Primary Amine-Clustered DNA Aptamer for DNA ... - ACS Publications

Subscriber access provided by READING UNIV

Article

Primary amine-clustered DNA aptamer for DNA-protein conjugation catalyzed by microbial transglutaminase Mari Takahara, Rie Wakabayashi, Kosuke Minamihata, Masahiro Goto, and Noriho Kamiya Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00594 • Publication Date (Web): 13 Nov 2017 Downloaded from http://pubs.acs.org on November 15, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Primary amine-clustered DNA aptamer for DNA-protein conjugation catalyzed by microbial transglutaminase Mari Takahara, †, § Rie Wakabayashi, † Kosuke Minamihata, † Masahiro Goto,† and Noriho Kamiya†, ‡, * †Department of Applied Chemistry, Graduate School of Engineering, Kyushu University, 744 Motooka, Fukuoka 819-0395, Japan. ‡Division of Biotechnology, Center for Future Chemistry, Kyushu University, 744 Motooka, Fukuoka 819-0395, Japan

ABSTRACT: DNA-protein conjugates are promising biomolecules for use in areas ranging from therapeutics to analysis because of the dual functionalities of DNA and protein. Conjugation requires site-specific and efficient covalent bond formation without impairing the activity of both biomolecules. Herein, we have focused on the use of a microbial transglutaminase (MTG) that catalyzes the cross-linking reaction between a glutamine residue and a primary amine. In a model bioconjugation, a highly MTGreactive Gln (Q)-donor peptide (FYPLQMRG, FQ) was fused to enhanced green fluorescent protein (FQ-EGFP) and a primary amine-clustered DNA aptamer was enzymatically synthesized as a novel acyl-acceptor substrate of MTG, whose combination leads to efficient and convenient preparation of DNA-protein conjugates with high purity. Dual functionality of the obtained DNA-EGFP conjugate was evaluated by discrimination of cancer cells via c-Met receptor recognition ability of the DNA aptamer. The DNA aptamer-EGFP conjugate only showed fluorescence toward cells with c-Met overexpression, indicating the retention of the biochemical properties of the DNA and EGFP in the conjugated form.

INTRODUCTION Since the discovery of DNA duplex formation, precise hybridization of DNA has contributed to the construction of designed nanostructures.1,2 Attachment of DNA as arbitrary direction tools and molecular recognition ligands, such as aptamers,3,4 to proteins (DNA-protein conjugates) has enabled the assembly of higher-ordered protein complexes in various environments.5,6 DNA-protein conjugates7,8 are potential medical or analytical reagents that combine the functionalities of DNA and proteins. For example, active targeting of protein by DNA aptamer,9 and highly-sensitive detection of target molecules coupled with signal amplification of DNA.10,11 The use of protein-DNA conjugates requires that conjugation does not impair the activity of either biomacromolecule. Thus, conjugation should be via a short chemical handle and biocompatible, and the coupling reaction should proceed efficiently under mild reaction conditions. In particular, recombinant proteins with a reactive handle are widely used for site-specific labeling, although the use of native protein labeling at specific residues is steadily increasing.12 Many studies have reported well-established DNArecombinant protein conjugation approaches that have achieved in vivo applications. Click chemistry with or without copper is a prominent method because of its bioorthogonality and the small size of the chemical handle.13,14 However, the incompatibility of copper in vivo, possibility of metalcatalyzed DNA strand degradation and low reaction kinetics without copper are drawbacks. Currently, a copper-free click reaction for DNA-protein conjugation is still under development.15 An alternative approach uses self-ligating protein affinity tags, such as the Snap-tag16 and Halo-tag.17 These spontaneous and substrate-specific couplings are

attractive for constructing DNA-protein conjugates because a stable covalent bond is formed in vivo; however, the presence of the large protein tag (20–33 kDa) can alter the activity of the target protein or DNA.18 The advantages of both methods provides a synthesized chemical handle (i.e., alkyne groups for click chemistry, O6-benzylguanine derivatives for Snap-tag, chloroalkane groups for Halo-tag) in an established manner. In this report, we focused on enzymatic conjugation via a microbial transglutaminase (MTG), which offers sitespecificity, biocompatibility, efficient reaction process, and a small conjugation handle, and operates under mild reaction conditions.19-21 In the enzymatic reaction, a covalent bond is formed between the acyl-donor glutamine (Gln, Q) and an acyl-acceptor lysine (Lys, K) or primary amine via MTG catalysis of an acyltransfer reaction. We have shown MTGmediated conjugation of N-benzyloxycarbonyl-Lglutaminylglycine (Z-QG) modified DNA (acyl-donor) with a K-tagged recombinant protein (acyl-acceptor).22,23 Considering the synthesis complexity of Z-QG peptide-modified DNA (or nucleotide), it is notable that MTG can use a primary amine that is universally used in chemical synthesis as a nucleophile.24 Therefore, a simple NH2-group modification of DNA should yield DNA that are MTG substrates. However, use of NH2-modified DNA as an MTG substrate showed minimal MTG-reactivity, presumably because of electrostatic repulsion between the anionic DNA backbone and the negatively charged amino acids surrounding the MTG active site,24 leading to diminish MTG recognition of NH2-DNA. To mitigate this repulsion, the roles of the environment near the NH2-group on DNA and the MTG-reactivity of the Q-tagged protein should be taken into consideration. Thus, to overcome low MTG-reactivity, we screened highly-reactive Gln (Q) sequences, the linker between the DNA and NH2-group, and

ACS Paragon Plus Environment

Bioconjugate Chemistry the number and position of the NH2-groups on DNA, i.e., clustering amino groups on the DNA tail (Figure 1). As a conjugation platform, the c-Met25 binding DNA aptamer (SL1)26 and the enhanced green fluorescent protein (EGFP) were selected as the model NH2-DNA and protein fused with MTG-reactive Gln (Q-tagged protein), respectively, and both functionalities after conjugation were evaluated by cell imaging dependent on c-Met expression.

dUTP]/[SL1] ratio), respectively. The incorporated NH2-DOdUTP was quantified by reversed phase (RP)-HPLC after enzymatic digestion of (NH2-DO)m-SL1.28 The components of (NH2-DO)m-SL1 were hydrolyzed into 2'-deoxyadenosine (dA), 2'-deoxyguanosine (dG), 2'-deoxythymidine (dT), 2'deoxycytidine (dC) and 5'-NH2-DO-deoxyuridylate (NH2-DOdU). Those nucleotide fragments were separated with a gradient of acetonitrile (ACN), resulting in the elution of dC (3.5 min), dG (7.8 min), dT (9.5 min), dA (15.3 min) and NH2DO-dU (16.2 min) (Figure S2A). The concentration of each nucleotide was calculated from peak integration using external nucleotide standards (Figure S2B) and subsequently converted into the number of nucleotides per chain based on SL1 components, as described previously.28 As shown in Figure 2B, the proportional tailing of NH2-DOdU into SL1 corresponds to the denaturing PAGE results (Figure S1B) and the reaction was saturated at a ratio of X = 50. The average number of NH2-DO-dUTP labels (m) per SL1 chain ranged between 1.3 and 26. Almost half the amount of substrate was consumed at each [NH2-DO-dUTP]/[SL1] ratio, except for [NH2-DO-dUTP]/[SL1] = 20 (m = 20) where NH2DO-dUTP was almost fully consumed. Compared with NH2Cn-dUTPs, it is notable that NH2-DO-dUTP achieved efficient NH2-group addition to DNA up to the number of 26-NH2-DOdU per DNA chain. The minor amount of incorporation of NH2-dUTP was similar to a previous report of the TdT reaction using nucleotides whose NH2-groups were attached directly to its base.29 According to Coleman et al., TdT catalysis requires phosphoryl transfer in the active site, which is surrounded by positively charged amino acids (Lys338, Arg336 and Arg454) that bind the phosphate backbone of DNA.30 Additionally, negatively charged amino acids of TdT active site (Asp343, Asp345 and Asp434) arrange the positions of two Co2+ ions to induce enzymatic catalysis.31 The relatively small amount of incorporation of NH2-Cn-dU is explained by electrostatic repulsion between NH2-Cn-dU and basic amino acids in the active site, and the inhibition of Co2+ positioning by cationic NH2-groups, whereas NH2-DO-dUTP showed otherwise. The different behavior of the Cn linker and DO linker indicates that the length of the alkyl chain did not mitigate inhibition of the TdT substrate recognition or catalysis; however, the DO linker did mitigate inhibition due to its flexible hydrophilic backbone.

Figure 1. Microbial transglutaminase-mediated conjugation of NH2-clustered DNA and the Q-tagged protein.

RESULTS AND DISCUSSION Preparation of NH2-modified DNAs. Amino group modifications of the DNA aptamer (SL1) were performed using terminal deoxynucleotidyl transferase (TdT), which incorporates nucleotides at the 3'-end of DNA.27 The chemical structures of NH2-modified dUTPs (NH2-dUTP, NH2-CndUTP, NH2-DO-dUTP) are shown in Figure 2A. The preliminary analysis of the TdT reaction was performed on denaturing polyacrylamide gel electrophoresis (PAGE) (Figure S1). After the TdT reaction, a few NH2-dUTP or NH2Cn-dUTP were attached to SL1 (one or two dUTPs per chain) at a [NH2-Cn-dUTP]/[SL1] = 100, whereas incorporation of NH2-DO-dUTP into SL1 gave [NH2-DO-dUTP]/[SL1] values of 2, 5, 10, 25, 50 and 100. SL1s labeled with NH2-dUTP, NH2-Cn-dUTP or NH2-DO-dUTP are abbreviated as NH2-SL1, NH2-Cn-SL1 and (NH2-DO)m-SL1(X) (X: [NH2-DO-

(A)

O HN O O O HO P O P O P O OH OH OH

O NH2 O O O HO P O P O P O OH OH OH

N

O O

HN

OH

O

HN

N H N

O

O

Dioxanone (DO) linker

NH2

n

NH2

(B) Template SL1

6.9

23

10 µM 2

7.8

23

25 µM 5

6.8

23

50 µM 10

8.2

100 µM 20

6.8

14

6.8

dC dG dT dA NH2-DO-dU NH2-DO-dUTP

N

NH2-Cn-dUTP (n = 1: C4, n = 2: C6, n = 3: C8, n = 4: C10) O

O O

N H

OH

NH2-dUTP

O O O HO P O P O P O OH OH OH

O O

O

[NH2-DO-dUTP]/[SL1]

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 14

250 50 µM

OH

9.4 0

NH2-DO-dUTP

23 23 23 20

16 15

7.6 1.3 6.7

17 18 17 40

2.0

8.1

5.1

7.2

20

8.8

26 60

80

100

Relative number of each bases/chain

Figure 2. (A) Chemical structures of NH2-modified dUTPs. (B) RP-HPLC analysis of the relative base numbers in (NH2-DO)m-SL1 after enzymatic hydrolysis. Each base number was relative to the experimental dG concentration, using components of the template SL1; dA, dT, dC and dG. Each analysis was conducted with three repeat injections, with the average calculated bases plotted and error bars representing standard deviations.


Page 3 of 14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. (A,B) Agarose gel electrophoresis analysis of MTG products. (A) 1) NH2-SL1, 2) NH2-C4-SL1, 3) NH2-C6-SL1, 4) NH2-C8SL1 and 5) NH2-C10-SL1. (B) (NH2-DO)m-SL1; 1) X = 2, 2) X = 5, 3) X =10, 4) X = 20, 5) X = 50 and 6) X = 100. M: 20 bp DNA ladder (Takara Bio Inc.). (C,D) SDS-PAGE analysis of MTG reaction products. 1) FQ-EGFP + FITC-(NH2-DO)m-SL1 alone (without MTG), [FQ-EGFP]/[FITC-(NH2-DO)m-SL1] = 2) 0, 3) 1, 4) 2, 5) 5, 6) 10 and 7) 20 with MTG. M. Precision Plus Protein™ Dual Color Standards (Bio-Rad Laboratories), M´: BenchMark™ Fluorescent Protein Standard (Thermo Fisher Scientific).

Screening of MTG-reactive NH2-modified DNA and the Q-tagged protein. The obtained NH2-SL1, NH2-Cn-SL1 and (NH2-DO)m-SL1 were subjected to the MTG reaction with Qtagged EGFP whose MTG reactivity toward specific primary amines was confirmed (Figure S3). To screen the Q-tagged EGFP reactivity towards amino groups on DNA, NH2-C6-SL1 was cross-linked with LLQG-EGFP (LQ-EGFP)32 or FYPLQMRG-EGFP (FQ-EGFP) using MTG (underlined Q is MTG-reactive site). The result showed that reactivity of FQEGFP toward NH2-C6-SL1 was higher than toward LQ-EGFP (Figure S4). Comparing the acyl-donor Q-tag sequence, more MTG-reactive FYPLQMRG was selected toward a peptidyl substrate (MRHKGS) by an in vitro phage display system (unpublished data). Thus, we selected FQ-EGFP for further screening of MTG-reactive NH2-modified DNAs. For evaluation of the linker between NH2-groups and SL1, NH2-SL1, NH2-Cn-SL1 and (NH2)m-DO-SL1 (100 ng/µL) were incubated with FQ-EGFP (5 µM) in the presence of MTG (0.1 U/mL) for 30 min at 37 °C, and subsequently spotted onto a 2% agarose gel for electrophoresis (Figure 3A,B). Without a higher molecular band shift, NH2-SL1 and NH2-Cn-SL1 showed minimal MTG-reactivity; however, all (NH2-DO)m-SL1s reacted with FQ-EGFP efficiently judging from the appearance of higher molecular weight bands (lanes 2–6, Figure 3B). In particular, (NH2-DO)m-SL1 (X = 50) was almost fully consumed during the MTG-reaction. For (NH2DO)m-SL1 (X = 50), unreacted EGFP from the MTG reaction was separated easily from the target products using a centrifugal filter (100 kDa cut-off) and the obtained conjugate was abbreviated as SL1-(EGFP)n conjugate.

The effect of the number of NH2-DO-dU labels on SL1 to MTG activity was monitored by changing the ratio of [FQEGFP]/[fluorescein isothiocyanate (FITC)-(NH2-DO)m-SL1] (X = 1:m = 1.3, or X = 50:m = 26; m = average number of NH2-DO-dU labels on an SL1 chain) in the MTG reaction. The MTG reaction mixtures were analyzed in 10–20% sodium dodecyl sulfate (SDS)-PAGE, where the increased ratio of [FQ-EGFP]/[FITC-(NH2-DO)m-SL1] encouraged the consumption of both FITC-(NH2-DO)m-SL1 (X = 2, 50) with the saturation of [FQ-EGFP]/[FITC- (NH2-DO)m-SL1] = 5 (Figure 3C,D). Comparison of (NH2-DO)1.3-SL1 and (NH2DO)26-SL1 after the MTG reaction showed that the multiple NH2-DO-groups clustered on (NH2-DO)26-SL1 were recognized preferably by MTG, leading to heterogeneous labeling of multiple EGFPs with a distribution of 75 kDa to over 250 kDa. The heterogeneous labeling of EGFPs on (NH2DO)26-SL1 came from the distributed modification of NH2DO-dUTP in the TdT reaction. The more efficient MTG reaction of (NH2-DO)26-SL1 than (NH2-DO)1.3-SL1 was due to an increase in substrate binding of (NH2-DO)26-SL1 in the MTG active site by NH3+ localization, where negatively charged amino acids capture acyl-acceptors. In our previous study, Lys (K) was used as the substrate for MTG and amino acids surrounding this Lys were positively charged, e.g., MKHK22,23 (underlined K is the reactive site). MTG recognition of a primary amine increases by spatial separation of the amino group and the negatively charged carboxyl groups in a substrate.33 Thus, clusters of NH2-DO-dU on an SL1 tail provides the positively charged microenvironment and separation from the anionic phosphate backbone, facilitating the binding of a modified DNA substrate to MTG,



1. SL1 alone

2. (NH2-DO) m-SL1 ( X = 50)

Absorbance at 280 nm (mAU)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3. FQ-EGFP alone

4. SL1-(EGFP) n

5. Purified SL1-(EGFP) n

5

6

7

8

9

10

11

12

13

Retention time (min)

Figure 4. Size-exclusion chromatography (SEC) analysis. 1) SL1 alone, 2) (NH2-DO)m-SL1 (X = 50), 3) FQ-EGFP alone, 4) (NH2-DO)m-SL1 (X = 50) + FQ-EGFP + MTG: (EGFP)nSL1 conjugate, and 5) Purified (EGFP)n-SL1 conjugate.

followed by the smooth acyltransfer reaction. Thus, optimized substrates of the MTG reaction involving NH2-DNA were multiple (NH2-DO)m-clustered DNA (m = 26) and FQ-EGFP containing the FYPLQMRG sequence, which yielded SL1(EGFP)n conjugates. The above results show that a novel combination of FQEGFP and (NH2-DO)26-SL1 as MTG substrates facilitated efficient conjugation. Moreover, the cluster of multiple NH2DO-groups on a DNA terminal end is more preferable for MTG recognition than a single group, indicating that the primary amine cluster aids substrate recognition by MTG. Analysis and purification of SL1-(EGFP)n conjugates. The obtained SL1-(EGFP)n conjugate was analyzed by sizeexclusion chromatography (SEC). After the MTG reaction between (NH2-DO)m-SL1 (X = 50, m = 26) and FQ-EGFP, a peak in the SEC at the shorter elution time (10.8 min) and a decreased EGFP peak (7.8 min) appeared, which was

Page 4 of 14

accompanied with the disappearance of the peak representing (NH2-DO)m-SL1 (X = 50, m = 26) (8.4 min) (Figure 4). Combined with SDS-PAGE analysis, the conjugate was labeled with 3–6 EGFPs on one SL1 chain heterogeneously. It is notable that the mere use of a centrifugal filter could purify the SL1-(EGFP)n conjugate (99%) by removing unreacted EGFP. Thus, the concentration of SL1-(EGFP)n was determined by absorbance at 488 nm.34 By determining the integrated peak intensities, MTG-mediated DNA-protein conjugation was efficiently achieved by the consumption of 100% and 79.2% of (NH2-DO)m-SL1 (X = 50) and FQ-EGFP, respectively, followed by easy purification of the conjugates using a centrifugal filter. The unreacted FQ-EGFP (20.8%) was most likely a hydrolyzed product; Q had reacted with water during MTG catalysis to form Glu (E). Cell imaging using the SL1-(EGFP)n conjugate. To access the functionality of the conjugates, SL1-(EGFP)n was used in cell imaging where SL1 binds c-Met, which is often overexpressed in cancer cells and EGFP serves as a fluorescent probe. We employed SNU-1 and SNU-5 as c-Met negative and positive cells, respectively.25 The quantitative binding property of the conjugate was analyzed by flow cytometry (Figure 5A). The fluorescence per cell (SNU-5) versus concentration of EGFP or FITC was fitted using the Langmuir equation25 to determine the apparent equilibrium binding constant (Kd) for SNU-5 cells. Conjugate and FITCSL1 showed dose-dependent fluorescent enhancement toward c-Met positive SNU-5 cells with almost the same Kd (219 nM and 164 nM, respectively), whereas negligible fluorescence was observed for c-Met negative SNU-1 cells, indicating cMet-targeted fluorescent emission. The slightly higher Kd of the conjugate was the concentration difference between SL1 and conjugate, where conjugates were calculated based on the EGFP molecular coefficient, leading to an apparent low SL1 concentration by multiple-EGFP labeling. Therefore, MTGmediated conjugation did not impair the functionality of SL1 and EGFP. The lower amount of FITC-(NH2-DO)m-SL1 binding to SNU-5 (Figure S5) suggests that multiple NH2groups did not contribute to non-specific binding to the cell membrane nor formation of a G-quadruplex structure for cMet binding. The localization of the conjugate in cells was observed by confocal laser scanning microscopy (CLSM) (Figure 5B) after staining SNU-1 or SNU-5 cells with conjugate (green) and lysotracker (red). The fluorescence of the conjugate was only observed inside SNU-5 cells, and coincided with the staining by lysotracker to yield a merged yellow fluorescence. Considering that there was no fluorescence inside SNU-1 cells or on the membrane surface, the (EGFP)n-SL1 conjugate distinguished the presence of c-Met in SNU-5 cells, resulting in incorporation of the conjugate by receptor mediated endocytosis35 after binding c-Met on SNU-5 cells. Additionally, there was no cytotoxicity of the conjugate, SL1 and (NH2-DO)m-SL1 (Figure S6), suggesting that the conjugate entered into live cells via receptor-mediated endocytosis. In summary, we have established MTG-mediated conjugation of NH2-DNA and a Q-tagged protein with sufficient reactivity. The purification of the DNA-(protein)n conjugate was performed simply by using a centrifugal filter, which neither impaired the functions of the DNA and protein nor induce cellular cytotoxicity.


Page 5 of 14 (A)

Conjugate (SNU-5) K d = 219 nM

Fluorescence/cell

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry (B)

FITC-SL1 (SNU-5) K d = 164 nM

FITC-SL1 (SNU-1) Conjugate (SNU-1)

FITC-SL1 or EGFP (nM)

EGFP (SNU-1/SNU-5)

Figure 5. (A) Flow cytometry analysis. The determination of fluorescence/cell provided the mean fluorescent intensity in a cell of interest calculated in the EC800 analysis mode. SNU-5 (diamond), SNU-1 (open circle). Error bars represent standard deviations. (B) CLSM imaging of SNU-5 or SNU-1 using the SL1-(EGFP)n conjugate. EGFP (green), lysotracker (red) and merged region (yellow).

CONCLUSIONS An NH2-modified DNA aptamer in which primary amine groups are terminally clustered at the 3'-end was designed and enzymatically synthesized as an acyl-acceptor substrate for the MTG reaction with a Gln-donor peptide-tagged EGFP. The highest MTG reactivity was observed for the combination of (NH2-DO)m-SL1s and FQ-EGFP, indicating that the flexible DO linker served to mitigate electrostatic repulsion between NH2-groups on DNA and basic amino acids surrounding the MTG active site. In the case of (NH2-DO)m-SL1, the labeled number of NH2-DO-dU on an SL1 chain played a significant role in MTG reaction efficiency, resulting in perfect conversion of (NH2-DO)m-SL1 (m = 26) into SL1-(EGFP)n, followed by a simple centrifugal purification step. The function of purified SL1-(EGFP)n was evaluated by cell imaging dependent on c-Met (SL1 target) expression. SL1(EGFP)n showed fluorescence of EGFP only for c-Met positive cell. Thus, novel MTG-mediated cross-linking between NH2-groups clustered on SL1 and FQ-EGFP was non-invasive in vivo. In principle, the primary amine groups clustered on the end of DNA can be synthesized not only by an enzyme reaction but also by solid-phase synthesis utilizing the phosphoramidite whose number of labeled NH2-groups on a DNA would be controlled and the distribution of DNA(protein)n conjugate in the subsequent MTG reaction would be limited. In addition, combination of protein and aptamer of interest is diverse in this conjugation method, where DNA aptamer-(protein)n conjugate could control cell functionality like cytokines as well as cell imaging, such as that of growth factor or toxin, and aptamer for their receptor. Therefore, MTG-mediated conjugation with biocompatibility and an efficient reaction rate offers further applications of DNA aptamer-(protein)n conjugates in vivo. EXPERIMENTAL SECTION Materials. TdT and tRNA were purchased from Roche (Basel, Switzerland). MTG purchased from Zedira GmbH (Darmstadt, Germany) was dissolved in ultrapure water and stored at –80 °C until used. Enzymatic activity of MTG was determined by an established method.36 NH2-dUTP was synthesized by Tokyo Chemical Industry (Tokyo, Japan). NH2-DO-dUTP and NH2-Cn-dUTP were custom-synthesized by Gene Act (Fukuoka, Japan). Oligonucleotides were

synthesized by Tsukuba Oligo Service (Tsukuba, Japan), dissolved in nuclease-free water (Wako) and stored at –20 °C until used. The sequence was: SL1 (5'ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGG TTGGCAAGCTGATTTTT-3') (underlined sequence is c-Met binding moiety) and FITC-SL1 was modified with FITC at the 5'-end of SL1. Agarose was purchased from Nacalai Tesque (Kyoto, Japan). Acetonitrile, ammonium carbonate, bovine serum albumin (BSA), methanol, N-ethylmaleimide (NEM), nuclease P1 from Penicillium citrinum and sodium dodecyl sulfate (SDS) were purchased from Wako Pure Chemical Industries (Osaka, Japan). Ammonium acetate, disodium hydrogen phosphate-2hydrate, sodium dihydrogen phosphate-2-hydrate and urea were purchased from Kishida Chemical (Osaka, Japan). Ethylenediamine-N,N,N´,N´-tetraacetic acid, disodium salt and dihydrate (EDTA) were purchased from Dojindo Laboratory (Kumamoto, Japan). Phosphodiesterase I from Crotalus adamanteus venom was purchased from Sigma-Aldrich (St. Louis, MO). Alkaline phosphatase from calf intestine (CIAP) was purchased from Takara Bio Inc. (Otsu, Japan). Ultrapure water was supplied by a Milli-Q Reference Water Purification System (Merck Millipore, Billerica, MA). Preparation of FQ-EGFP. The FQ-EGFP gene was prepared by inverse PCR with the pET22b+ vector containing LQ-EGFP as the template. Inverse PCR was performed using the KOD-Plus-Mutagenesis Kit (Toyobo, Osaka, Japan) and primers (Supporting Information) synthesized by Europhine Genomics (Tokyo, Japan). The insert and substitution of the FYPLQMRG sequence at the 3'-end of the LQ-EGFP gene was confirmed by the sequence analysis of Genenet (Fukuoka, Japan). The constructed FQ-EGFP gene was transformed into the BL21 (DE3) Escherichia coli (E. coli) strain (Merck Millipore) in order to express FQ-EGFP. The expression followed our previous work31 and the supernatant of the E. coli extract was purified using a HisTrap FF crude column (GE Healthcare, Little Chalfont, U.K.). The purification was confirmed by SDS-PAGE (Figure S7). The concentration of FQ-EGFP was determined by UV absorbance at 488 nm with a molar extinction coefficient33 of 55000 cm–1M–1 using a



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

NanoDrop ND-2000 device (Thermo Fisher Scientific, Waltham, MA). NH2-modification of DNA by the TdT reaction. NH2groups at the 3'-end of DNA were attached by the TdT reaction. The reaction mixture of 5 µM SL1, nucleotide (500 µM NH2-dUTP, 500 µM NH2-Cn-dUTP, or 10, 25, 50, 100, 250, 500 µM NH2-DO-dUTP) and 20 U/µL TdT was dissolved in the reaction buffer (5 mM CoCl2, 200 mM potassium cacodylate, 25 mM Tris-HCl and 0.25 mg/mL bovine serum albumin, pH 6.6) and incubated at 37 °C for 60 min. The reaction was terminated by addition of 20 µM EDTA. The obtained NH2-modified SL1s were purified using a QIAquick Nucleotide Removal Kit (Qiagen N. V., Venlo, Netherlands) and eluted with nuclease-free water. The concentrations of NH2-modified SL1s were determined by absorbance at 260 nm using a NanoDrop ND-2000 device, while those of NH2-modified SL1s were determined by their fluorescent measurement. NH2-modified SL1s were loaded into a white 96-well plate (Thermo Fisher Scientific) and their fluorescence intensities quantified with an LS-55 fluorescence spectrometer (PerkinElmer, Waltham, MA). The measurement conditions were: excitation wavelength 495 nm; emission wavelength 520 nm; and excitation and emission slit widths of 10 nm. MTG reaction between Q-tagged EGFP and NH2modified DNAs. Purified (NH2-DO)m-SL1s (10 ng/µL) were cross-linked with FQ-EGFP (5 µM) using 0.1 U/mL MTG in 20 mM phosphate buffer (pH 6.0) for 60 min at 4 °C. The reaction was stopped by the addition of 200 µM NEM. Subsequently (NH2-DO)m-SL1 (X = 50) was purified using a 100 kDa molecular-weight cutoff Amicon Ultra 0.5 mL centrifugal filter (Merck Millipore) and the supernatant was collected. MTG reaction products were evaluated by agarose gel electrophoresis. To analyze the optimal ratio of [FQ-EGFP]/[(NH2-DO)mSL1], FITC- (NH2-DO)m-SL1s (0.5 µM; X = 2 or 50), FQEGFP (0–10 µM) and MTG (0.1 U/mL) were incubated in 20 mM phosphate buffer (pH 6.0) for 60 min at 4 °C ([FQEGFP]/[FITC-(NH2-DO)m-SL1] = 0, 1, 2, 5, 10, 20). The reaction was stopped by mixing SDS loading buffer and heating at 94 °C for 15 min. The samples were analyzed by SDS-PAGE. Electrophoresis. 2.0% agarose gel electrophoresis (100 ng/well MTG reaction product, 135 V, 25 min) was conducted in 1 × TBE (89 mM Tris-borate, 2 mM EDTA) (Bio-Rad Laboratories, Hercules, CA) using GelRed (Biotium, Hayward, CA) as precast staining. GelRed staining of DNA was imaged by a Gel Doc™ EZ Imager (Bio-Rad Laboratories) using a UV tray. SDS-PAGE for the MTG reaction product containing FITC(NH2-DO)m-SL1s, FQ-EGFP and MTG was performed using a 10–20% e-PAGEL (ATTO, Tokyo, Japan). The gel was initially imaged by a fluorescent imager (Molecular Imager FxPro, Bio-Rad Laboratories) for the FITC moiety of SL1. Imaging settings used were an excitation wavelength of 488 nm, a 530 (± 15) nm band-pass filter and high sample sensitivity. The gel was then soaked in CBB Stain One Super (Nacalai Tesque) for protein staining, imaged by a Gel Doc™ EZ Imager (Bio-Rad Laboratories) using a white tray. Enzymatic digestion of NH2-modified SL1s and RPHPLC analysis. Digestion of (NH2-DO)m-SL1s was performed in an enzymatic manner. To prepare DNA

Page 6 of 14

fragments of (NH2-DO)m-SL1, 2 µg of (NH2-DO)m-SL1s were incubated with nuclease P1 (2 U) in 10 µL of 100 mM ammonium acetate buffer (pH 4.5) at 37 °C for 3 h, and subsequently treated with phosphodiesterase I (0.002 U) and CIAP (20 U) in 20 µL of 100 mM ammonium bicarbonate buffer (pH 9.5) at 37 °C for 3 h. For external standards, mixtures of dATP, dGTP, dTTP, dCTP and NH2-DO-dUTP were treated with CIAP (20 U) in 20 µL of 100 mM ammonium bicarbonate buffer (pH 9.5) at 37 °C for 3 h, producing dA, dG, dT, dC and NH2-DO-dU for the calibration curves. Fragmented DNA samples (2 µg) in a volume of 20 µL were analyzed by RP-HPLC on a Nexera X2 series LC system (Shimadzu, Tokyo, Japan) in three parallel injections. Injected nucleotides were separated using a 2.0 × 150 mm COSMOSIL 5C18-AR-II column (Nacalai-Tesque) and binary mobile phases of 10 mM ammonium acetate (pH 6.7)/methanol (95/5) and ACN at 30 °C with the following gradient: 0–10 min 0% ACN, 10–30 min 0–50% ACN at a flow rate of 200 µL/min. The eluted nucleosides were detected by absorbance at 260 nm using a photodiode array detector (SPD-M20A, Shimadzu). The concentrations of each nucleoside were calculated using standard curves and converted into the relative number of bases per SL1 chain following a previous report.25 Size-exclusion chromatography (SEC). The purity of obtained conjugates was analyzed on a Nexera X2 series LC system. Forty microliters of 5 µM (NH2-DO)m-SL1 (X = 50), FQ-EGFP and SL1-(EGFP)n before and after the centrifugal filter step were injected onto the SEC system using a 2.0 mm × 30 cm TSKgel SuperSW 3000 column (Tosoh, Tokyo, Japan) with an isocratic flow mode and a flow rate of 65 µL/min. Protein or DNA elution was detected by UV detection of SPD-M20A at 280 nm or 260 nm, respectively. The mobile phase was 25 mM Tris-HCl, 100 mM NaCl, pH 7.5 at 30 °C. Cell lines and cell culture. Antibiotic-antimycotic, Dulbecco's phosphate-buffered saline (D-PBS), fetal bovine serum (FBS) and Roswell Park Memorial Institute medium (RPMI 1640) were purchase from Thermo Fisher Scientific. HyClone™ Iscove's modified Dulbecco's medium (IMDM) was purchased from GE Healthcare. All cell lines were grown at 37 °C in a humidified atmosphere of 5% CO2. SNU-1 and SNU-5 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA). SNU-1 cells were maintained using RPMI 1640 supplemented with 10% FBS and 1% Antibiotic-Antimycotic, whereas SNU-5 cells were grown in IMDM supplemented with 20% FBS and 1% v/v Antibiotic-Antimycotic. Flow cytometry. SNU-1 or SNU-5 cells (4.0 × 105) were incubated with 0–500 nM SL1-(EGFP)n, FITC-SL1, FITC(NH2-DO)m-SL1 or FQ-EGFP in 50 µL D-PBS containing 0.05 mg/mL BSA and 0.05 mg/mL tRNA at 37 °C for 15 min. The unbound compounds were removed by rinsing twice with 200 µL D-PBS and then cells were suspended in D-PBS and passed through a 40 µm cell strainer (Corning Inc., Corning, NY). After incubation, the signal of FITC-SL1 or EGFP bound on SNU-1 or SNU-5 cells was measured by a cell analyzer EC800 (Sony, Tokyo, Japan). The measurement was performed using three parallel samples at each concentration. The apparent dissociation constant (Kd) of the SL1-(EGFP)n conjugate to SNU-5 cells was determined as follows. Concentration-dependent changes in mean fluorescence intensity from histograms (Figure S5) were fitted using the


Page 7 of 14

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Langmuir equation of FmaxX/(Kd + X), where Fmax, X and Kd represent the maximum fluorescent intensity, EGFP or SL1 concentration, and the dissociation constant, respectively. The regression was performed using KaleidaGraph (Synergy Software, Reading, PA). CLSM imaging. SNU-1 or SNU-5 cells (5.0 × 104) were incubated with 500 nM (EGFP)n-SL1 or EGFP in 50 µL DPBS containing 0.05 mg/mL BSA and 0.05 mg/mL tRNA at 37 °C for 15 min followed by LysoTracker™ Red DND-99 (Thermo Fisher Scientific) staining for 10 min. The unbound SL1-(EGFP)n, EGFP or lysotracker was removed by rinsing twice with 100 µL D-PBS after each step and then cells were suspended in 100 µL D-PBS. The localization of SL1-(EGFP)n or EGFP bound on SNU-1 or SNU-5 cells was observed by CLSM (Carl Zeiss AG, Oberkochen, Germany).

ASSOCIATED CONTENT Supporting Information The Supporting Information is available free of charge on the ACS Publications website. Denaturing PAGE of TdT products, RP-HPLC chromatogram and standard curves, SDS-PAGE analysis of the Q-tagged protein in the MTG reaction, agarose gel electrophoresis for comparison of Q-tagged EGFP toward NH2-C6-SL1, histograms from flowcytometry analysis, cell viability assay results and SDS-PAGE analysis of FQ-EGFP purity (PDF).

AUTHOR INFORMATION Corresponding Author *E-mail: [email protected], Tel: +81-(0)92802-2807; Fax: +81-(0)92-802-2810.

Present Addresses §

National Institute of Technology, Kitakyushu College, Department of Chemistry and Materials, 5-20-1 Shii, Kokuraminamiku, Kitakyushu, Fukuoka, Japan.

Funding Sources This work was supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI Grant Number JP16H04581.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENTS This work was financially supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI (No. JP16H04581 to N. K.). M.T. was supported by a Research Fellowship from the JSPS for Young Scientists with a Grant-in-Aid for JSPS Fellows (No. 26-4260) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan. Part of this research was supported by the Nanotechnology Platform Project (Molecules and Materials Synthesis) from MEXT of Japan. We thank the Edanz Group (www.edanzediting.com/ac) for editing a draft of this manuscript.

ABBREVIATIONS EGFP, enhanced green fluorescent protein; MTG, microbial transglutaminase; RP-HPLC, reversed-phase high-performance liquid chromatography; SEC, size-exclusion chromatography;

SL1, c-Met binding DNA deoxynucleotidyl transferase.

aptamer;

TdT,

terminal

REFERENCES (1) Rothemund, P. W. (2006) Folding DNA to create nanoscale shapes and patterns. Nature 440, 297-302. (2) Hong, F., Zhang, F., Liu, Y., and Yan, H. (2017) DNA Origami: Scaffolds for Creating Higher Order Structures. Chem. Rev. Article ASPS. (3) Ellington, A. D., and Szostak, J. W. (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-22. (4) Tuerk, C., and Gold, L., (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510. (5) Wilner, O. I., Weizmann, Y., Gill, R., Lioubashevski, O., Freeman, R., and Willner, I. (2009) Enzyme cascades activated on topologically programmed DNA scaffolds. Nat. Nanotechnol. 4, 249-54. (6) Sacca, B., Meyer, R., Erkelenz, M., Kiko, K., Arndt, A., Schroeder, H., Rabe, K. S., and Niemeyer, C. M. (2010) Orthogonal protein decoration of DNA origami. Angew. Chem. Int. Ed. Engl. 49, 9378-83. (7) Meyer, R., Giselbrecht, S., Rapp, B. E., Hirtz, M., and Niemeyer, C. M. (2014) Advances in DNA-directed immobilization. Curr. Opin. Chem. Biol. 18, 8-15. (8) Yang, Y. R., Liu, Y., and Yan, H. (2015) DNA Nanostructures as Programmable Biomolecular Scaffolds. Bioconjugate Chem. 26, 1381-95. (9) Bruno, J. G., Carrillo, M. P., and Crowell, R. (2009) Preliminary development of DNA aptamer-Fc conjugate opsonins. J. Biomed. Mater. Res. A 90, 1152-61. (10) Liu, B., Zhang, B., Chen, G., Yang, H., and Tang, D. (2014) Proximity ligation assay with three-way junction-induced rolling circle amplification for ultrasensitive electronic monitoring of concanavalin A. Anal. Chem. 86, 7773-81. (11) Tang, J., Huang, Y., Liu, H., Zhang, C., and Tang, D. (2016) Homogeneous electrochemical immunoassay of aflatoxin B1 in foodstuff using proximity-hybridization-induced omega-like DNA junctions and exonuclease III-triggered isothermal cycling signal amplification. Ana.l Bioana.l Chem. 408, 8593-8601. (12) Trads, J. B., Torring, T., and Gothelf, K. V. (2017) Site-Selective Conjugation of Native Proteins with DNA. Acc. Chem. Res. 50, 1367-1374 (13) Voigt, N. V., Torring, T., Rotaru, A., Jacobsen, M. F., Ravnsbaek, J. B., Subramani, R., Mamdouh, W., Kjems, J., Mokhir, A., Besenbacher, F., and Gothelf, K. V. (2010) Singlemolecule chemical reactions on DNA origami. Nat. Nanotechnol. 5, 200-3. (14) Khatwani, S. L., Mullen, D. G., Hast, M. A., Beese, L. S., Distefano, M. D., and Taton, T. A. (2012) Covalent proteinoligonucleotide conjugates by copper-free click reaction. Bioorgan. Med. Chem. 20, 4532-9. (15) Jawalekar, A. M., Malik, S., Verkade, J. M., Gibson, B., Barta, N. S., Hodges, J. C., Rowan, A., and van Delft, F. L. (2013) Oligonucleotide tagging for copper-free click conjugation. Molecules 18, 7346-63. (16) Juillerat, A., Gronemeyer, T., Keppler, A., Gendreizig, S., Pick, H., Vogel, H., and Johnsson, K. (2003) Directed evolution of O6alkylguanine-DNA alkyltransferase for efficient labeling of fusion proteins with small molecules in vivo. Chem. Biol. 10, 313-7. (17) Los, G. V., and Wood, K. (2007) The HaloTag: a novel technology for cell imaging and protein analysis. Methods Mol. Biol. 356, 195-208. (18) Lichty, J. J., Malecki, J. L., Agnew, H. D., Michelson-Horowitz, D. J., and Tan, S. (2005) Comparison of affinity tags for protein purification. Protein Expr. Purif. 41, 98-105. (19) Yokoyama, K., Nio, N., and Kikuchi, Y. (2004) Properties and applications of microbial transglutaminase. Appl. Microbiol. Biotechnol. 64, 447-54.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

(20) Zhu, Y., and Tramper, J. (2008) Novel applications for microbial transglutaminase beyond food processing. Trends Biotechnol. 26, 559-65. (21) Strop, P. (2014) Versatility of microbial transglutaminase. Bioconjugate Chem.25, 855-62. (22) Kitaoka, M., Tsuruda, Y., Tanaka, Y., Goto, M., Mitsumori, M., Hayashi, K., Hiraishi, Y., Miyawaki, K., Noji, S., and Kamiya, N. (2011) Transglutaminase-mediated synthesis of a DNA(enzyme)n probe for highly sensitive DNA detection. Chem. Eur. J. 17, 5387-92. (23) Takahara, M., Hayashi, K., Goto, M., and Kamiya, N. (2013) Tailing DNA aptamers with a functional protein by two-step enzymatic reaction. J. Biosci. Bioeng. 116, 660-5. (24) Ohtsuka, T., Sawa, A., Kawabata, R., Nio, N., and Motoki, M. (2000) Substrate specificities of microbial transglutaminase for primary amines. J. Agric. Food Chem. 48, 6230-3. (25) Ueki, R., and Sando, S. (2014) A DNA aptamer to c-Met inhibits cancer cell migration. Chem. Commun. (Cambridge, England) 50, 13131-4. (26) Gherardi, E., Birchmeier, W., Birchmeier, C., and Vande Woude, G. (2012) Targeting MET in cancer: rationale and progress. Nat Rev. Cancer 12, 89-103. (27) Takahara, M., Hayashi, K., Goto, M., and Kamiya, N. (2016) Enzymatic conjugation of multiple proteins on a DNA aptamer in a tail-specific manner. Biotechnol. J. 11, 814-23. (28) Motea, E. A., and Berdis, A. J. (2010) Terminal deoxynucleotidyl transferase: the story of a misguided DNA polymerase. Biochim. Biophys. Acta 1804, 1151-66.

Page 8 of 14

(29) Berdis, A. J., and McCutcheon, D. (2007) The use of non-natural nucleotides to probe template-independent DNA synthesis. Chem. Bio. Chem. 8, 1399-408. (30) Yang, B., Gathy, K. N., and Coleman, M. S. (1994) Mutational analysis of residues in the nucleotide binding domain of human terminal deoxynucleotidyl transferase. J Biol Chem. 269, 1185968. (31) Delarue, M., Boule, J. B., Lescar, J., Expert-Bezancon, N., Jourdan, N., Sukumar, N., Rougeon, F., and Papanicolaou, C. (2002) Crystal structures of a template-independent DNA polymerase: murine terminal deoxynucleotidyltransferase. EMBO J. 21, 427-39. (32) Tanaka, Y., Tsuruda, Y., Nishi, M., Kamiya, N., and Goto, M. (2007) Exploring enzymatic catalysis at a solid surface: a case study with transglutaminase-mediated protein immobilization. Org. Biomol. Chem. 5, 1764-70. (33) Gundersen, M. T., Keillor, J. W., and Pelletier, J. N. (2014) Microbial transglutaminase displays broad acyl-acceptor substrate specificity. Appl. Microbiol. Biotechnol. 98, 219-30. (34) Tsien, R. Y. (1998) The green fluorescent protein. Annu. Rev. Biochem. 67, 509-544. (35) Goh, L. K., and Sorkin, A. (2013) Endocytosis of receptor tyrosine kinases. Cold Spring Harb. Perspect. Biol. 5, a017459. (36) Folk, J. E., and Cole, P. W. (1966) Mechanism of action of guinea pig liver transglutaminase. I. Purification and properties of the enzyme: identification of a functional cysteine essential for activity. J. Biol. Chem. 241, 5518-25.

Insert Table of Contents artwork here


Page 9 of 14

Bioconjugate Chemistry O

O

≡

HN 1 O O O 2 N O 3 HO P O P O P O O OH OH OH 4 OH 5 6 7 8 9 10 11 Template DNA 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

N H

O

O

NH2-modified dUTP

NH2

Terminal deoxynucleotidyl transferase (TdT)

O

O

≡

HN O

N H

O

O

NH2

N

MTG-recognizable primary amine

NH2-clustered DNA as substrate Microbial transglutaminase (MTG)

FQ-tagged protein

O

H N

FQ-tag: FYPLQMRG

NH

O

O O

F Y P L Q M R G

HN

DNA-(Protein)n conjugate


O


O HN O O P O P O OH OH

O NH2 O O O HO P O P O P O OH OH OH

N

O O

HN

OH

n

O

O N H N

O

O

Dioxanone (DO) linker

OH

NH2-DO-dUTP

NH2

NH2

(B)

Template SL1

6.9

23

10 µM 2

7.8

23

25 µM 5

6.8

23

50 µM 10

8.2

100 µM 20

6.8

14

6.8

dC dG dT dA NH2-DO-dU NH2-DO-dUTP

N

NH2-Cn-dUTP (n = 1: C4, n = 2: C6, n = 3: C8, n = 4: C10)

HN O O

N H

OH

NH2-dUTP

O O P O P O OH OH

O O

O

[NH2-DO-dUTP]/[SL1]

1 2 3 4 5 6 7 8 9 10 11(A) 12 13O HO P O 14OH 15 16 17 18 19 20 21O HO P O 22OH 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Page 10 of 14

250 50 µM

9.4 0

23 23 23 20

16 15

7.6 1.3 6.7

17 18 17 40

2.0

8.1

5.1

7.2

20

8.8

26 60

80

Relative number of each bases/chain


100

Page 11 of 14


1 2 3 (A) (B) w/o MTG w/ MTG w/ MTG 4 w/o MTG 5 (bp) 1 2 3 4 5 6 M 1 2 3 4 5 6 2 3 4 5 M 1 2 3 4 5 M (bp) 1 6 7 Slight SL1-EGFP 8 conjugate 500 500 9 10 200 200 NH2-Cn-SL1 11 100 100 NH2-SL1 12 13 14 15 16 (D) 17 (C) (NH2-DO)m(NH2-DO)m(NH2-DO)m(NH2-DO)m18 SL1 (X = 50) SL1 (X = 2) SL1 (X = 50) SL1 (X = 2) 19 M 1 2 3 4 5 6 7 1 2 3 4 5 6 7 M M 1 2 3 4 5 6 7 1 2 3 4 5 6 7 M 20 21 (kDa) (kDa) 22 SL1-(EGFP)n 23 250 conjugate 24 155 155 25 26 SL1-(EGFP)2 27 conjugate 75 28 75 29 (NH2-DO)m30 41 37 SL1 31 32 25 23 33 34 35 NH2-SL1 12 36 37 38 39 ACS Paragon Plus Environment 40 41 42

FQ-EGFP SL1-(EGFP)n conjugate (NH2-DO)m-SL1

SL1-(EGFP)n conjugate Impurities from E.Coli MTG EGFP


Page 12 of 14

2. (NH2-DO) m-SL1 ( X = 50)

Absorbance at 280 nm (mAU)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

1. SL1 alone

3. FQ-EGFP alone

4. SL1-(EGFP) n

5. Purified SL1-(EGFP) n

5


6

7

8

9

10

Retention time (min)

11

12

13

Page 13 of 14

Conjugate (SNU-5) K d = 219 nM

Fluorescence/cell

1 2 3 4 5 6 7 8 9 10 (A) 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42


(B)

FITC-SL1 (SNU-5) K d = 164 nM

FITC-SL1 (SNU-1) Conjugate (SNU-1)

FITC-SL1 or EGFP (nM)

EGFP (SNU-1/SNU-5)



O

O

≡

HN O

NH2-clustered DNA as substrate FQ-tagged protein

≡

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42

Page 14 of 14

N H

O

O

N

MTG-recognizable primary amine

Microbial transglutaminase (MTG)

O

H N

FQ-tag: FYPLQMRG

NH

O

O O

F Y P L Q M R G

HN

DNA-(Protein)n conjugate


NH2

O

Primary Amine-Clustered DNA Aptamer for DNA ... - ACS Publications

Recommend Documents