Prenylated Flavonoids from the Roots and Rhizomes of Sophora

Article pubs.acs.org/jnp

Cite This: J. Nat. Prod. XXXX, XXX, XXX−XXX

Prenylated Flavonoids from the Roots and Rhizomes of Sophora tonkinensis and Their Effects on the Expression of Inflammatory Mediators and Proprotein Convertase Subtilisin/Kexin Type 9 Jongmin Ahn,†,# Young-Mi Kim,‡,# Hee-Sung Chae,‡ Young Hee Choi,‡ Hee-Chul Ahn,‡ Hunseung Yoo,§ Minseok Kang,§ Jinwoong Kim,† and Young-Won Chin*,‡ †

College of Pharmacy and Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 08826, Republic of Korea College of Pharmacy and Integrated Research Institute for Drug Development, Dongguk University-Seoul, Gyeonggi-do 10326, Republic of Korea § New Drug Preclinical & Analytical Team, Life Science R & D Center, SK Chemicals, 310 Pangyo-ro, Bundang-gu, Seongnam-si, Gyeonggi-do 13494, Republic of Korea

Downloaded via MIDWESTERN UNIV on January 31, 2019 at 08:24:09 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

‡

S Supporting Information *

ABSTRACT: Seven new prenylated flavonoids (1−7) and one new prenylated phenylpropiophenone (8) were isolated from roots and rhizomes of Sophora tonkinensis, along with nine known compounds (9−17). The structures 1−8 were elucidated by spectroscopic data analysis and comparison with reported values. Compounds 8 and 12 (7-methoxyebenosin) showed inhibitory activities against nitric oxide production in lipopolysaccharide-induced RAW264.7 cells, with IC50 values of 8.1 and 6.2 μM, respectively. They also significantly lowered expression of CSF2, TNF, and IL-1β. Lonchocarpol A (10) and erybraedin D (16) at concentrations of 20 μM downregulated proprotein convertase subtilisin/kexin type 9 (PCSK9) mRNA expression in HepG2 cells. Moreover, erybraedin D (16) inhibited PCSK9 protein synthesis (IC50 7.8 μM), while simultaneously activating AMP-activated protein kinase and acetyl-CoA carboxylase.

T

production and expression of inflammatory mediators in RAW264.7 cells and of proprotein convertase subtilisin/kexin type 9 (PCSK9) relevant to cholesterol metabolism in HepG2 cells14−17 were determined.

he dried roots and rhizomes of Sophora tonkinensis Gagnep. (Leguminosae) have been used as a traditional herbal medicine for the treatment of dermatitis, gastrointestinal hemorrhage, throat swelling, and acute pharyngolaryngeal infections in mainland China and Korea.1−3 Phytochemical studies have shown that bioactive constituents of this plant include prenylated flavonoids, isoflavones, 2-arylbenzofuran dimers, and matrine-type and cytisine-type alkaloids.4−7 Biological investigations have revealed that extracts of S. tonkinensis and their individual components possess antiinflammatory, antitumor, and antiviral activities.8−11 To search for minor constituents of flavonoids with novel structures and bioactivities from S. tonkinensis, relatively nonpolar extracts of this plant11 were reinvestigated in this study. As a result, eight new compounds (1−8), including seven prenylated flavonoids (1−7) and one prenylated phenylpropiophenone (8), were isolated along with nine known compounds (9−17). The structures of the new compounds were elucidated via interpretation of their spectroscopic data and comparison with reported values in the literature. Previous studies have shown that some prenylated flavonoids have anti-inflammatory and anti-hypercholesterolemia activities.10,12,13 Herein are described the isolation and structure elucidation of the new compounds and the individual activities of all compounds isolated using several bioassays. Their effects on nitric oxide (NO) © XXXX American Chemical Society and American Society of Pharmacognosy

■

RESULTS AND DISCUSSION A commercially available 50% ethanolic extract of S. tonkinensis was fractionated by several chromatographic techniques to yield seven new prenylated flavonoids (1−7) and one prenylated phenylpropiophenone (8), together with nine known compounds (9−17). The structures of the known compounds were determined as lupinifolin (9),18 lonchocarpol A (10),19 sophoradochromene (11),20 7-methoxyebenosin (12),21 homopterocarpin (13),22 dehydromaackiain (14),23 flemichapparin B (15),24 erybraedin D (16),25 and maackiapterocarpan A (17).26 Sophoratonin A (1) was obtained as a yellow, amorphous solid. Its molecular formula was deduced to be C27H28O4 by the observed protonated molecular ion peak at m/z 417.2086 [M + H]+ (calcd for C27H29O4, 417.2066). Altogether, 27 carbon peaks were detected in the 13C NMR spectrum, and one carbonyl carbon, 10 sp2 quaternary carbons (three oxygenated carbons and seven nonoxygenated carbons), Received: September 2, 2018

A

DOI: 10.1021/acs.jnatprod.8b00748 J. Nat. Prod. XXXX, XXX, XXX−XXX

Journal of Natural Products

Article

Table 2. 1H NMR Data of Compounds 5−7 (δH, J in Hz, 400 MHz, CDCl3)

eight sp2 methine carbons (one oxygenated carbon and seven nonoxygenated carbons), one oxygenated sp3 methine, three sp3 methylenes (one oxygenated carbon and two nonoxygenated carbons), and four methyl groups were classified by their chemical shifts and HSQC spectrum (Tables 1 and 3).

position 2 3

Table 1. 1H NMR Data of Compounds 1−4 (δH, J in Hz, 400 MHz, CDCl3) position

1

2

3

4

5.50 dd (13.5, 2.9) 3 3.17 dd (13.5, 16.8), α 2.87 dd (2.9, 16.8), β 5 7.90 d (8.8) 6 7.18 dd (8.8, 0.9) 2′ 7.13 s 6′ 7.13 s OH-4′ 5.53 s 8-substitution 1 6.93 dd (2.2, 0.9) 2 7.59 d (2.2) 4

5.48 dd (13.5, 2.9) 3.17 dd (16.8, 13.5), α 2.86 dd (16.8, 2.9), β 7.87 d (8.7) 7.13 d (8.7)

5.46 dd (13.5, 2.8) 3.16 dd (16.9, 13.5), α 2.86 dd (16.9, 2.8), β 7.87 d (8.8) 7.13 d (8.8)

5.37 overlapped

7.13 s 7.13 s 5.52 s

7.00 d (2.2) 7.10 d (2.2)

7.09 s 7.09 s 5.49 s

6.77 s

6.78 s

5.77 s, 5.19 s

5 3′-substitution 1 3.39 d (7.2) 2 5.34 m 4 1.78 s 5 1.78 s 5′-substitution 1 3.39 d (7.2) 2 5.34 m 4 1.78 s 5 1.78 s

2.09 s

5.77 brs, 5.19 brs 2.09, 3H, s

1.34 s

3.39 5.34 1.78 1.78

d (7.2) m s s

6.34 5.65 1.44 1.44

d (9.8) d (9.8) s s

3.38 5.34 1.78 1.78

d (7.2) m s s

3.39 5.34 1.78 1.78

d (7.2) m s s

3.31 5.30 1.73 1.73

d (7.6) m s s

3.38 5.34 1.78 1.78

d (7.2) m s s

2

5

6

7

5.33 dd (13.3, 2.7) 3.01 dd (16.8, 13.3), α 2.78 dd (16.8, 2.7), β 7.73 d (8.7) 6.48 d (8.7) 6.94 d (2.2) 7.05 d (2.2)

5.33 m 2.98 dd (13.7, 16.9), α 2.78 dd (3.2, 16.9), β

5.52 dd (13.1, 2.9) 3.07 dd (16.9, 13.1), α 2.88 dd (16.9, 2.9), β 7.77 d (8.7) 6.55 d (8.7) 7.55 s 7.19 s

5 6 2′ 6′ OH-7 OH-4′ 6-substitution 1 2 4 5 8-substitution 1 6.64 d (10.1) 2 5.56 d (10.1) 4 1.47 s 5 1.44 s 3′-substitution 1 6.33 d (9.8) 2 5.64 d (9.8) 4 1.44 s 5 1.44 s 5′-substitution 1 3.29 d (7.4) 2 5.28 m 4 1.74 s 5 1.74 s

3.00 dd (16.8, 13.4), α 2.78 dd (16.8, 2.9), β 7.71 d (8.7) 6.49 d (8.7)

2.68 m, 2.66 m 1.79 m 1.36 s

7.60 s 7.07 7.07 6.10 5.46

s s s s

3.30 5.24 1.78 1.77

d (7.3) m overlapped overlapped

3.40 5.31 1.78 1.77


3.44 5.27 1.74 1.74

3.40 5.31 1.78 1.77


6.79 d (2.1) 7.67 d (2.1)

3.40 5.31 1.78 1.77


3.65 5.42 1.77 1.77

d (7.1) t (7.1) s s

d (7.4) t (7.4) s s

between H-1″ and H-2″, and HMBC cross-peaks of H-2″ were seen with δC 160.0 (C-7) and 117.4 (C-8). HMBC correlations of H-5 with C-9 (δC 156.9) and C-7 and those of H-6 with C10 (δC 115.7) and C-8 were observed. Along with these HMBC correlations, a benzofuran unit was confirmed by HMBC correlation between H-1″ and C-8. This unit was the A ring of flavanone, as suggested by HMBC correlations between a carbonyl carbon at δC 191.6 and both H-3 and H-5 and an HMBC correlation between C-2 and H-3 (Figure 2). Thus, the structure of 1 was determined as 2-[4-hydroxy-3,5-bis(3methyl-2-buten-1-yl)phenyl]-2,3-dihydrofuro[2,3-H]chromen4-one and was named sophoratonin A. From an electronic circular dichroism (ECD) spectrum and the specific rotation value of 1, this compound was found to be isolated as a scalemic mixture. Sophoratonin B (2), a yellow, amorphous solid, gave a molecular formula of C30H32O4 from the observed protonated molecular ion peak at m/z 457.2394 [M + H]+ (calcd for C30H32O4, 457.2379). The 1H and 13C NMR spectra of 2 (Tables 1 and 3) were similar to those of 1, except that additional signals for a methyl group, an exomethylene group, and two olefinic quaternary carbons, along with the absence of an sp2 methine signal, were observed. In the HMBC spectrum, cross-peaks of H-1″ (δH 6.77, 1H, s) with C-2″ (δC 157.1), C-7 (δC 159.7), and C-8 (δC 118.9) suggested the presence of a benzofuran unit, as in 1. HMBC correlations of H-5″ (δH 2.09, 3H, s) and H-4″ (δH 5.77, 1H, s and δH 5.19, 1H, s) with C-3″ (δC 132.3) and C-2″ supported the structure of 2 shown in

The 1H and 13C NMR spectroscopic data indicated that 1 is a prenylated flavonoid structurally related to 5-hydroxysophoranone (10), isolated from the title plant in the present study. The 1H NMR spectroscopic data of 1 displayed characteristic signals for a flavanone moiety at δH 5.50 (1H, dd, J = 13.5, 2.9 Hz, H-2), 3.17 (1H, dd, J = 16.8, 13.5 Hz, H-3a), and 2.87 (1H, dd, J = 16.8, 2.9 Hz, H-3b), signals for two isoprenyl units chemically equivalent at δH 5.34 (2H, m, H-2′″, 2″″), 3.39 (4H, d, J = 7.2 Hz, H-1′″, 1″″), and 1.78 (12H, s, H-4′″, 4″″, 5′″, 5″″), and aromatic protons at δH 7.90 (1H, d, J = 8.8 Hz, H-5), 7.59 (1H, d, J = 2.2 Hz, H-2″), 7.18 (1H, dd, J = 8.8, 0.9 Hz), 7.13 (2H, s, H-2′, 6′), and 6.93 (1H, dd, J = 2.2, 0.9 Hz, H-1″) (Table 1). Two isoprenyl groups that were chemically equivalent were confirmed by the HMBC correlations observed between δH 3.39 (H-1′″, 1″″) and δC 134.8 (C-3′″, 3″″) and between δH 1.78 (H-4′″, 4″″, 5′″, 5″″) and δC 121.6 (C-2′″, 2″″). From the HMBC spectrum, correlations of H-2′, 6′ with δC 29.7 (C1′″, 1″″), 153.3 (C-4′), and 80.6 (C-2) and those of H-1′″, 1″″ with δC 127.5 (C-3′, 5′) and 153.3 (C-4′) suggested that these two isoprenyl groups are positioned symmetrically in the B ring of the flavanone. The cross-peak between H-2 and δC 130.2 suggested that the latter signal could be assigned to C-1′. A 2,3-disubstituted furan ring was suggested by a coupling constant (J = 2.2 Hz) B


Journal of Natural Products Table 3. position

13

Article

C NMR Data of Compounds 1−7 in CDCl3 (100 MHz) 1

2 80.6, CH 3 44.2, CH2 4 191.6, C 5 123.5, CH 6 106.2, CH 7 160.0, C 8 117.4, C 9 156.9, C 10 115.7, C 1′ 130.2, C 2′ 126.1, CH 3′ 127.5, C 4′ 153.3, C 5′ 127.5, C 6′ 126.1, CH 6-substitution 1 2 3 4 5 8-substitution 1 104.9, CH 2 144.8, CH 3 4 5 3′-substitution 1 29.7, CH2 2 121.6, CH 3 134.8, C 4 25.8, CH3 5 17.9, CH3 5′-substitution 1 29.7, CH2 2 121.6, CH 3 134.8, C 4 25.8, CH3 5 17.9, CH3

2

3

4

5

6

7

80.6, CH 44.2, CH2 191.6, C 123.8, CH 105.8, CH 159.7, C 118.9, C 156.6, C 115.7, C 130.2, C 126.2, CH 127.5, C 153.3, C 127.5, C 126.2, CH




79.7, CH 44.4, CH2 192.0, C 125.8, CH 121.5, C 160.0, C 114.6, C 159.6, C 114.9, C 131.1, C 125.9, CH 127.4, C 153.0, C 127.4, C 125.9, CH


29.3, CH2 121.7, CH 135.0, C 26.0, CH3 18.1, CH3 100.7, CH 157.1, C 132.3, C 113.7, CH2 19.2, CH3

100.7, CH 157.1, C 132.4, C 113.7, CH2 19.2, CH3

27.0, 31.8, 75.4, 26.4, 16.8,

CH2 CH2 C CH3 CH3

116.0, CH 128.7, CH 77.5, C 28.2, CH3 28.1, CH3

22.6, CH2 121.8, CH 134.8, C 26.0, CH3 18.1, CH3

22.3, CH2 121.0, CH 135.3, C 25.8, CH3 17.9, CH3

29.7, CH2 121.6, CH 134.8, C 25.8, CH3 17.9, CH3

122.3, CH 131.1, CH 76.5, C 28.2, CH3 28.1, CH3

29.7, CH2 121.7, CH 134.7, C 25.8, CH3 17.9, CH3

122.3, CH 131.0, CH 76.4, C 28.1, CH3 28.1, CH3

29.9, CH2 121.7, CH 134.9, C 26.0, CH3 18.1, CH3

106.9, CH 145.5, CH

29.7, CH2 121.6, CH 134.8, C 25.8, CH3 17.9, CH3

28.3, CH2 122.3, CH 132.3, C 25.8, CH3 17.9, CH3

29.7, CH2 121.7, CH 134.7, C 25.8, CH3 17.9, CH3

28.4, CH2 122.3, CH 132.4, C 25.8, CH3 17.9, CH3

29.9, CH2 121.7, CH 134.9, C 26.0, CH3 18.1, CH3

28.2, CH2 121.2, CH 133.7, C 25.8, CH3 17.9, CH3

122.3), and C-4′ (δC 151.1), while, H-1″″ (δH 3.31, d, J = 7.6 Hz, 2H) exhibited cross-peaks with C-4′, C-5′ (δC 129.5) and C-6′ (δC 127.6) (Figure 2). The absolute configuration of C-2 in 3 was confirmed as 2S from the ECD spectrum, which showed a positive Cotton effect at 340 nm (Δε +0.21) and a negative Cotton effect at 279 nm (Δε −0.71). In their ECD spectra, (2S)-flavanones are well known to show a positive Cotton effect due to an n−π* transition (∼330 nm) and a negative Cotton effect due to a π−π* transition (270−290 nm).27 The molecular formula, C30H36O4, of compound 4 was established based on the protonated molecular ion peak at m/z 461.2714 [M + H]+ (calcd for C30H37O4, 461.2692). The 1H and 13C NMR data of compound 4 (Tables 1 and 3) were comparable to those of compounds 1 and 2, except that 4 showed the presence of a 2,2-dimethylchromane for the A ring substituent instead of a benzofuran ring in 1 and 2. The structure of 4 was confirmed by COSY correlations between H-1″ (δH 2.68 and 2.66, m, 1H each) and H-2″ (δH 1.79, m, 2H), HMBC correlations of H-1″ with C-7 (δC 160.9), C-8

Figure 1. The structure of sophoratonin B (2) was determined as 2-[4-hydroxy-3,5-bis(3-methyl-2-buten-1-yl)phenyl]-8(prop-1-en-2-yl)-2,3-dihydrofuro[2,3-H]chromen-4-one. Again, from the ECD spectrum and specific rotation value of 2, this compound was obtained as a scalemic mixture. Sophoratonin C (3) was isolated as a yellow, amorphous solid. Its molecular formula was deduced as C30H30O4, based on the proton-adducted molecular ion peak at m/z 455.2245 [M + H]+ (calcd for C30H31O4, 455.2222). The 1H and 13C NMR spectra of 3 (Tables 1 and 3) were similar to those of 2, except for the B ring of flavanone and one prenyl group. The 1 H, 13C, and HSQC NMR data of 3 displayed signals for a prenyl group, a 1,3-disubstituted benzene ring, two methyl groups, two olefinic methines, and an oxygenated quaternary carbon in the B ring. The 1H−1H COSY correlation between H-1′″ (δH 6.34, d, J = 9.8 Hz, 1H) and H-2′″ (δH 5.65, d, J = 9.8 Hz, 1H) and HMBC correlations of the methyl protons (δH 1.73, s, 6H, H-4′″, H-5′″) with an oxygenated quaternary carbon (C-3′″, δC 76.5) and C-2′″ (δC 131.1) were observed. In the HMBC spectrum, H-1′″ coupled with C-3′″, C-2′ (δC C



Article

that of 3. The A ring of 5 was similar to that of 4, except that the double bond at C-1″ in 5 was present in the chromane moiety. This substructure was established by COSY correlation between H-1″ (δH 6.64, d, J = 10.1 Hz, 1H) and H-2″ (δH 5.56, d, J = 10.1 Hz, 1H) and HMBC correlations between H1″ and C-7 (δC 159.6), C-9 (δC 157.8), and C-3″ (δC 77.5) and between the methyl protons (δH 1.74, s, 6H, H-4″,5″) and C-2″ (δC 128.7) (Figure 2). The ECD spectrum of 5 showed a similar appearance to those of 3 and 4, suggesting that the absolute configuration of C-2 in 5 is 2S. Compound 6 was obtained as a yellow, amorphous powder. Its molecular formula was deduced to be C35H44O4, based on the protonated molecular ion peak observed at m/z 529.3344 [M + H]+ (calcd for C35H45O4, 529.3318). The 1H and 13C NMR data of compound 6 (Tables 2 and 3) revealed its B ring to be identical to those of 1, 2, and 4. In addition to peaks indicating the B ring, a flavanone moiety and two prenyl groups were observed in the NMR spectroscopic data of 6. In its HMBC spectrum, a benzyl proton (δH 4.60, s, 1H, H-5) showed a correlation with C-4 (δC 192.0), suggesting that this proton is located at C-5. In addition, H-5 was coupled with C7 (δC 160.0) and prenyl carbon C-1″ (δC 29.3). Its HMBC spectrum exhibited correlations of an oxygenated proton (δH 6.10, s, 1H, OH-7) with C-6 (δC 121.5), C-7 (δC 160.0), and C-8 (δC 114.6), as well as correlations of a set of prenyl protons (δH 3.40, d, J = 7.3 Hz, 2H, H-1′″) with C-7, C-8, and C-9 (δC 159.6) (Figure 3). Based on these data, the A ring in 6 could be established and the overall structure of the compound determined. The ECD spectrum of 6 (sophoratonin F) was similar to those of 3, 4, and 5, indicating that the absolute configuration of C-2 in 6 is 2S. Sophoratonin G (7) was isolated as a yellow, amorphous solid. Its molecular formula was deduced to be C27H28O4, based on the protonated molecular ion peak at m/z 417.2061 [M + H]+ (calcd for C27H29O4, 417.2066). The 1H and 13C NMR spectra of 7 (Tables 2 and 3) indicated the presence of a flavanone moiety, two prenyl groups, and two additional aromatic carbons. The 1H NMR data displayed characteristic signals for a flavanone moiety at δH 5.52 (1H, dd, J = 13.1, 2.9 Hz, H-2), 3.07 (1H, dd, J = 16.9, 13.1 Hz, H-3a), and 2.88 (1H, dd, J = 16.9, 2.9 Hz, H-3b), signals for a prenyl group at δH 5.27 (1H, t, J = 7.1 Hz, H-2″), 3.44 (2H, d, J = 7.2 Hz, H-

Figure 1. Structures isolated from roots and rhizomes of S. tonkinensis.

(δC 109.1), and C-9 (δC 160.6), and HMBC correlations of the methyl protons (δH 1.36 and 1.34, s, 3H each, H-4″,5″) with C-3″ (δC 75.4) and C-2″ (δC 31.8) (Figure 2). The ECD spectrum of 4 (sophoratonin D) gave a positive Cotton effect at 332 nm (Δε 0.29) and a negative Cotton effect at 304 nm (Δε −0.51), indicating the absolute configuration of C-2 as 2S. The HRESIMS data of sophoratonin E (5) showed a protonated molecular ion peak at m/z 457.2397 [M + H]+ (calcd for C30H33O4, 457.2379), corresponding to a molecular formula of C30H32O4. NMR spectroscopic data analysis of 5 (Tables 2 and 3) revealed the presence of a 2,2-dimethyl-8prenyl-2H-chromene substructure in the B ring identical to

Figure 2. Key HMBC (blue arrows) and 1H−1H COSY (bold lines) correlations of 1−5. D



Article

Figure 3. Key HMBC (blue arrow) and 1H−1H COSY (bold line) correlations of compounds 6−8.

Table 4. 1H and 13C NMR Data of Compound 8 (δ in ppm, 400 MHz for 1H and 100 MHz for 13C, in CDCl3)

1″), and 1.74 (6H, s, H-4″ and 5″), a second prenyl group at δH 5.42 (1H, t, J = 7.4 Hz, H-2″″), 3.65 (2H, d, J = 7.4 Hz, H1″″), and 1.77 (6H, s, 4″″ and 5″″), and aromatic protons at δH 7.77 (1H, d, J = 8.7 Hz, H-5), 7.67 (1H, d, J = 2.1 Hz, H2′″), 7.55 (1H, s, H-2′), 7.19 (1H, s, H-6′), 6.79 (1H, d, J = 2.1 Hz, H-1′″), and 6.55 (1H, d, J = 8.7 Hz, H-6) (Table 3). The 1H−1H COSY cross-peak and coupling constant (J = 8.7 Hz) confirmed that H-5 and H-6 are ortho-coupled aromatic protons. From the HMBC spectrum, H-5 gave a correlation with C-4 (δC 191.6), indicating the position of this proton. The location of one prenyl group was determined at C-8 by HMBC correlations of H-5 (δC 126.5) with C-7 (δC 161.4) and C-9 (δC 160.8) and those of H-1″ (δC 22.3) with C-7 and C-8 (δC 114.5). An HMBC cross-peak between H-6 and C-10 (δC 115.0) was observed (Figure 3). A 2,3-disubstituted furan ring was determined in compound 7 based on chemical shifts of H-1′″ and H-2′″ (δH 7.67 and 6.79), their coupling constants (J = 2.1 Hz), and HMBC correlations of H-1′″ with C-4′ (δC 153.4) and those of H-2′″ with C-3′ (δC 127.3). A 5,7-disubstituted benzofuran unit was characterized by HMBC correlations of H-2′ with C-4′, C-6′ (δC 122.1), and C-1′″ (δC 106.9) and the correlation of H-6′ with C-4′ (Figure 3). Couplings of H-6′ with C-1″″ and C-2 (δC 80.1) and of H-2′ with C-2 were observed. Based on these data, 7 was elucidated as 7-hydroxy-8-(3-methylbut-2-en-1-yl)2-(7-(3-methylbut-2-en-1-yl)benzofuran-5-yl)chroman-4-one. The ECD spectrum of 7 also gave a positive first Cotton effect at 331 nm (Δε +2.11) and a negative second Cotton effect at 303 nm (Δε −4.55), like those of 3−6, suggesting that its absolute configuration of C-2 is 2S. The molecular formula of 8 was established as C22H26O5, indicating 10 indices of hydrogen deficiency, from the protonated molecular ion peak at m/z 371.1868 [M + H]+ (calcd for C22H27O5, 371.1858). The 1H, 13C, and HSQC spectra of 8 (Table 4) showed a total of 22 carbons, including a carbonyl carbon at δC 203.6, seven tertiary sp2 carbons at δC 130.4, 129.3 (2C), 121.5, 114.6 (2C), and 99.0, seven quaternary sp2 carbons at δC 164.8, 164.1, 159.0, 133.8, 128.8, 121.3, and 112.2, two secondary sp3 carbons at δC 64.8 and 27.1, a tertiary sp3 carbon at δC 55.7, two methyl carbons at δC 25.9 and 17.6, and two methoxy carbons at δC 55.3 and 54.9. A 1,4-substituted benzene ring was suggested by the orthocoupled proton signals at δH 7.16 (2H, d, J = 8.7 Hz, H-2, H-6) and 6.85 (2H, d, J = 8.7 Hz, H-3, H-5) and the HMBC correlations (Figure 3) between H-2/H-6 and C-4 (δC 159.0) and between H-3/H-5 and C-1 (δC 128.8). In addition, a methoxy proton resonance at δH 3.76 (3H, s, OCH3-4) showed a correlation with C-4, suggesting the presence of a 1substituted-4-methoxybenzene ring. An CH2OH group attached at C-α was suggested based on an HMBC correlation

position

δC, type

1 2 3 4 5 6 CO α β

128.8, C 129.3, CH 114.6, CH 159.0, C 114.6, CH 129.3, CH 203.6, C 55.7, CH 64.8, CH2

1′ 2′ 3′ 4′ 5′ 6′ 1″ 2″ 3″ 4″ 5″ OCH3-4 OCH3-4′ OH-β OH-2′

112.2, C 164.8, C 99.0, CH 164.1, C 121.3, C 130.4, CH 27.1, CH2 121.5, CH 133.8, C 25.9, CH3 17.6, CH3 54.9, CH3 55.3, CH3

δH (J in Hz) 7.16 d (8.7) 6.85 d (8.7) 6.85 d (8.7) 7.16 d (8.7) 4.65 dd (8.5, 4.9) 4.24 ddd (11.5, 8.5, 6.0) 3.83 m

6.34 s

7.40 s 3.08 m 5.13 m 1.81 s 1.56 s 3.76 s 3.82 s 2.28 dd (7.9, 6.0) 12.62 s

between H-α (δH 4.65, dd, J = 8.5, 4.9 Hz, 1H) and C-6 (δC 129.3) and a COSY correlation between H-α and H-β [δH 4.24 (1H, ddd, J = 11.5, 8.5, 6.0 Hz, H- βa) and 3.83 (1H, m, Hβb)]. An HMBC cross-peak between H-β and the carbonyl carbon (δC 203.6) suggested that the carbonyl carbon is linked at C-α. A prenyl group was deduced by a COSY correlation between H-1″ (δH 3.08, m, 2H) and H-2″ (δH 5.13, m, 1H), together with HMBC cross-peaks of methyl protons at δH 1.81 (3H, s, H-4″) and 1.56 (3H, s, H-5″) with C-2″ (δC 121.5) and C-3″ (δC 133.8) and HMBC correlation of H-1″ with C-3″. From HMBC spectroscopic data, H-1″ was coupled with C-4′ (δC 164.1), C-5′ (δC 121.3), and C-6′ (δC 130.4), while the methoxy proton (δH 3.82, s, 3H, 4′-OCH3) was coupled with C-4′ (δC 164.1). H-6′ (δH 7.40, s, 1H) was correlated with C2′ (δC 27.1), C-4′ (δC 164.1), C-1″ (δC 27.1), and the carbonyl carbon (δC 203.6). Correlations of H-3′ (δH 6.34, s, 1H) with C-1′ (δC 112.2) and C-5′ were also observed (Figure 3). Based on these data, the structure of 8 (sophoratonin H) was assigned as shown in Figure 1. E



Article

Figure 4. Effects of 8 and 12 on LPS-stimulated expression of cytokines in RAW264.7 macrophages. After RAW264.7 cells were stimulated with LPS for 6 h, inhibitory effects of 8 and 12 on the expression of inflammatory cytokines were determined using qRT-PCR. (A) Inhibitory effect of 8 on expression of CSF2. (B) Inhibitory effect of 8 on expression of IL-1β. (C) Inhibitory effect of 12 on expression of CSF2. (D) Inhibitory effect of compound 12 on expression of TNF. *p < 0.001 vs LPS.

Figure 5. Effects of compounds isolated from S. tonkinensis on PCSK9 mRNA and protein levels. (A) Expression of PCSK9 mRNA was assayed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) in cells treated with 20 μM of each isolated compound (Ber, berberine, positive control). (B) Hepatic steatosis associated protein changes assessed by Western blot analysis. *p < 0.001 versus Nor (normal). (C) Immunoblot signals were quantified using Molecular Analyst/PC densitometry software (Bio-Rad). Densitometric analysis of phosphorylated isoforms is reported. Content of PCSK9, P-ACC, ACC, or P-AMPK in cell lysates was normalized to that of β-actin as a loading control. F



Article

(JASCO, Tokyo, Japan). NMR spectra were obtained on a Varian 400 spectrometer (Varian, Palo Alto, CA, USA) at 400 MHz for 1H NMR and 100 MHz for 13C NMR. High-resolution mass spectrometric data were obtained using a Waters Xevo G2 Q-TOF mass spectrometer (Waters, Milford, MA, USA). Semipreparative high-performance liquid chromatography (HPLC) was performed with a Gilson 321 pump and Gilson 172 diode array detector (Gilson, Middleton, WI, USA). HPLC columns used were a 250 × 20 mm YMC-Pack Pro C18 RS (YMC, Kyoto, Japan) and a 250 × 10 mm Luna 5 μm C18 100A (Phenomenex, Seoul, Korea). Water was purified using a Milli-Q system (Millipore, Milford, MA, USA). Column chromatography was performed on silica gel and C18 RP silica gel (Cosmosil, Kyoto, Japan). TLC analysis was conducted on silica gel 60 F254 plates (Merck, Darmstadt, Germany). Spots were visualized by spraying with 10% aqueous H2SO4. HPLC grade solvents and solvents for extraction and fractionation were purchased from SK Chemical (Seoul, Korea). Solvent for NMR (CDCl3) was purchased from Cambridge Isotope Laboratories, Inc. (Andover, MA, USA). Plant Material. Sophora tonkinensis (Leguminosae) for “SKI3301” used in the present study was collected in the southwestern region of the People’s Republic of China (Mashan City, Guanxi Province) in September 2009. A voucher specimen (SKC04) was deposited at the Herbarium of Medicinal Plant Garden, College of Pharmacy, Seoul National University, Republic of Korea. This was identified by Professor Youngbae Suh at the Natural Product Research Institute, College of Pharmacy, Seoul National University, Republic of Korea. Extraction and Isolation. S. tonkinensis roots and rhizomes (600 kg) of 0.5 to 2.0 cm in length were twice extracted with 4200 L of a 50% (v/v) ethanol−water mixture in an extraction unit at a temperature of 80 °C. The extract was filtered and concentrated by evaporation in vacuo until its volume was reduced to 600 L. The concentrate was twice partitioned with 600 L of water-saturated nbutanol. The upper phase was collected, filtered, and concentrated by evaporation in vacuo. From 600 kg of S. tonkinensis roots and rhizomes, about 24 kg of extract was obtained. A portion of the extract of S. tonkinensis (500 g) was subjected to column chromatography (CC) using Diaion HP-20. This was eluted with MeOH−H2O (50%, 70%, 90%, 100%) and then with acetone to give five fractions (SK1−SK5). SK5 (3.02 g) was chromatographed by silica gel CC increasing gradient mixtures of n-hexane−ethyl acetate (20:1 → 0:1) and MeOH (100%) for elution to yield 26 fractions (SK5A−SK5Z). Fraction SK5L was separated by reversed-phase medium-pressure liquid chromatography (RP-MPLC) and eluted with MeOH−H2O (1:1 → 1:0). A total of 46 fractions (SK5L1− SK5L46) and pure compound 15 (flemichapparin B, 25.7 mg, SK5L18) were obtained. Compound 13 (homopterocarpin, tR 21.4 min, 6.3 mg) was obtained from SK5L10 (82.5 mg) by HPLC (YMCPack Pro C18 RS) eluted by CH3CN−H2O (66:44, 8 mL/min). Compound 1 (tR 33.7 min, 1.0 mg) was purified from SK5L22 (28.1 mg) using HPLC separation (Phenomenex Luna C18, CH3CN−H2O (80:20), 2 mL/min). SK5L26 and SK5L27 were combined and separated by HPLC (YMC-Pack Pro C18 RS, CH3CN−H2O (80:20), 8 mL/min) to provide compound 4 (tR 48.1 min, 5.1 mg). Compound 6 (tR 13.1 min, 1.3 mg) was purified from SK5L30 via semipreparative HPLC (YMC-Pack Pro C18 RS, CH3CN−H2O (90:10), 8 mL/min). SK5L34 was subjected to HPLC (YMC-Pack Pro C18 RS, CH3CN−H2O (95:5), 8 mL/min) to afford compound 5 (tR 23.9 min, 12.0 mg). Compound 3 (tR 27.3 min, 1.5 mg) was purified from SK5L36 via HPLC (Phenomenex Luna C18, CH3CN− H2O (95:5), 8 mL/min). SK5O was subjected to RP-MPLC and eluted with MeOH−H2O (1:1 → 1:0), yielding 25 fractions (SK5O1−SK5O25) and pure compound 17 (maackiapterocarpan A, 25.7 mg). Compound 16 (erybraedin D, tR 21.1 min, 1.0 mg) was obtained from SK5O10 using HPLC (YMC column, CH3CN−H2O (80:20), 2 mL/min). From SK5O21, compound 11 (sophoradochromen, tR 18.2 min, 1.2 mg) was obtained using HPLC (Phenomenex Luna C18, CH3CN−H2O (100:0), 2 mL/min). SK5Q was subjected to RP-MPLC and eluted with gradient mixtures of MeOH−H2O (1:1 → 1:0), producing 42 fractions and pure compounds 9 (lupinifolin, 25.4 mg) and 12 (7-methoxyebenosin, 5.6 mg). SK5S was separated

By comparing calculated ECD spectra of (S)-8 and (R)-8 (Figure S62, Supporting Information), the absolute configuration of C-α in 8 was determined to be S. The calculated ECD curve of (S)-8 at the B3LYP/def-SV(P) level by the CPCM model in methanol solution28 had a similar pattern to the experimental ECD curve of 8. The experimental ECD spectrum of 8, in a similar manner as the calculated ECD of (S)-8, exhibited a positive Cotton effect at 334 nm (Δε +2.48), a negative Cotton effect at 268 nm (Δε −3.48), and a positive Cotton effect at 238 nm (Δε +1.99). Accordingly, the absolute configuration of C-α in 8 was assigned as S. Previous studies have shown that many prenylated flavonoids possess anti-inflammatory effects.3,10,12 Thus, all isolates of the present study were evaluated for their inhibitory activities against NO production in RAW264.7 cells. The results are shown in Figure S63, Supporting Information. Only two compounds (8 and 12) were found to inhibit NO production without showing cellular cytotoxicity (IC50 8.1 and 6.2 μM, respectively). These two compounds were also tested for their effects on lipopolysaccharide (LPS)-induced production of cytokines. The data obtained revealed that sophoratonin H (8) and 7-methoxyebenosin (12) could modulate expression of TNF, CSF2, and IL-1β mRNAs in macrophages. As shown in Figure 4, pretreatment with sophoratonin H (8) lowered the expression of CSF2 and IL-1β mRNAs in LPSinduced RAW264.7 cells without changing TNF expression, while 7-methoxyebenosin (12) downregulated the expression levels of CSF2 and TNF mRNAs without changing the expression of IL-1β mRNA. PCSK9 is known to control cholesterol levels by modulating degradation of low-density lipoprotein receptor (LDLR).29,30 Two antibodies, evolocumab and alirocumab, have been approved recently as PCSK9 inhibitor drugs by the U.S. FDA. In the search for PCSK9 inhibitors from small organic molecules, several synthetic compounds capable of inhibiting the binding of PCSK9 and LDLR or PCSK9 synthesis have been found.29,30 As for natural-product-derived PCSK9 inhibitors, only a few natural products have been reported to inhibit PCSK9 expression.17,31−34 According to the literature,31,34 several flavonoids can inhibit PCSK9 synthesis. Thus, all compounds isolated in this study were assessed for their effects on PCSK9 mRNA expression. Of the test compounds, lonchocarpol A (10) (67.2% inhibition) and erybraedin D (16) (44.0% inhibition) downregulated PCSK9 mRNA expression at a concentration of 20 μM compared to the normal group (Figure 5A). Berberine, a positive control, showed 67.0% inhibition. Of these two compounds, erybraedin D (16) was selected for further investigation, since lonchocarpol A (10) was cytotoxic at the tested concentration. As a result, erybraedin D (16) inhibited PCSK9 expression with an IC50 value of 7.8 μM (berberine, a positive control, IC50, 6.9 μM). It also activated AMP-activated protein kinase (AMPK) and acetyl-CoA carboxylase (ACC) (Figure 5B and C). Both AMPK and ACC are known to facilitate the reduction of LDL cholesterol in lipid metabolism.29,30

■

EXPERIMENTAL SECTION

General Experimental Procedures. Optical rotation was measured with a JASCO P-2000 digital polarimeter (JASCO, Tokyo, Japan). UV and ECD spectra were obtained with a Chirascan plus circular dichroism spectrometer (Chirascan, APL, UK). IR spectra were recorded on a JASCO FT/IR-4200 spectrophotometer G



Article

by RP-MPLC and eluted with gradient mixtures of MeOH−H2O (1:1 → 1:0), yielding 42 fractions (SK5S1−SK5S42) and compound 10 (lonchocarpol A, 24.9 mg). HPLC (Phenomenex Luna C18, CH3CN− H2O (68:32), 2 mL/min) of SK5S16 gave compound 8 (tR 24.6 min, 3.6 mg). Compound 14 (dehydromaackiain, tR 21.1 min, 1.0 mg) was obtained via HPLC (Phenomenex Luna C18, CH3CN−H2O (70:30), 2 mL/min) from SK5S12. SK5S28 was subjected to HPLC (YMCPack Pro C18 RS, CH3CN−H2O (85:15), 8 mL/min), leading to the purification of compound 7 (tR 24.6 min, 3.6 mg). Sophoratonin A (1): yellowish, amorphous solid; [α]20 D +21.0 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 241 (4.05), 319 (3.51) nm; IR (neat) νmax 3445, 2974, 2928, 1683, 1612, 1462, 1388, 1330, 1295, 1254, 1216 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 417.2086 [M + H]+ (calcd for C27H29O4, 417.2066). Sophoratonin B (2): yellow, amorphous solid; [α]20 D +29.4 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 242 (4.02) nm; IR (neat) νmax 3434, 2925, 1682, 1610, 1467, 1387, 1325 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 457.2394 [M + H]+ (calcd for C30H32O4, 457.2379). Sophoratonin C (3): yellow, amorphous solid; [α]20 D +86.5 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 234 (4.03), 264 (3.92) nm; ECD (MeOH) λmax (Δε) 219 (+0.73), 279 (−0.71), 305 (−0.57), 342 (+0.21) nm; IR (neat) νmax 3422, 2974, 2929, 1685, 1610, 1467, 1385, 1323, 1265, 1205, 1153 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 455.2245 [M + H]+ (calcd for C30H31O4, 455.2222). Sophoratonin D (4): yellow, amorphous solid; [α]20 D +34.4 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 235 (4.03), 284 (3.95) nm; ECD (MeOH) λmax (Δε) 219 (+0.89), 304 (−0.51), 332 (+0.29) nm; IR (neat) νmax 3413, 2975, 2938, 1681, 1601, 1582, 1437, 1372, 1332, 1270 cm−1; 1H and 13C NMR data, see Tables 1 and 3; HRESIMS m/ z 461.2714 [M + H]+ (calcd for C30H37O4, 461.2692). Sophoratonin E (5): yellow, amorphous solid; [α]20 D −24.1 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 240 (4.05), 310 (3.78) nm; ECD (MeOH) λmax (Δε) 308 (−3.80), 342 (+1.08) nm; IR (neat) νmax 2975, 2931, 1683, 1638, 1596, 1578, 1376, 1273, 1212, 1113 cm−1; 1 H and 13C NMR data, see Tables 1 and 3; HRESIMS m/z 457.2397 [M + H]+ (calcd for C30H33O4, 457.2379). Sophoratonin F (6): yellow, amorphous solid; [α]20 D +3.6 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 229 (4.02), 285 (3.88) nm; ECD (MeOH) λmax (Δε) 243 (0.54), 308 (−1.63), 338 (+0.92) nm; IR (neat) νmax 3422, 2974, 2940, 1668, 1605, 1473, 1454, 1374, 1339, 1169, 1057, 1033 cm−1; 1H and 13C NMR data, see Tables 2 and 3; HRESIMS m/z 529.3344 [M + H]+ (calcd for C35H45O4, 529.3318). Sophoratonin G (7): yellow, amorphous solid; [α]20 D −21.0 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 241 (4.03), 279 (3.92) nm; ECD (MeOH) λmax (Δε) 230 (+0.89), 303 (−4.55), 331 (+2.11) nm; IR (neat) νmax 3421, 2980, 2936, 1681, 1605, 1455, 1373, 1338, 1055, 1033 cm−1; 1H and 13C NMR data, see Tables 2 and 3; HRESIMS m/ z 417.2061 [M + H]+ (calcd for C27H29O4, 417.2066). Sophoratonin H (8): yellow, amorphous solid; [α]20 D +53.1 (c 0.1, MeOH); UV (MeOH) λmax (log ε) 234 (4.03), 277 (4.00),330 (3.83) nm; ECD (MeOH) λmax (Δε) 238 (1.99), 268 (−3.48), 334 (+2.48) nm; IR (neat) νmax 2937, 1631, 1611, 1510, 1374, 1252, 1206, 1034 cm−1; 1H and 13C NMR data, see Table 4; HRESIMS m/z 371.1868 [M + H]+ (calcd for C22H27O5, 371.1858). ECD Calculations. The absolute configuration of compound 8 was determined by density functional theory (DFT) calculations carried out with Conflex 7 and Tubormole programs. Conformational searches were performed using the MMFF94s force field in Conflex 7 with a search limit of 95% (one conformer for each enantiomer of 8). These conformers were optimized with the Turbomole program at the B3LYP/def-SV(P) level. ECD data were calculated by the TDDFT method at the B3LYP/def-SV(P) level with the CPCM model in methanol solution. ECD spectra were simulated using Gaussian functions overlapping each transition.35,36 Cell Cultures. RAW264.7 murine macrophages were obtained from the Korean Research Institute of Bioscience and Biotechnology (Daejeon, Korea) and grown in RPMI 1640 medium supplemented with 10% fetal bovine serum and 100 U/mL penicillin/streptomycin

sulfate. A HepG2 human hepatocellular liver cell line was obtained from the Korea Research Institute of Bioscience and Biotechnology (South Korea) and grown in Eagle’s minimum essential medium (EMEM), supplemented with 10% fetal bovine serum and 100 U/mL penicillin/streptomycin sulfate. Cells were incubated in a humidified incubator at 37 °C in a 5% CO2 atmosphere. Media and Chemicals. RPMI, EMEM, penicillin, and streptomycin were purchased from Hyclone (Logan, UT, USA). Bovine serum albumin and LPS were purchased from Sigma (St. Louis, MO, USA). Antibodies against β-actin, p-AMPK, p-ACC, ACC, and PCSK9 were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Oligonucleotide primers for TNF, CSF2, IL1β, PCSK9, and GAPDH were purchased from Bioneer Corp. (Daejeon, Korea). MTT Assay for Cell Viability. Cell viability was assessed by the MTT assay according to standard procedures.10 All experiments were performed in triplicate. Measurement of NO Production. Nitrite concentration in culture medium was measured as an indicator of NO production, based on the Griess reaction.10 Immunoblot Analysis. Protein expression was assessed by Western blotting according to standard procedures.17 Images were acquired using a ChemiDoc Imaging system (ChemiDoc XRS system with Image Lab software 3.0; Bio-Rad, Hercules, CA, USA). Quantitative Real-Time RT-PCR. Total cellular RNA was isolated using a Trizol RNA extraction kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Total RNA (1 μg) was then converted to cDNA using 200 units ofreverse transcriptase and 500 ng of oligo-dT primers in 50 mM TrisHCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, and 1 mM dNTPs at 42 °C for 1 h. The reaction was stopped by incubating the solution at 70 °C for 15 min, after which 1 μL of cDNA mixture was used for enzymatic amplification. PCR reactions were performed using 1 μL of the cDNA and 9 μL of master mix containing iQ SYBR Green Supermix (Bio-Rad), 5 pmol of forward primer, and 5 pmol of reverse primer, in a CFX384 real-time PCR detection system (Bio-Rad). Reaction conditions were 3 min at 95 °C followed by 40 cycles of 10 s at 95 °C and 30 s at 55 °C. The plate was subsequently read. The fluorescence signal generated with SYBR Green I DNA dye was measured during the annealing step. The specificity of the amplification was confirmed using a melting curve analysis. Data were collected and recorded with CFX Manager Software (Bio-Rad) and expressed as a function of the threshold cycle (CT). Relative quantity of the gene of interest was then normalized to the relative quantity of GAPDH (ΔΔCT). The mRNA abundance in the sample was calculated using the 2−(ΔΔCT) method. The following specific primer sets were used (5′ to 3′): human GAPDH: GAAGGTGAAGGTCGGAGTCA (forward), AATGAAGGGGTCATTGATGG (reverse); human PCSK9: GGTACTGACCCCCAACCTG (forward), CCGAGTGTGCTGACCATACA (reverse); mouse Gapdh: TGTTCCTACCCCCAATGTGT (forward), GGTCCTCAGTGTAGCCCAAG (reverse); mouse Tnf CAAATGGCCTCCCTCTCAT (forward), TGGGCTACAGGCTTGTCACT (reverse); mouse Csf2: GGCCTTGGAAGCATGTAGAG (forward), TGAAGGAGAACTCGTTAGAGACG (reverse); mouse Il1β: GACCTTCCAGGATGAGGACA (forward), TGTTCATCTCGGAGCCTGTA (reverse). Gene-specific primers were custom-synthesized by Bioneer (Daejeon, Korea). Statistical Analysis. For multiple comparisons, one-way analysis of variance (ANOVA) was performed followed by Dunnett’s t test. Data from experiments are presented as means ± standard error of the mean (SEM). The number of independent experiments analyzed is given in the figure captions.

■

ASSOCIATED CONTENT

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jnatprod.8b00748. H



■

Article

(15) Barter, P. J.; Brandrup-Wognsen, G.; Palmer, M. K.; Nicholls, S. J. J. Lipid Res. 2010, 51, 1546−1553. (16) Mayne, J.; Dewpura, T.; Raymond, A.; Cousins, M.; Chaplin, A.; Lahey, K. A.; LaHaye, S. A.; Mbikay, M.; Ooi, T. C.; Chrétien, M. Lipids Health Dis. 2008, 7, 1−9. (17) Chae, H.-S.; You, B. H.; Kim, D.-Y.; Lee, H.; Ko, H. W.; Ko, H. J.; Choi, Y. H.; Choi, S. S.; Chin, Y.-W. Sci. Rep. 2018, 8, 6737. (18) Mahidol, C.; Prawat, H.; Ruchirawat, S.; Lihkitwitayawuid, K.; Lin, L. Z.; Cordell, G. A. Phytochemistry 1997, 45, 825−829. (19) Tahara, S.; Katagiri, Y.; Ingham, J. L.; Mizutani, J. Phytochemistry 1994, 36, 1261−1271. (20) Komatsu, M.; Tomimori, T.; Hatayama, K.; Makiguchi, Y.; Miduriya, N. Chem. Pharm. Bull. 1970, 18, 741−745. (21) Ngamga, D.; Yankep, E.; Tane, P.; Bezabih, M.; Ngadjui, B. T.; Fomum, Z. T.; Abegaz, B. M. Bull. Chem. Soc. Ethiop. 2005, 19, 1−6. (22) Song, Y.; Pan, L.; Li, W.; Si, Y.; Zhou, D.; Zheng, C.; Hao, X.; Jia, X.; Jia, Y.; Shi, M.; Jia, X.; Li, N.; Hou, Y. Bioorg. Med. Chem. Lett. 2017, 27, 4765−4769. (23) Arai, M. A.; Koryudzu, K.; Koyano, T.; Kowithayakorn, T.; Ishibashi, M. Mol. BioSyst. 2013, 9, 2489. (24) Nayak, M.; Jung, Y.; Kim, I. Org. Biomol. Chem. 2016, 14, 8074−8087. (25) Rukachaisirikul, T.; Innok, P.; Aroonrerk, N.; Boonamnuaylap, W.; Limrangsun, S.; Boonyon, C.; Woonjina, U.; Suksamrarn, A. J. Ethnopharmacol. 2007, 110, 171−175. (26) Li, X.; Wang, D.; Xia, M.; Wang, Z.; Wang, W.; Cui, Z. Chem. Pharm. Bull. 2009, 57, 302−306. (27) Han, Q.-T.; Ren, Y.; Li, G.-S.; Xiang, K.-L.; Dai, S.-J. Phytochemistry 2018, 152, 91−96. (28) Zhou, L.; Yao, G.-D.; Song, X.-Y.; Wang, J.; Lin, B.; Wang, X.B.; Huang, X.-X.; Song, S.-J. J. Agric. Food Chem. 2018, 66, 331−338. (29) Taechalertpaisarn, J.; Zhao, B.; Liang, X.; Burgess, K. J. Am. Chem. Soc. 2018, 140, 3242−3249. (30) McClure, K. F.; Piotrowski, D. W.; Petersen, D.; Wei, L.; Xiao, J.; Londregan, A. T.; Kamlet, A. S.; Dechert-Schmitt, A.-M.; Raymer, B.; Ruggeri, R. B.; Canterbury, D.; Limberakis, C.; Liras, S.; DaSilvaJardine, P.; Dullea, R. G.; Loria, P. M.; Reidich, B.; Salatto, C. T.; Eng, H.; Kimoto, E.; Atkinson, K.; King-Ahmad, A.; Scott, D.; Beaumont, K.; Chabot, J. R.; Bolt, M. W.; Maresca, K.; Dahl, K.; Arakawa, R.; Takano, A.; Halldin, C. Angew. Chem., Int. Ed. 2017, 56, 16218− 16222. (31) Nhoek, P.; Chae, H.-S.; Masagalli, J. N.; Mailar, K.; Pel, P.; Kim, Y.-M.; Choi, W. J.; Chin, Y.-W. Molecules 2018, 23, No. E504. (32) Pel, P.; Chae, H. S.; Nhoek, P.; Kim, Y.-M.; Chin, Y.-W. J. J. Agric. Food Chem. 2017, 65, 5316−5321. (33) Pel, P.; Chae, H.-S.; Nhoek, P.; Yeo, W.; Kim, Y.-M.; Chin, Y.W. Phytochemistry 2017, 136, 119−124. (34) Momtazi, A. A.; Banach, M.; Pirro, M.; Katsiki, N.; Sahebkar, A. Pharmacol. Res. 2017, 120, 157−169. (35) Hong, M. J.; Kim, J. J. Nat. Prod. 2017, 80, 1354−1360. (36) Jiao, W.-H.; Chen, G.-D.; Gao, H.; Li, J.; Gu, B.-B.; Xu, T.-T.; Yu, H.-B.; Shi, G.-H.; Yang, F.; Yao, X.-S.; Lin, H.-W. J. Nat. Prod. 2015, 78, 125−130.

MS, ECD, UV, IR, and NMR spectra of 1−8, calculated ECD spectra of (S)-8 and (R)-8 and experimental ECD spectrum of 8, NO production inhibition data in LPSstimulated RAW264.7 cells for 1−17, cell viability data in RAW264.7 cells for 1−17, inhibitory activities of 8 and 12 on TNF and IL1β expression in LPS-stimulated RAW264.7 cells, and cell viability data in HepG2 cells for 1−17 (PDF)

AUTHOR INFORMATION

Corresponding Author

*Tel: +82-31-961-5218. E-mail: [email protected] (Y.-W. Chin). ORCID

Young-Mi Kim: 0000-0002-9443-9393 Jinwoong Kim: 0000-0001-9579-738X Young-Won Chin: 0000-0001-6964-1779 Author Contributions #

J. Ahn and Y.-M. Kim contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This work was supported by a grant (NRF2018R1A5A2023127) from the National Research Foundation of Korea (NRF) funded by the Korean government (MSIT) and the Dongguk University Research Fund of 2018.

■

REFERENCES

(1) Luo, G.; Yang, Y.; Zhou, M.; Ye, Q.; Liu, Y.; Gu, J.; Zhang, G.; Luo, Y. Fitoterapia 2014, 99, 21−27. (2) Li, X. N.; Sha, N.; Yan, H. X.; Pang, X. Y.; Guan, S. H.; Yang, M.; Hua, H. M.; Wu, L. J.; Guo, D. A. Phytochem. Lett. 2008, 1, 163−167. (3) Yang, X.; Deng, S.; Huang, M.; Wang, J.; Chen, L.; Xiong, M.; Yang, J.; Zheng, S.; Ma, X.; Zhao, P.; Feng, Y. Bioorg. Med. Chem. Lett. 2017, 27, 1463−1466. (4) Ding, P.; Chen, D. Helv. Chim. Acta 2007, 90, 2236−2244. (5) Yang, R. Y.; Lan, Y. S.; Huang, Z. J.; Shao, C. L.; Liang, H.; Chen, Z. F.; Li, J. Chem. Nat. Compd. 2012, 48, 674−676. (6) Pan, Q. M.; Li, Y. H.; Hua, J.; Huang, F. P.; Wang, H. S.; Liang, D. J. Nat. Prod. 2015, 78, 1683−1688. (7) Li, X. N.; Lu, Z. Q.; Qin, S.; Yan, H. X.; Yang, M.; Guan, S. H.; Liu, X.; Hua, H. M.; Wu, L. J.; Guo, D. A. Tetrahedron Lett. 2008, 49, 3797−3801. (8) Lee, J. W.; Lee, J. H.; Lee, C.; Jin, Q.; Lee, D.; Kim, Y.; Hong, J. T.; Lee, M. K.; Hwang, B. Y. Bioorg. Med. Chem. Lett. 2015, 25, 960− 962. (9) Yoo, H.; Kang, M.; Pyo, S.; Chae, H. S.; Ryu, K. H.; Kim, J.; Chin, Y. W. J. Ethnopharmacol. 2017, 206, 298−305. (10) Chae, H.; Yoo, H.; Choi, H.; Choi, J.; Chin, Y. Biol. Pharm. Bull. 2016, 39, 259−266. (11) Yoo, H.; Chae, H. S.; Kim, Y. M.; Kang, M.; Ryu, K. H.; Ahn, H. C.; Yoon, K. D.; Chin, Y. W.; Kim, J. Bioorg. Med. Chem. Lett. 2014, 24, 5644−5647. (12) Park, K. H.; Park, Y.-D.; Han, J.-M.; Im, K.-R.; Lee, B. W.; Jeong, I. Y.; Jeong, T.-S.; Lee, W. S. Bioorg. Med. Chem. Lett. 2006, 16, 5580−5583. (13) Hirata, H.; Uto-Kondo, H.; Ogura, M.; Ayaori, M.; Shiotani, K.; Ota, A.; Tsuchiya, Y.; Ikewaki, K. J. Nutr. Biochem. 2017, 47, 29−34. (14) Abifadel, M.; Varret, M.; Rabès, J.-P.; Allard, D.; Ouguerram, K.; Devillers, M.; Cruaud, C.; Benjannet, S.; Wickham, L.; Erlich, D.; Derré, A.; Villéger, L.; Farnier, M.; Beucler, I.; Bruckert, E.; Chambaz, J.; Chanu, B.; Lecerf, J. M.; Luc, G.; Moulin, P.; Weissenbach, J.; Prat, A.; Krempf, M.; Junien, C.; Seidah, N. G.; Boileau, C. Nat. Genet. 2003, 34, 154−156. I


Prenylated Flavonoids from the Roots and Rhizomes of Sophora

Recommend Documents