, 5 (5), 484−501. (8) Nair, J. K.; Willoughby, J. L.; Chan, A.; Charisse, K.; Alam, M. R.; Wang, Q.; Hoekstra, M.; Kandasamy, P.; Kel’in, A. V.; Milstein, S.; Taneja, N.; O’Shea, J.; Shaikh, S.; Zhang, L.; van der Sluis, R. J.; Jung, M. E.; Akinc, A.; Hutabarat, R.; Kuchimanchi, S.; Fitzgerald, K.; Zimmermann, T.; van Berkel, T. J.; Maier, M. A.; Rajeev, K. G.; Manoharan, M. Multivalent N-acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi-mediated gene silencing. J. Am. Chem. Soc. 2014, 136 (49), 16958−61. (9) Meade, B. R.; Gogoi, K.; Hamil, A. S.; Palm-Apergi, C.; van den Berg, A.; Hagopian, J. C.; Springer, A. D.; Eguchi, A.; Kacsinta, A. D.; Dowdy, C. F.; Presente, A.; Lonn, P.; Kaulich, M.; Yoshioka, N.; Gros, E.; Cui, X. S.; Dowdy, S. F. Efficient delivery of RNAi prodrugs containing reversible charge-neutralizing phosphotriester backbone modifications. Nat. Biotechnol. 2014, 32 (12), 1256−61. (10) Love, K. T.; Mahon, K. P.; Levins, C. G.; Whitehead, K. A.; Querbes, W.; Dorkin, J. R.; Qin, J.; Cantley, W.; Qin, L. L.; Racie, T.; Frank-Kamenetsky, M.; Yip, K. N.; Alvarez, R.; Sah, D. W.; de Fougerolles, A.; Fitzgerald, K.; Koteliansky, V.; Akinc, A.; Langer, R.; Anderson, D. G. Lipid-like materials for low-dose, in vivo gene silencing. Proc. Natl. Acad. Sci. U. S. A. 2010, 107 (5), 1864−9. (11) Sakurai, Y.; Hatakeyama, H.; Sato, Y.; Hyodo, M.; Akita, H.; Harashima, H. Gene silencing via RNAi and siRNA quantification in tumor tissue using MEND, a liposomal siRNA delivery system. Mol. Ther. 2013, 21 (6), 1195−203. (12) Whitehead, K. A.; Dorkin, J. R.; Vegas, A. J.; Chang, P. H.; Veiseh, O.; Matthews, J.; Fenton, O. S.; Zhang, Y.; Olejnik, K. T.; Yesilyurt, V.; Chen, D.; Barros, S.; Klebanov, B.; Novobrantseva, T.; Langer, R.; Anderson, D. G. Degradable lipid nanoparticles with predictable in vivo siRNA delivery activity. Nat. Commun. 2014, 5, 4277. (13) Zintchenko, A.; Philipp, A.; Dehshahri, A.; Wagner, E. Simple Modifications of Branched PEI Lead to Highly Efficient siRNA Carriers with Low Toxicity. Bioconjugate Chem. 2008, 19 (7), 1448− 1455. (14) Meyer, M.; Philipp, A.; Oskuee, R.; Schmidt, C.; Wagner, E. Breathing life into polycations: functionalization with pH-responsive endosomolytic peptides and polyethylene glycol enables siRNA delivery. J. Am. Chem. Soc. 2008, 130 (11), 3272−3273. (15) Meyer, M.; Dohmen, C.; Philipp, A.; Kiener, D.; Maiwald, G.; Scheu, C.; Ogris, M.; Wagner, E. Synthesis and Biological Evaluation of a Bioresponsive and Endosomolytic siRNA−Polymer Conjugate. Mol. Pharmaceutics 2009, 6 (3), 752−762. (16) Leng, Q.; Chou, S. T.; Scaria, P. V.; Woodle, M. C.; Mixson, A. J. Increased tumor distribution and expression of histidine-rich plasmid polyplexes. J. Gene Med. 2014, 16 (9−10), 317−28. (17) Wagner, E. Polymers for siRNA Delivery: Inspired by Viruses to be Targeted, Dynamic, and Precise. Acc. Chem. Res. 2012, 45 (7), 1005−13. (18) Wagner, E. Biomaterials in RNAi therapeutics: quo vadis? Biomater. Sci. 2013, 8, 804−809. (19) Pittella, F.; Cabral, H.; Maeda, Y.; Mi, P.; Watanabe, S.; Takemoto, H.; Kim, H. J.; Nishiyama, N.; Miyata, K.; Kataoka, K. Systemic siRNA delivery to a spontaneous pancreatic tumor model in transgenic mice by PEGylated calcium phosphate hybrid micelles. J. Controlled Release 2014, 178, 18−24. (20) Lachelt, U.; Wagner, E. Nucleic Acid Therapeutics Using Polyplexes: A Journey of 50 Years (and Beyond). Chem. Rev. 2015, 115 (19), 11043−11078.

(21) Hartmann, L.; Krause, E.; Antonietti, M.; Borner, H. G. Solidphase supported polymer synthesis of sequence-defined, multifunctional poly(amidoamines). Biomacromolecules 2006, 7 (4), 1239−1244. (22) Wang, X. L.; Nguyen, T.; Gillespie, D.; Jensen, R.; Lu, Z. R. A multifunctional and reversibly polymerizable carrier for efficient siRNA delivery. Biomaterials 2008, 29 (1), 15−22. (23) Wang, X.-L.; Xu, R.; Lu, Z.-R. A peptide-targeted delivery system with pH-sensitive amphiphilic cell membrane disruption for efficient receptor-mediated siRNA delivery. J. Controlled Release 2009, 134 (3), 207−213. (24) Schaffert, D.; Troiber, C.; Salcher, E. E.; Frohlich, T.; Martin, I.; Badgujar, N.; Dohmen, C.; Edinger, D.; Klager, R.; Maiwald, G.; Farkasova, K.; Seeber, S.; Jahn-Hofmann, K.; Hadwiger, P.; Wagner, E. Solid-phase synthesis of sequence-defined T-, i-, and U-shape polymers for pDNA and siRNA delivery. Angew. Chem., Int. Ed. 2011, 50 (38), 8986−9. (25) Hartmann, L. Polymers for Control Freaks: Sequence-Defined Poly(amidoamine)s and Their Biomedical Applications. Macromol. Chem. Phys. 2011, 212 (1), 8−13. (26) Frohlich, T.; Edinger, D.; Klager, R.; Troiber, C.; Salcher, E.; Badgujar, N.; Martin, I.; Schaffert, D.; Cengizeroglu, A.; Hadwiger, P.; Vornlocher, H. P.; Wagner, E. Structure-activity relationships of siRNA carriers based on sequence-defined oligo (ethane amino) amides. J. Controlled Release 2012, 160 (3), 532−41. (27) Dohmen, C.; Edinger, D.; Frohlich, T.; Schreiner, L.; Lachelt, U.; Troiber, C.; Radler, J.; Hadwiger, P.; Vornlocher, H. P.; Wagner, E. Nanosized Multifunctional Polyplexes for Receptor-Mediated SiRNA Delivery. ACS Nano 2012, 6 (6), 5198−208. (28) Troiber, C.; Edinger, D.; Kos, P.; Schreiner, L.; Klager, R.; Herrmann, A.; Wagner, E. Stabilizing effect of tyrosine trimers on pDNA and siRNA polyplexes. Biomaterials 2013, 34 (5), 1624−33. (29) Zhang, W.; Rodl, W.; He, D.; Doblinger, M.; Lachelt, U.; Wagner, E. Combination of sequence-defined oligoaminoamides with transferrin-polycation conjugates for receptor-targeted gene delivery. J. Gene Med. 2015, 17 (8−9), 161−72. (30) Hughes, J. A.; Rao, G. A. Targeted polymers for gene delivery. Expert Opin. Drug Delivery 2005, 2 (1), 145−157. (31) Low, P. S.; Henne, W. A.; Doorneweerd, D. D. Discovery and development of folic-acid-based receptor targeting for imaging and therapy of cancer and inflammatory diseases. Acc. Chem. Res. 2008, 41 (1), 120−9. (32) Sudimack, J.; Lee, R. J. Targeted drug delivery via the folate receptor 95. Adv. Drug Delivery Rev. 2000, 41 (2), 147−162. (33) Xia, W.; Low, P. S. Folate-targeted therapies for cancer. J. Med. Chem. 2010, 53 (19), 6811−24. (34) Park, E. K.; Kim, S. Y.; Lee, S. B.; Lee, Y. M. Folate-conjugated methoxy poly(ethylene glycol)/poly(epsilon-caprolactone) amphiphilic block copolymeric micelles for tumor-targeted drug delivery. J. Controlled Release 2005, 109 (1−3), 158−68. (35) Duro-Castano, A.; Movellan, J.; Vicent, M. J. Smart branched polymer drug conjugates as nano-sized drug delivery systems. Biomater. Sci. 2015, 3 (10), 1321−34. (36) Weitman, S. D.; Lark, R. H.; Coney, L. R.; Fort, D. W.; Frasca, V.; Zurawski, V. R., Jr.; Kamen, B. A. Distribution of the folate receptor GP38 in normal and malignant cell lines and tissues. Cancer Res. 1992, 52 (12), 3396−401. (37) Antony, A. C. The biological chemistry of folate receptors. Blood 1992, 79 (11), 2807−20. (38) Ross, J. F.; Chaudhuri, P. K.; Ratnam, M. Differential regulation of folate receptor isoforms in normal and malignant tissues in vivo and in established cell lines. Physiologic and clinical implications. Cancer 1994, 73 (9), 2432−43. (39) Veronese, F. M.; Pasut, G. PEGylation, successful approach to drug delivery. Drug Discovery Today 2005, 10 (21), 1451−1458. (40) Lollo, G.; Hervella, P.; Calvo, P.; Aviles, P.; Guillen, M. J.; Garcia-Fuentes, M.; Alonso, M. J.; Torres, D. Enhanced in vivo therapeutic efficacy of plitidepsin-loaded nanocapsules decorated with a new poly-aminoacid-PEG derivative. Int. J. Pharm. 2015, 483 (1−2), 212−9. L


Article

Molecular Pharmaceutics (41) Mishra, S.; Webster, P.; Davis, M. E. PEGylation significantly affects cellular uptake and intracellular trafficking of non-viral gene delivery particles. Eur. J. Cell Biol. 2004, 83 (3), 97−111. (42) Walker, G. F.; Fella, C.; Pelisek, J.; Fahrmeir, J.; Boeckle, S.; Ogris, M.; Wagner, E. Toward synthetic viruses: endosomal pHtriggered deshielding of targeted polyplexes greatly enhances gene transfer in vitro and in vivo. Mol. Ther. 2005, 11 (3), 418−425. (43) Hatakeyama, H.; Akita, H.; Harashima, H. A multifunctional envelope type nano device (MEND) for gene delivery to tumours based on the EPR effect: A strategy for overcoming the PEG dilemma. Adv. Drug Delivery Rev. 2011, 63 (3), 152−60. (44) Zhang, C. Y.; Kos, P.; Muller, K.; Schrimpf, W.; Troiber, C.; Lachelt, U.; Scholz, C.; Lamb, D. C.; Wagner, E. Native chemical ligation for conversion of sequence-defined oligomers into targeted pDNA and siRNA carriers. J. Controlled Release 2014, 180, 42−50. (45) Kos, P.; Lachelt, U.; Herrmann, A.; Mickler, F. M.; Doblinger, M.; He, D.; Krhac Levacic, A.; Morys, S.; Brauchle, C.; Wagner, E. Histidine-rich stabilized polyplexes for cMet-directed tumor-targeted gene transfer. Nanoscale 2015, 7 (12), 5350−62. (46) Hatakeyama, H.; Akita, H.; Harashima, H. The polyethyleneglycol dilemma: advantage and disadvantage of PEGylation of liposomes for systemic genes and nucleic acids delivery to tumors. Biol. Pharm. Bull. 2013, 36 (6), 892−9. (47) Scholz, C.; Wagner, E. Therapeutic plasmid DNA versus siRNA delivery: Common and different tasks for synthetic carriers. J. Controlled Release 2012, 161 (2), 554−65. (48) Ogris, M.; Walker, G.; Blessing, T.; Kircheis, R.; Wolschek, M.; Wagner, E. Tumor-targeted gene therapy: strategies for the preparation of ligand-polyethylene glycol-polyethylenimine/DNA complexes. J. Controlled Release 2003, 91 (1−2), 173−181. (49) Fella, C.; Walker, G. F.; Ogris, M.; Wagner, E. Amine-reactive pyridylhydrazone-based PEG reagents for pH-reversible PEI polyplex shielding. Eur. J. Pharm. Sci. 2008, 34 (4−5), 309−20. (50) Klein, P. M.; Muller, K.; Gutmann, C.; Kos, P.; Krhac Levacic, A.; Edinger, D.; Hohn, M.; Leroux, J. C.; Gauthier, M. A.; Wagner, E. Twin disulfides as opportunity for improving stability and transfection efficiency of oligoaminoethane polyplexes. J. Controlled Release 2015, 205, 109−19. (51) Lachelt, U.; Kos, P.; Mickler, F. M.; Herrmann, A.; Salcher, E. E.; Rodl, W.; Badgujar, N.; Brauchle, C.; Wagner, E. Fine-tuning of proton sponges by precise diaminoethanes and histidines in pDNA polyplexes. Nanomedicine 2014, 10 (1), 35−44. (52) Wu, C.; Leroux, J. C.; Gauthier, M. A. Twin disulfides for orthogonal disulfide pairing and the directed folding of multicyclic peptides. Nat. Chem. 2012, 4 (12), 1044−9. (53) Barz, M.; Canal, F.; Koynov, K.; Zentel, R.; Vicent, M. J. Synthesis and in vitro evaluation of defined HPMA folate conjugates: influence of aggregation on folate receptor (FR) mediated cellular uptake. Biomacromolecules 2010, 11 (9), 2274−82. (54) El Fadili, A.; Kundig, C.; Ouellette, M. Characterization of the folylpolyglutamate synthetase gene and polyglutamylation of folates in the protozoan parasite Leishmania. Mol. Biochem. Parasitol. 2002, 124 (1−2), 63−71. (55) Chabner, B. A.; Roberts, T. G., Jr. Timeline: Chemotherapy and the war on cancer. Nat. Rev. Cancer 2005, 5 (1), 65−72. (56) Lachelt, U.; Wittmann, V.; Muller, K.; Edinger, D.; Kos, P.; Hohn, M.; Wagner, E. Synthetic polyglutamylation of dual-functional MTX ligands for enhanced combined cytotoxicity of poly(I:C) nanoplexes. Mol. Pharmaceutics 2014, 11 (8), 2631−9. (57) Lee, D. J.; Kessel, E.; Edinger, D.; He, D.; Klein, P. M.; Voith von Voithenberg, L.; Lamb, D. C.; Lachelt, U.; Lehto, T.; Wagner, E. Dual antitumoral potency of EG5 siRNA nanoplexes armed with cytotoxic bifunctional glutamyl-methotrexate targeting ligand. Biomaterials 2016, 77, 98−110. (58) Knorr, V.; Russ, V.; Allmendinger, L.; Ogris, M.; Wagner, E. Acetal linked oligoethylenimines for use as pH-sensitive gene carriers. Bioconjugate Chem. 2008, 19 (8), 1625−34.

(59) Soo Choi, H.; Liu, W.; Misra, P.; Tanaka, E.; Zimmer, J. P.; Itty Ipe, B.; Bawendi, M. G.; Frangioni, J. V. Renal clearance of quantum dots. Nat. Biotechnol. 2007, 25 (10), 1165−1170. (60) Buyens, K.; Lucas, B.; Raemdonck, K.; Braeckmans, K.; Vercammen, J.; Hendrix, J.; Engelborghs, Y.; De Smedt, S. C.; Sanders, N. N. A fast and sensitive method for measuring the integrity of siRNA-carrier complexes in full human serum. J. Controlled Release 2008, 126 (1), 67−76. (61) Bae, Y.; Jang, W. D.; Nishiyama, N.; Fukushima, S.; Kataoka, K. Multifunctional polymeric micelles with folate-mediated cancer cell targeting and pH-triggered drug releasing properties for active intracellular drug delivery. Mol. BioSyst. 2005, 1 (3), 242−50. (62) Lu, Y.; Low, P. S. Folate-mediated delivery of macromolecular anticancer therapeutic agents. Adv. Drug Delivery Rev. 2002, 54 (5), 675−93. (63) Thomas, M.; Kularatne, S. A.; Qi, L.; Kleindl, P.; Leamon, C. P.; Hansen, M. J.; Low, P. S. Ligand-Targeted Delivery of Small Interfering RNAs to Malignant Cells and Tissues. Ann. N. Y. Acad. Sci. 2009, 1175 (1), 32−39. (64) Dohmen, C.; Frohlich, T.; Lachelt, U.; Rohl, I.; Vornlocher, H.P.; Hadwiger, P.; Wagner, E. Defined Folate-PEG-siRNA Conjugates for Receptor-specific Gene Silencing. Mol. Ther.–Nucleic Acids 2012, 1, e7. (65) Lee, H.; Lytton-Jean, A. K. R.; Chen, Y.; Love, K. T.; Park, A. I.; Karagiannis, E. D.; Sehgal, A.; Querbes, W.; Zurenko, C. S.; Jayaraman, M.; Peng, C. G.; Charisse, K.; Borodovsky, A.; Manoharan, M.; Donahoe, J. S.; Truelove, J.; Nahrendorf, M.; Langer, R.; Anderson, D. G. Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery. Nat. Nanotechnol. 2012, 7 (6), 389−393. (66) Willibald, J.; Harder, J.; Sparrer, K.; Conzelmann, K. K.; Carell, T. Click-modified anandamide siRNA enables delivery and gene silencing in neuronal and immune cells. J. Am. Chem. Soc. 2012, 134 (30), 12330−3. (67) Lee, T. J.; Haque, F.; Shu, D.; Yoo, J. Y.; Li, H.; Yokel, R. A.; Horbinski, C.; Kim, T. H.; Kim, S. H.; Kwon, C. H.; Nakano, I.; Kaur, B.; Guo, P.; Croce, C. M. RNA nanoparticle as a vector for targeted siRNA delivery into glioblastoma mouse model. Oncotarget 2015, 6 (17), 14766−76. (68) Lopes, I.; Oliveira, A. C. N.; Sarria, M. P.; Neves, J. P. N.; Goncalves, O.; Gomes, A. C.; Real Oliveira, M. E. Monoolein-based nanocarriers for enhanced folate receptor-mediated RNA delivery to cancer cells. J. Liposome Res. 2016, 1−12. (69) Yang, T.; Li, B.; Qi, S.; Liu, Y.; Gai, Y.; Ye, P.; Yang, G.; Zhang, W.; Zhang, P.; He, X.; Li, W.; Zhang, Z.; Xiang, G.; Xu, C. Co-delivery of doxorubicin and Bmi1 siRNA by folate receptor targeted liposomes exhibits enhanced anti-tumor effects in vitro and in vivo. Theranostics 2014, 4 (11), 1096−111. (70) Nahire, R.; Hossain, R.; Patel, R.; Paul, S.; Meghnani, V.; Ambre, A. H.; Gange, K. N.; Katti, K. S.; Leclerc, E.; Srivastava, D. K.; Sarkar, K.; Mallik, S. pH-triggered echogenicity and contents release from liposomes. Mol. Pharmaceutics 2014, 11 (11), 4059−68. (71) Ohyama, A.; Higashi, T.; Motoyama, K.; Arima, H. In Vitro and In Vivo Tumor-targeting siRNA Delivery Using Folate-PEG-appended Dendrimer (G4)/alpha-Cyclodextrin Conjugates. Bioconjugate Chem. 2016, 27 (3), 521−32. (72) Liu, L.; Zheng, M.; Librizzi, D.; Renette, T.; Merkel, O. M.; Kissel, T. Efficient and Tumor Targeted siRNA Delivery by Polyethylenimine-graft-polycaprolactone-block-poly(ethylene glycol)folate (PEI-PCL-PEG-Fol). Mol. Pharmaceutics 2016, 13 (1), 134−43. (73) Li, H.; Miteva, M.; Kirkbride, K. C.; Cheng, M. J.; Nelson, C. E.; Simpson, E. M.; Gupta, M. K.; Duvall, C. L.; Giorgio, T. D. Dual MMP7-proximity-activated and folate receptor-targeted nanoparticles for siRNA delivery. Biomacromolecules 2015, 16 (1), 192−201. (74) Novo, L.; Takeda, K. M.; Petteta, T.; Dakwar, G. R.; van den Dikkenberg, J. B.; Remaut, K.; Braeckmans, K.; van Nostrum, C. F.; Mastrobattista, E.; Hennink, W. E. Targeted decationized polyplexes for siRNA delivery. Mol. Pharmaceutics 2015, 12 (1), 150−61. M


Article

Molecular Pharmaceutics (75) Shane, B. Folylpolyglutamate synthesis and role in the regulation of one-carbon metabolism. Vitam. Horm. 1989, 45, 263− 335. (76) Moran, R. G. Roles of folylpoly-gamma-glutamate synthetase in therapeutics with tetrahydrofolate antimetabolites: an overview. Semin Oncol 1999, 26, 24−32. (77) Mislick, K. A.; Baldeschwieler, J. D. Evidence for the role of proteoglycans in cation-mediated gene transfer. Proc. Natl. Acad. Sci. U. S. A. 1996, 93 (22), 12349−12354. (78) Ruponen, M.; Honkakoski, P.; Ronkko, S.; Pelkonen, J.; Tammi, M.; Urtti, A. Extracellular and intracellular barriers in non-viral gene delivery. J. Controlled Release 2003, 93 (2), 213−217. (79) Kopatz, I.; Remy, J. S.; Behr, J. P. A model for non-viral gene delivery: through syndecan adhesion molecules and powered by actin. J. Gene Med. 2004, 6 (7), 769−776. (80) Zelphati, O.; Uyechi, L. S.; Barron, L. G.; Szoka, F. C., Jr. Effect of serum components on the physico-chemical properties of cationic lipid/oligonucleotide complexes and on their interactions with cells. Biochim. Biophys. Acta, Lipids Lipid Metab. 1998, 1390 (2), 119−33. (81) Wagner, E. Effects of membrane-active agents in gene delivery. J. Controlled Release 1998, 53 (1−3), 155−158. (82) Boeckle, S.; Fahrmeir, J.; Roedl, W.; Ogris, M.; Wagner, E. Melittin analogs with high lytic activity at endosomal pH enhance transfection with purified targeted PEI polyplexes. J. Controlled Release 2006, 112 (2), 240−8. (83) Meyer, M.; Zintchenko, A.; Ogris, M.; Wagner, E. A dimethylmaleic acid-melittin-polylysine conjugate with reduced toxicity, pH-triggered endosomolytic activity and enhanced gene transfer potential. J. Gene Med. 2007, 9 (9), 797−805. (84) Lorenzer, C.; Dirin, M.; Winkler, A. M.; Baumann, V.; Winkler, J. Going beyond the liver: progress and challenges of targeted delivery of siRNA therapeutics. J. Controlled Release 2015, 203, 1−15. (85) McLean, J. W.; Fox, E. A.; Baluk, P.; Bolton, P. B.; Haskell, A.; Pearlman, R.; Thurston, G.; Umemoto, E. Y.; McDonald, D. M. Organ-specific endothelial cell uptake of cationic liposome-DNA complexes in mice. Am. J. Physiol. 1997, 273, H387−404. (86) He, D.; Muller, K.; Krhac Levacic, A.; Kos, P.; Lachelt, U.; Wagner, E. Combinatorial Optimization of Sequence-Defined Oligo(ethanamino)amides for Folate Receptor-Targeted pDNA and siRNA Delivery. Bioconjugate Chem. 2016, 27 (3), 647−59.

N


Post-PEGylation of siRNA Lipo-oligoamino Amide Polyplexes Using

Recommend Documents