(PRMT) Inhibitors Inhibiting Leukemia Cells ... - ACS Publications

Subscriber access provided by UNIVERSITY OF ADELAIDE LIBRARIES

Article

Development of Potent Type I Protein Arginine Methyltransferase (PRMT) Inhibitors Inhibiting Leukemia Cells Proliferation Chen Wang, Hao Jiang, Jia Jin, Yiqian Xie, Zhifeng Chen, Hao Zhang, Fulin Lian, Yu-Chih Liu, Chenhua Zhang, Hong Ding, Shijie Chen, Naixia Zhang, Yuanyuan Zhang, Hualiang Jiang, Kaixian Chen, Fei Ye, Zhiyi Yao, and Cheng Luo J. Med. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.jmedchem.7b01134 • Publication Date (Web): 11 Oct 2017 Downloaded from http://pubs.acs.org on October 12, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Journal of Medicinal Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Journal of Medicinal Chemistry

Development of Potent Type I Protein Arginine Methyltransferase (PRMT) Inhibitors Inhibiting Leukemia Cells Proliferation Chen Wanga,b,c#, Hao Jiangb,c#, Jia Jina,#, Yiqian Xieb, Zhifeng Chend, Hao Zhangb, Fulin Lianb, Yu-Chih Liue, Chenhua Zhange, Hong Dingb, Shijie Chenb, Naixia Zhangb, Yuanyuan Zhangb,*, Hualiang Jiangb, Kaixian Chenb,d, Fei Yea,*, Zhiyi Yaof* and Cheng Luob,* a

b

College of Life Sciences, Zhejiang Sci-Tech University, Hangzhou, China

Drug Discovery and Design Center, CAS Key Laboratory of Receptor Research, State

Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, 555 Zuchongzhi Road, Shanghai 201203, China c

University of Chinese Academy of Sciences, 19 Yuquan Road, Beijing 100049, China

d

School of Life Science and Technology, ShanghaiTech University, 100 Haike Road,

Shanghai 201210, China e

In Vitro Biology, Shanghai ChemPartner Life Science Co., Ltd., #5 Building, 998, Halei

Road, Shanghai 201203, China

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

f

College of Chemical and Environmental Engineering, Shanghai Institute of Technology,

Shanghai, 210032, China


Page 2 of 71

Page 3 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ABSTRACT: Protein Arginine Methyltransferases (PRMTs) are crucial players in diverse biological processes and dysregulation of PRMTs has been linked to various human diseases, especially cancer. Therefore, small molecules targeting PRMTs have profound impact for both academic functional studies and clinical disease treatment. Here,

we

report

the

discovery

of

N1-(2-((2-chlorophenyl)thio)benzyl)-N1-methylethane-1,2-diamine (28d, DCPR049_12), a highly potent inhibitor of type I PRMTs that has good selectivity against a panel of other methyltransferases. 28d effectively inhibits cell proliferation in several leukemia cells and reduces the cellular asymmetric arginine dimethylation levels. Serving as an effective inhibitors, 28d underlies the mechanism of cell killing in both cell cycle arrest and apoptotic effect as well as downregulation of the pivotal mixed lineage leukemia (MLL) fusion target genes such as HOXA9 and MEIS1, which reflects the critical roles of type I PRMTs in MLL leukemia These studies represent 28d as a valuable inhibitor to investigate the role of type I PRMTs in cancer and other diseases.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 71

INTRODUCTION

The involvement of PRMTs in human tumorigenesis has been broadly reported. PRMTs expression is upregulated and associated with aggressive clinical features and poor survival in human malignancies.1, 2 Overexpression of PRMT1 promotes the survival and invasion of cancer cells while knockdown of PRMT1 has been shown to arrest the growth of cancer cells.3-7 In addition, accumulating evidence suggests the important roles of PRMT1 in malignant hematopoiesis.8 Chromosomal translocation at t(8;21) generates a fusion protein acute myelogenous leukemia 1-RUNX1 translocation partner 1 (AML1-ETO), which acts as an oncogenic transcription factor and occurs in 15% of de novo acute myeloid leukemia (AML) cases.9 PRMT1 can interact and methylate AML1-ETO fusion protein, promoting its transcriptional activation and self-renewal capability.10 PRMT1 can also cooperate with the MLL fusion proteins such as lysine methyltransferase 2A-SH3 domain containing GRB2 like 1 (MLL-EEN) or lysine methyltransferase 2A-growth arrest specific 7 (MLL-GAS7) in MLL leukemia.11,

12

Moreover, the enzymatic activity of PRMT1 has shown to be essential for MLL-mediated transformation, as evidenced by the disability of the transforming capacity in the PRMT1 catalytic-dead mutant. In addition, PRMT4 (also known as coactivator associated arginine methyltransferase 1 (CARM1)) and PRMT6 dysregulation have been reported to


Page 5 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


be involved in diverse cancer types including colorectal, bladder and lung cancer.2, 13 These findings not only unveil the critical functions of PRMTs in oncogenesis but also make PRMT family of enzymes promising therapeutic targets in drug discovery. Therefore, PRMTs modulators are valuable compounds to both facilitate the dissection of PRMTs biological function and speed up the development of candidate drug leads targeting PRMTs. So far nine PRMTs have been well reported in mammalian cells, and these enzymes can be divided into three types.14 Type I PRMTs consisting of PRMT1, 2, 3, 4, 6 and 8 catalyze the transfer of methyl group(s) from S-adenosyl-L-methionine (SAM) onto arginine residues to form monomethylation (MMA) and asymmetric dimethylation (ADMA) while type II PRMTs consisting of PRMT5 and 9 catalyze formation of monoand symmetric dimethylation (SDMA).15,

16

Type III PRMTs, which only contains

PRMT7, generates monomethylation of arginine.17 Among these enzymes, PRMT1 is the predominant type I methyltransferase which accounts for ~ 90% of all cellular arginine methylation events and has a wide range of substrate spectrum including histone H4 residue Arg 3 (H4R3), transcriptional factor forkhead box O1 (FOXO1) and abundant proteins involving in RNA processing.18-20 Through methylation of various substrates, PRMT1 is reported to impact on diverse cellular processes including DNA damage repair, RNA splicing process, signal transduction and gene transcription.21-24 Besides, application of the pan-dimethyl arginine antibodies has benefited the functional study of



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

PRMTs. Researches with these antibodies have shown that loss of PRMT1 activity switches the substrate arginine methylation status from asymmetry to symmetry in cellular level.25 These validated antibodies are powerful tools in chemical biological evaluations of PRMTs inhibition in cells. To date, many PRMT inhibitors have been reported (Chart 1).26 Early studies often used S-adenosyl methionine (SAM) anologues (including S-adenosylhomocysteine (SAH),27

5'-deoxy-5'-(1,4-diamino-4-carboxybutyl)adenosine (1, sinefungin),28 and

methylthioadenosine (2, MTA)29) to explore PRMT1 biology in various cell models. Since SAM is a common methyl group donor, these pan-methyltransferase inhibitors may have the off-target effects through inhibiting other melthyltransferases, leading to confounded phenotypes to interpret. Compound 3 (AMI-1)30 was the first molecular that specifically inhibited type I PRMTs (PRMT1, 3, 4 and 6) activity at low micromolar level in vitro and has been widely used as a chemical tool under various biological conditions. In recent years, many efforts have been made to seek more potent and selective inhibitors toward type I PRMTs. Compounds like 4 (DCLX069),31 5 (DB75),32 6 (MHI-21)33 show improved activity and selectivity compared with compound 3, however, their biochemical IC50 values trap in the micromolar range. In addition, PRMT4 (CARM1) inhibitor 7 (CMPD-1),34 with the potency at nanomolar range, has claimed good selectivity over other PRMTs. Notably, while this work is in preparation, PRMT6 inhibitor 8 (EPZ020411)35 and type I PRMT inhibitor 9 (MS023)36 have been identified. Our


Page 6 of 71

Page 7 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


previous virtual screening work identified compound 4 as PRMT1 inhibitor which theoretically occupied SAM-binding site to exert the inhibitory effect.31 In this study, we fine-tune our strategies and focus on the substrate-binding site to seek compounds with enhanced activity both in vitro and in cells.

Chart 1. Chemical structures of the reported PRMT inhibitors. Here, based on virtual screening and chemical optimizations, we identified two potent type

I

PRMT


inhibitors,


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 71

N1-(2-((2-chlorophenyl)thio)benzyl)-N1-methylethane-1,2-diamine (28d, DCPR049_12) and

N1-(2-((2-chlorophenyl)thio)benzyl)-N1,N2-dimethylethane-1,2-diamine

(31d,

DCPR049_13) with biochemical IC50 values of 5.3 nM and 6.0 nM respectively. Moreover, 28d and 31d exhibited potent inhibitory effect on leukemia cells and altered the endogenous arginine methylation levels. They modulated key leukemogenic homeobox genes, thus reflecting the critical role of type I PRMTs in human MLL leukemia. Due to their high potency and selectivity against type I PRMTs, 28d and 31d will be valuable compounds to dissect type I PRMT biology as well as facilitate PRMTs-guided drug discovery progress.

RESULTS

Discovery of a lead compound 13a (DCPR049) through virtual screening

In our previous study, we identified several inhibitors of PRMT1 based on virtual screening targeting SAM-binding site.31 For achieving inhibitors with better activity and selectivity, an optimized structure-based virtual screening strategy which focused on the substrate-binding pocket was adopted to identify small-molecule PRMT1 inhibitors with novel scaffolds (Figure 1A). To date, the crystal structure of human PRMT1 (hPRMT1) has not been determined. Given the highly conserved sequences shared among hPRMT1, rat PRMT1 (rPRMT1) and human PRMT6 (hPRMT6) (Figure S1) as well as the


Page 9 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


conformation similarity of the N-terminal helix αX domain which is important for PRMT1 activity, we generated a homology model for hPRMT1 based on the X-ray structure of rPRMT1 (PDB ID: 1OR8)29 and hPRMT6 (PDB ID: 4Y30)35. The modeled hPRMT1 structure was used as a target to perform molecular docking screening against SPECS database (http://www.specs.net). To refine the database, we filtered it by Lipinski’s rule of five and removed pan-assay interference compounds (PAINS).37-40 The remaining 182,014 compounds were subsequently docked into the substrate arginine binding site using energy scoring function of DOCK4.0. The top-ranked 10500 candidates were evaluated and ranked by Glide SP and XP modes integrated in Maestro 9.2,41 resulting a list of 600 compounds. To ensure the scaffold diversity in the hits, the top-ranked 600 molecules were clustered into 100 groups with Pipeline Pilot, version 7.5 (Pipeline Pilot; Accelrys Software Inc., San Diego, CA). Finally, 107 compounds were purchased from Specs Company for further biochemical evaluations.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. Virtual-screening procedures and PRMT1 activity assay results in vitro. A. Flowchart of the integrated virtual screening for PRMT1 inhibitors. B. Inhibitory activity of top 23 compounds from virtual screening determined by TR-FRET.

Inhibition of PRMT1 enzymatic activity and characterization in biophysical assay

The 107 candidate molecules selected by virtual screening were tested for PRMT1 inhibition to determine their biochemical activities. First, Time-resolved Flourescence Resonance Energy Transfer (TR-FRET) assay was carried out. The reactions were run with His-tagged rPRMT1 (11-353) as the enzyme and biotinylated H4 peptide (1-21) as the substrate. The reaction mixture was treated with europium-labeled histone H4 arginine 3 asymmetric dimethylation (H4R3me2a) antibody and Ulight streptavidin and the final measurement was performed to detect methylation products. From the enzyme


Page 10 of 71

Page 11 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


inhibition assay, we chose 7 compounds for their ability to inhibit PRMT1 activity by >80% at the concentration of 100 µM (Figure 1B and Figure S2). To further validate the activities of the 7 compounds, we determined their IC50 values against PRMT1 by 3

H-labeled radioactive methylation assay (Figure 2A-B and Figure S3). Amongst them,

compound 13a (Figure 2A) exhibited the highest potency with an IC50 value of 3.0 µM. To confirm the binding between 13a and PRMT1, both Carr-Purcell-Meiboom-Gill (CPMG) and saturation transfer difference (STD) NMR experiments were performed. As shown in Figure 2C-D, a strong signal in STD experiment and a significant decreased signal in CPMG spectrum were detected under the condition of 5 µM PRMT1 and 200 µM

compound 13a, indicating the mutual binding between PRMT1 and the compound.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 2. Structures of compounds and biochemical or biophysical assay results. A. Structure of 13a and IC50 determination for 13a against PRMT1 by radioisotope. B. Structures of four compounds with poor activity against PRMT1 determined by radioisotope. C. STD NMR experiments of 5 µM PRMT1 in the presence of 200 µM compound 13a. D. Dose dependent CPMG spectra for 200 µM compound 13a (red) in the presence of 5 µM PRMT1 (blue), 2 µM PRMT1 (green) and 1 µM PRMT1 (aqua).

Analysis of the binding mode and chemical modification of compound 13a

To gain a better understanding of the molecular basis for the inhibitory activity of compound 13a toward PRMT1, a putative binding mode was docked by Glide42 with XP mode43. As shown in Figure 3A, compound 13a occupied the negative-charged binding site of the substrate arginine. The ethylenediamine side chain of this compound formed hydrophobic interactions with E144, Y148, E153 and S154, which were critical for


Page 12 of 71

Page 13 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 3. Predicted binding mode and structural modification of compound 13a. A. Superimposition of the binding modes of 13a and substrate arginine (PDB ID: 1OR8). Compound 13a is shown as magenta sticks, and substrate arginine is shown as cyan sticks, with the surface of PRMT1 depicted in vacuum electrostatics. B. Binding mode of 13a. It is shown as magenta sticks, and key residues are shown as gray sticks. Hydrogen bonds are shown as a red dashed line. C. Schematic diagram showing putative interactions between PRMT1 and 13a. Residues involved in the hydrophobic interactions are shown as starbursts, and hydrogen-bonding interactions are denoted by dotted green lines. D. Chemical modification of 13a, which leads to 28d and 31d with enhanced activities. The bold bonds mimic side chain of substrate arginine.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 71

methylation catalysis. It has been reported that mutations of E144 and E153 could significantly reduce or totally abolish the activity of PRMT1.29 Besides, a hydrogen bond was found between the nitrogen in the ethylenediamine moiety and the OH group of residue Y39, which was located at the N-terminal helix αX (Figure 3B). There were also some hydrophobic interactions between the naphthalene ring of 13a and residues in αX and the adjacent αY (Figure 3C). Table 1. Chemical Modification of compound 13a

No.

R1

R2

23a

24a

H

23b

24b

H

R3

R4

R5

IC50 (µM)

H

> 200

H

34

H

> 50

H

> 50


Page 15 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


25b

H

23c

24c

H

25c

H

23d

24d

H

25d

H

28d

H

31d

H

3.6

H

> 200

H

45

0.71

H

> 50

H

54

0.39

H

H

0.0053

H

0.006

To improve the molecular inhibitory activities against PRMT1, we synthesized a series of phenyl sulfide derivatives for investigating the structure activity relationship (SAR) based on the predicted binding mode of lead compound (Figure 3D). We found that the substitution of naphthalene ring with benzene ring resulting in 25b displayed



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

similar activity to 13a, with an IC50 value of 3.6 µM (Table 1, potency (IC50) data shown in table 1 were measured using radioisotope assay). However, introduction of carbonyl to the ethylenediamine side chain (R2 position) or replacement of the methyl group with hydrogen atom (R3 position) totally abolished or remarkably reduced the activity of inhibitors (23a, 24a, 23b, 24b Table 1), indicating the essential role of the tertiary amine in the middle of the ethylenediamine chain. Next, we explored introduction of halogen atom to the benzene ring of 25b (Figure 3D). Halogen bond, a specific intermolecular interaction between a halogen atom and an electron-rich partner (O, N, S, or π), is a distinct class of hydrogen-bond-like interactions.44 Compounds with halogen atom attached to the benzene ring may form halogen bonding with surrouding residues (e.g, Y35, S38). As expected, the inhibitory activity of 25c, with ortho-substituted fluorine atom on the benzene ring in R1 position, was improved by about 5-fold. Introducing a chlorine atom to benzene ring also increased activity (25d, IC50 = 0.39 µM, Table 1). As shown in Figure 3A, the ethylenediamine moiety of 13a mimics the conformation of substrate arginine side chain.

45

It is known that in the typical SN2-favored catalytic

process of PRMT1, the first and second methyl are transferred onto the substrate arginine one after another.45 We also noticed PRMT4 (CARM1) inhibitor CMPD-1 features a similar side chain which was directed towards the bottom of the arginine-binding cavity.34 Hence we wanted to mimic the substrate changes during the catalytic process. We designed and synthesized compounds 28d and 31d, which replaced the terminal tertiary amine with primary amine or secondary amine respectively (Figure 3D and


Page 16 of 71

Page 17 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Scheme 1). The IC50 values of 28d and 31d were determined using radiolabel assay to be 5.3 nM and 6.0 nM, respectively (Table 1). Strikingly, the introduction of hydrogen-bond donor significantly improved the activity of inhibitors. The molecular modeling of 28d implied that the improved affinity is probably contributed by hydrogen bonds and electrostatic attraction interactions between the tail group of the inhibitors and the negative-charged binding pocket which is mainly formed by E144, M146, Y148, E153, as well as halogen bond with Y35 located at the helix αX (Figure S4). While we were performing the biological experiments, two compounds 8 and 9 with the similar side chain were reported, which further confirmed the ethylenediamino group is an arginine mimetic and an excellent moiety for targeting type I PRMTs.35,

36

What’s more, the

optimized compounds 28d and 31d were again evaluated by both CPMG and STD experiments. The results showed obvious binding signals between PRMT1 and both of the compounds, confirming the inhibitory potency (Figure S5).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 71

Scheme 1. aReagents and conditions: (i) Cu, K2CO3, Aryl halides, DMF, reflux, 12 h. (ii) Oxalyl

dichloride,

DMF,

CH2Cl2,

0

℃

to

RT,

4

h.

(iii)

N1,N1-dimethylethane-1,2-diamine, Ph, RT, 12 h. (iv) NaBH4, (C2H5)2O·BF3, THF, 1 h at RT and 3 h reflux. (v) HCOOH, 36% HCHO, 100℃, 3 h. (vi) Tert-butyl (2-(methylamino)ethyl)carbamate, NaBH(OAc)3, toluene, 0℃ to RT, 4 h. (vii) NaBH4, (C2H5)2O·BF3, THF, 1 h at RT and 3 h reflux. (viii) HCl/dioxane, RT, 16 h. (ix) NaH,


Page 19 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MeI, THF, 0℃ to RT, 17 h. (x) NaBH4, (C2H5)2O·BF3, THF, 1 h at RT and 3 h reflux. (xi) HCl/dioxane, RT, 16 h. Overall, based on combination of molecular modeling and chemical modifications, we improved the potency of PRMT1 inhibitors by over 500-fold, highlighting the efficiency of structural optimizations.

Mechanism of action (MOA) studies and selectivity of 28d

To study MOA of 28d, we performed a kinetic experiment using radiolabel method to determine the potency (IC50) of 28d using various concentrations of SAM or peptide. As shown in Figure S6, 28d showed uncompetitive inhibition with respect to cofactor SAM on PRMT1, and showed noncompetitive inhibition with respect to peptide on PRMT1. The uncompetitive pattern of inhibition on SAM has also been observed in the study by Eram et al.36 where they explored MOA of a similar inhibitor 9 against PRMT3. However, in their study, compound 9 displayed noncompetitive pattern against PRMT1 with respect to SAM. The difference might be due to the lower concentrations of SAM used in our assay. In the crystal structure (PDB ID: 1OR8), the cofactor SAM binding site was around the peptide substrate binding site, we suggest that SAM may assist in stabilizing peptide substrate binding pocket, which is benefit for the binding of 28d to PRMT1. In other words, there is a preferred binding sequence for productive PRMT1-SAM-compounds complex formation in which SAM binds before the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

compounds. While at the low concentration of SAM, the protein may be flexible and could hardly bind the compounds. Thus the inhibitory activity towards PRMT1 of 28d was much weaker at low SAM concentrations. This possibility was also supported by the ITC experiments conditions of 7 and 9, in which SAH or SAM were added.34, 36 In the study of compound 7, Sack et al.34 showed the ITC results in the absence of SAH, demonstrating that 7 cannot bind to PRMT4 without SAH. Considering the conserved structure among type I PRMTs, we suggest cofactor binding will induce structural changes of PRMT1 that leads to appropriate formation of the arginine-binding pocket. Thus at very low concentrations of SAM will reduce the binding efficiency of 28d, which results in the uncompetitive inhibition with respect to cofactor SAM. Notably, we acquired the same result on the noncompetitive mode of inhibition with respect to peptide towards PRMT1 like 9. However, in the previous studies like compound 7, 8 and 9,34-36 the crystal structures clearly showed the ethylenediamine moiety mimics the conformation of substrate arginine side chain and occupies the peptide substrate binding site so that we suggest 28d may share the similar MOA with them since the ethylenediamine side chain of 28d is similar with them. And the possible explanation about the contradictory results is there might be conformation change about the α-helix at the N-terminus of the protein. As shown in crystal structures of type I PRMTs with inhibitors, the α-helix was completely floded and locked the substrate binding pocket, which might prevent the binding of peptide. Thus the proteins once bind the compounds


Page 20 of 71

Page 21 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


and form a closed state with compounds. Then peptide would not enter the binding cavity by competing the compounds, even in a high concentration of peptide substrate. In summary, although the kinetic experiment didn’t show competitive inhibition with respect to peptide, we still can predict the binding model, in which 28d occupies the substrate binding site of PRMT1, according to the previous studies.6, 10, 28 To assess the selectivity of 28d, we evaluated the inhibitory activities of 28d against other PRMT family enzymes (PRMT3, PRMT4, PRMT5, PRMT6, PRMT8) and a panel of other 10 methyltransferases and acetyltransferases at the concentrations of 50 µM and 100 µM (Figure 4). We found 28d exhibited obvious and diverse inhibitory activities towards type I PRMTs, demonstrating its role as a pan inhibitor. However, 28d showed minimal inhibitory effects on the other methyltransferases including 7 PKMTs (EZH2, DOT1L, G9a, MLL1, PRDM9, SMYD2 and SUV39H1) as well as DNA methyltransferases (DNMT1 and DNMT3A/3L) and histone acetyltransferase GCN5, indicating its good selectivity against other methyltransferases (Figure 4G).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 ACS Paragon Plus Environment

Page 22 of 71

Page 23 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 4. Determination of the selectivity of 28d in biochemical assays. A-F. IC50 determination of 28d against PRMT1, PRMT3, PRMT4, PRMT5, PRMT6 and PRMT8 using AlphaLISA method. G. Determination of 28d against GCN5, DOT1L, EZH2, DNMT3A/3L, DNMT1, G9a, MLL1, PRDM9, SMYD2 and SUV39H1 at 50 µM and 100 µM.

Inhibitory effect on the proliferation of leukemia cells



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 5. 28d decreased the cell viability in leukemia cells and knockdown of PRMT1 inhibited MV4-11 cell growth. A,B. Treatment with 28d for 96 h dose-dependently reduced the proliferation of leukemia cells (A) but not normal cells (B). C. Knockdown of PRMT1 was validated through western blotting. Both PRMT1 expression and arginine dimethylation levels were reduced. GAPDH and Histone H4 were used as loading controls. D. Genetic knockdown of PRMT1 reduced cell proliferation in MV4-11 cells. The results are mean ± SD of three replicates. **P < 0.01, ***P < 0.001

To detect whether 28d and 31d were sufficient to inhibit cancer cell proliferation, we screened eight leukemia cell lines (KOPN-8, KMS11, MV4-11, THP-1, RS4.11, RCH-ACV, REH and U937) using CellTiter-Glo assay. Results showed these two compounds were potent at inhibiting cell proliferation in a dose-dependent manner, and notably showed high potency toward MV4-11 cells (Figure 5A and Figure S7A). We also found these two compounds exhibited minimal effects on cell proliferation of human normal cells (human umbilical vein endothelial HUV-EC-C cells, human normal lung MRC-5 cells and human renal cortical tubule epithelial RCTEC cells) (Figure 5B and Figure S7B). The potent cell-killing activity of type I PRMT inhibitors suggests PRMTs might be a regulator of leukemia cell proliferation. Since the biological function of PRMTs in leukemia is largely unknown, the effects of abrogation of the predominant enzyme PRMT1 activity on leukemia cell proliferation were examined using validated


Page 24 of 71

Page 25 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PRMT1 shRNA. Immunoblot results showed both PRMT1 expression level and the substrate asymmetric methylation levels were reduced (Figure 5C). Besides, depletion of PRMT1 reduced cell proliferation of MV4-11 cells (Figure 5D). However, genetic knockdown of PRMT1 showed a prolonged and rather small effect on cell proliferation compared with the inhibitor treatment. Given that the inhibitors exhibited the role as pan inhibitors, the cell-killing effect may attribute to combined inhibition of type I PRMTs.

Alteration of the arginine methylation patterns in cellular levels

The most sensitive cell MV4-11 was chosen as the cell model to further characterize the two compounds. We first performed a long-term treatment of the two compounds against MV4-11 cells and found both 28d and 31d greatly reduced



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 6. The anti-proliferative effect and arginine methylation alterations upon treatment with 28d in MV4-11 cells. A. Long-term treatment of MV4-11 cells with 28d inhibited cell proliferation in a time-dependent manner. B. Treatment with 28d for 48 h dose-dependently inhibited the methyltransferase activity of PRMT1 in MV4-11 cells. ADMA, SDMA) and H4R3me2a levels were detected by western blotting. C. The negative compound 24b (DCPR049_4, shown in biochemical experiments) showed minimal inhibition effects toward MV4-11 cells at 12.5 µM and 6.25 µM compared to 28d and 31d. Results shown are mean ± SD of three replicates.


Page 26 of 71

Page 27 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MV4-11 cell growth in a time-dependent manner with a 12 day IC50 value of 0.81 µM and 1.08 µM respectively (Figure 6A and Figure S8A). Using Western blot, we confirmed these two compounds could alter the arginine methylation patterns in cellular levels. After treating MV4-11 cells for 48 hours, they could potently block the global levels of ADMA and concurrently increase the global levels of SDMA in a concentration-dependent manner (Figure 6B and Figure S8B). These effects were in line with the PRMT1 knockout results in MEF cells, which revealed the competitive pattern between the two arginine methylation types.25 In addition, we observed a dose-dependently decrease of H4R3me2a level. This result demonstrated the PRMT1 engagement effect of the compounds in cellular context since PRMT1 is the only known contributor modifying this site.46 Also, upon treatment with 28d, the expression levels of histone H3 arginine 2 asymmetric dimethylation (H3R2me2a) and histone H3 arginine 17 asymmetric dimethylation (H3R17me2a) decreased in a concentration-dependent way, indicating the inhibitory effect towards PRMT6 and CARM1 (PRMT4) respectively (Figure S9). We next chose a structurally similar but far less active compound 24b to rule out the possibility of the off-target effects of 28d and 31d. As expected, 24b exhibited low potency against MV4-11 cells, and correspondingly showed little effects on the arginine methylation patterns (Figure 6C and Figure S10), indicating minimal off-target effects of our compounds.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Induction of cell cycle arrest and cell apoptosis and blockage of leukemogenic genes expression

Figure 7. Treatment with 28d led to cell cycle arrest, apoptosis induction and leukemogenic gene regulation in MV4-11 cells. A, B. Treatment of 28d arrested MV4-11 cells at G1 phase at 72 h (A) and induced apoptosis at 96 h (B). C. Quantitative RT-PCR


Page 28 of 71

Page 29 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


analysis revealed 28d dose-dependently regulated the MLL-fusions target genes HOXA9, HOXA10, MEIS1 and MNDA. Data shown are mean ± SD of three replicates.

To illustrate the antiproliferation mechanism, we examined the effects of the two compounds on cell cycle and cell apoptosis through flow cytometric analysis. Results showed a concentration-dependent cell cycle arrest at G1 phase (Figure 7A and Figure S11A) and an increased apoptosis (Figure 7B and Figure S11B) upon treatment with our compounds for 72 hours and 96 hours respectively. These data supported the idea that these compounds were not only cell-cycle arrestors, but also inducers of apoptosis. Furthermore, we explored whether treatment with the two compounds could block expression of leukemogenic genes in MV4-11 cells which originates from acute monocytic leukemia and bears MLL-AF4 leukemic fusion gene. Overexpression of homeobox genes including homeobox A9 (HOXA9), homeobox A10 (HOXA10) and the HOX cofactor Meis homeobox 1 (MEIS1) has been considered as hallmarks of acute leukemia carrying MLL rearrangements.47 MEIS1 was reported to synergize with HOXA9 to facilitate transforming of myeloid progenitors and down-regulation of MEIS1 and HOXA genes reduced proliferation in MLL-rearranged acute leukemia.48, 49 By using quantitative real-time PCR analysis, we examined the effects of the two compounds on HOXA9, HOXA10 and MEIS1 mRNA levels.50 Treatment with the two compounds led to profound dose-dependent decreases of all three transcripts in MV4-11 cells (Figure 7C and Figure S11C). Meanwhile, the transcriptional level of myeloid cell nuclear



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

differentiation antigen (MNDA), a gene that serves as a differentiation marker of myeloid cells, was significantly upregulated.50-52 The upregulation of MNDA transcript levels also eliminated the possibilities of general inhibitory effect induced by the compounds. Notably, the effects of these two inhibitors on gene expression and growth inhibition in MV4-11 cells were consistent with that of MLL complex disruption,50 indicating the functional involvement of type I PRMTs in regulating MLL complex. Also we detected the negative compound 24b on cell cycle and cell apoptosis, as well as leukemogenic gene expression. As shown in Figure S12, 24b has no influence on cell cycle, apoptosis and leukemogenic gene at the same concentrations of 28d and 31d, ruling out the off-target possibilities of our compounds. Taken together, using of these compounds helps elucidating type I PRMTs as critical regulators in MLL-AF4 mediated leukemogenesis through modulating cell cycle, cell apoptosis and MLL associated gene expression. Therefore, pharmacological inhibition of type I PRMTs may serve as a promising therapeutic strategy for MLL-fusion leukemia.

DISCUSSION

Arginine methylation is a common post-translational modification in cells which is involved in various biological processes and multiple human diseases, particularly cancers. Therefore, PRMT inhibitors meet the pressing needs of both academic functional researches and industrial pharmaceutical development. Here in our study, through virtual


Page 30 of 71

Page 31 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


screening and chemical modifications, small-molecules 28d and 31d with extremely high potency have been identified. The selectivity data showed 28d targeted PRMT1, PRMT3, PRMT4, PRMT6 and PRMT8, revealing its role as a pan inhibitor targeting type I PRMTs. In cellular level, inhibition of type I PRMTs activities by the compounds reduced the proliferation of leukemia cells. In the most chemosensitive cell model (MV4-11 cell line), robust ablation of H4R3, H3R2, H3R17 and pan-substrate asymmetric dimethylation by the two compounds provided strong evidence of their ability to modulate the cellular methylation pattern. Moreover, treatment of the two compounds led to cell cycle arrest, apoptosis induction and leukemogenic gene regulation in MLL leukemia cells. The identification of these compounds could stand out as a landmark in biological mechanism studies driven by type I PRMTs-mediated substrate methylation in cancer and other diseases. Through applying these two compounds, we achieved a better understanding of type I PRMTs function in human malignant hematology. Loss of type I PRMTs activity through chemical inhibition inhibited the growth of various MLL leukemia cell lines, indicating the important roles of type I PRMTs in MLL leukemia. Also, the two compounds underlay the mechanism of type I PRMTs regulating MLL leukemia cells growth by cell cycle arrest, enhanced apoptosis and transcriptional changes in a set of key leukemogenic genes, such as HOXA9, HOXA10 and MEIS1. Notably, a recent study has elucidated the functional involvement of PRMT1 in mouse MLL leukemia in which PRMT1 cooperated with MLL-GAS7 fusion proteins, leading to



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 32 of 71

transcription deregulation and leukemogenic transformation.12 Given that the effects intervened by our compounds were comparable to those shown in other MLL studies, the two compounds could act as valuable lead compounds to further study the pathobiology of type I PRMTs mediated oncogenesis. Nowadays, epigenetic machinery and molecular interplay networks have received growing concerns. It is notable that multiple biological researches on genetic function and phenotype analyses are based on RNA interference technologies. However, this system suffers from the off-target effects and the disability in study protein complex. It thus seems urgent to explore the complicated epigenetic regulation processes by using potent, selective small molecular inhibitors of specific epigenetic enzymes. Indeed, a number of specific inhibitors have been reported. For example, a potent and selective DOT1

like

histone

lysine

methyltransferase

(DOT1L)

inhibitor

1-(3-((((2S,3S,4R,5R)-5-(4-amino-7H-pyrrolo[2,3-d]pyrimidin-7-yl)-3,4-dihydroxytetrah ydrofuran-2-yl)methyl)(isopropyl)amino)propyl)-3-(4-(tert-butyl)phenyl)urea

(10,

EPZ004777) has been identified to elucidate the causal role of DOT1L enzymatic activity in MLL-rearranged leukemia.53 Therefore, the discovery of potent, cell-active PRMTs inhibitors will benefit investigation into the transcriptional regulation and epigenetic mechanism studies of PRMTs mediated substrate methylation. Apart from the role of being efficient inhibitors to study PRMTs biology, these two inhibitors are valuable lead compounds that can address the potential therapeutic benefit of inhibiting PRMTs and might result in the development of therapeutically useful drugs


Page 33 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for patients. Nowadays, abundant reports implicating PRMTs oncogenic function in cancers indicate that type I PRMT inhibitors may be useful in various tumor targeted therapy, embracing a wide scope of clinical applications. In our study, these compounds help disclosing the oncogenic role of type I PRMTs in human MLL leukemia, thus providing the foundations of future therapeutic strategies in this notorious disease. With high potency and selectivity towards type I PRMTs, these compounds may pave the way for potential drug candidates for patients suffered from MLL leukemia. However, the pharmacokinetics properties as well as the toxicity of the two compounds should be further examined in vivo to assess their role of being drug candidates. Besides, extensive examination in other cellular and animal models need to be conducted for exploration of the inhibitory activity and specificity of the two compounds. Further optimization of the drug-like properties of these compounds holds great promise for this eventual outcome. Finally, it is worth noting that application of these two compounds revealed the competitive mode between the asymmetric and symmetric arginine dimethylation types, which is consistent with the effects shown in PRMT1 knockout cells.25 The symmetric dimethylation of arginine residues is predominantly catalyzed by PRMT5 which belongs to type II PRMTs.54 PRMT5 as well as the asymmetric methyl mark of its substrates has been reported to play crucial roles in driving oncogenesis, thus making PRMT5 a potential antitumor target.55 Recently, a selective and highly potent PRMT5 inhibitor has been evaluated in mantle cell lymphoma (MCL).56 Given the competitive methylation mode observed in PRMT1-null cells, we hypothesize inhibitors targeting for PRMT5 may



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

cause an opposite arginine methylation pattern compared to treatment with type I PRMT inhibitors. Thus, treatment of both type I and type II PRMT compounds may enhance the efficiency in killing cancer cells since both of the dimethylation levels of arginine-containing substrates are reduced. This may guide a combined approach for using both of the inhibitors to either study the biology of PRMT family or improve the pharmacological effects on treating cancer.

CONCLUSION

In summary, we identified two highly potent type I PRMT inhibitors. With these compounds, the leukemogenic role of type I PRMTs in MLL leukemia was disclosed. We believe 28d and 31d are powerful inhibitors that could be used to further study the biological roles of type I PRMTs and potentially help providing therapeutic strategies across broad cancer indications.

EXPERIMENTAL SECTION

Virtual screening

hPRMT1 modeling and protein preparation. The 3D structure of hPRMT1 structure hasn't been determined to date, while many homologous structures with high sequence identity have been reported. Since there is only one residue distinct between the amino


Page 34 of 71

Page 35 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


acid sequences of human and rat PMRT1 (Figure S1), we mutated H161 in rPMRT1 (PDB ID: 1OR8) to tyrosine to obtain the initial hPRMT1 model. However, the N-terminal helix αX, which is essential for enzymatic activity of PRMT1,29 is disordered in X-ray structures of rPMRT1. Considering the complete helical structure of αX, we chose the crystal structure of human PRMT6 (PDB ID: 4Y30),35 which shares 36% sequence identity with hPRMT1, as a template to generated a homology model for the active form of hPRMT1 with N-terminal αX. The sequence alignment of the hPRMT1, rPRMT1 and hPMRT6 was performed with the ClustalW.57 The homology model of the hPRMT1 was built by MODELER 9.11 software.58 The protein status was optimized through the Protein Preparation Wizard Workflow provided in the Maestro,41 with a pH of 7.0 ± 2.0. Other parameters were set as the default. Residues within a distance of 6 Å around the substrate arginine which extracted from the crystal structure of rPMRT1, were defined as binding pocket. Ligand database preparation. The Specs database (http://www.specs.net), which contains ~287,000 compounds, was used for the virtual screening. To refined the database, we filtered it by Lipinski’s rule of five37 and removed pan-assay interference compounds (PAINS)38-40 with Pipeline Pilot, version 7.5 (Pipeline Pilot; Accelrys Software Inc., San Diego, CA), yielding a database of 182,014 small-molecule compounds. The remaining molecules were treated by LigPrep59 integrated in Maestro 9.241 to generate all stereo isomers and different protonation states with Epik.60



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Virtual screening procedure. The virtual screening protocol was shown in Figure 1. Firstly, the program DOCK4.061 was applied to dock the compound library into the defined binding site. The top-ranked 10500 candidates selected by DOCK4.0 were subsequently evaluated by Glide SP mode and Glide XP mode, leading to a list of 600 compounds. In order to ensure diversity in the candidates, the remaining compounds from Glide were classified to 100 groups by SciTegic functional class fingerprints (FCFP_4) in Pipeline Pilot, version 7.5 (Pipeline Pilot; Accelrys Software Inc., San Diego, CA), and 1-2 compounds were picked from each group. Finally, 107 compounds were selected and purchased for biological testing.

Protein expression and purification

The rPRMT1 (11~353) was cloned into a vector pET28a with an N-terminal hexahistidine (His6x) tag. The fusion protein was expressed in Escherichia coli BL21 (DE3) cells cultured at 37℃ for 4~6 h and inducted at 16℃ in the presence of 0.4 mM IPTG. Cells were harvested 15 h postinduction and lysed by sonication in lysis buffer containing 20 mM Hepes (pH 8.0), 250 mM NaCl, 10 mM imidazole, 0.1% β-mercaptoethanol. The supernatant was firstly loaded onto a 5 mL HisTrap HP column (GE Healthcare). The column was washed with washing buffer (20 mM HEPES (pH 8.0), 250 mM NaCl, 120 mM imidazole, 0.1% β-mercaptoethanol) and subsequently eluted with elution buffer (20 mM HEPES (pH 8.0), 250 mM NaCl, 350 mM imidazole, 0.1%


Page 36 of 71

Page 37 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


β-mercaptoethanol). The eluted protein was purified further by Superdex200 column (GE Healthcare) in the buffer consisting 20 mM HEPES (pH 8.0), 250 mM NaCl, 1 mM DTT. The proteins were concentrated to 2 mg/mL and flash-frozen in liquid nitrogen for storage.

Radioactive methylation assay

The enzyme activity was measured in ShangHai Chempartner Co.Ltd through radioisotope assay. The enzyme, substrate and [3H]-SAM solution were prepared in 1x assay buffer (modified Tris Buffer) and compounds were added to assay plate by Echo. Then, 15 µL of enzyme solution was transferred into assay plate and incubated at room temperature for 15 min. Afterwards, 5 µL of substrate solution and 5 µL of [3H]-SAM solution were added to start reaction. After 60 min incubation at room temperature, reaction was stopped by the addition of 5 µL cold stop solution. Subsequently, 25 µL of the mix solution per well was transferred to Flashplate from assay plate. Finally, the plate was incubated at room temperature for 60 min and washed with ddH2O (with 0.1% Tween-20) three times before reading on Microbeta. The data was analyzed in GraphPad Prism 5.0 to obtain IC50 values.

Selectivity Assay



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

The selectivity of 28d were determined at two concentrations of 50 µM and 100 µM against 15 different kinds of methyltransferases as described previously62-65. The selectivity against PRMT family of enzymes including PRMT3, CARM1(PRMT4), PRMT5, PRMT6 and PRMT8 and a panel of histone lysine methyltransferases including G9a, MLL1, PRDM9, SMYD2, SUV39H1 were assessed using the AlphaLISA assay. Briefly, in AlphaLISA assay, first both enzyme and substrate solution were prepared in 1x assay buffer, while compounds were transferred to assay plate by Echo in a final concentration of 1% DMSO. Next, 5 µL of enzyme solution was transferred to assay plate and incubated at room temperature for 15 min. Then 5 µL of substrate solution was added to each well to start reaction. After incubation at room temperature for 60 min (For SMYD2, incubate for 240 min), 15 µL beads mix solution was added to assay plate and incubated at room temperature for 60 min with subdued light. The signal was collected with EnSpire and analyzed in Graphpad Prism 5.0. The selectivity against EZH2, GCN5, DNMT1 and DNMT3A/3L methyltransferases were assessed using the radioisotope assay. The selectivity against DOT1L was determined through Alpha Screen assay. In Alpha Screen assay, both enzyme (acceptor) and substrate (donor) beads were prepared in 1x assay buffer, while compounds were transferred to assay plate by Echo in a final concentration of 1% DMSO. Subsequently, 5 µL of enzyme solution was transferred to assay plate and incubated at room temperature for 15 min. Then 5 µL of substrate solution was added to each well to start reaction. After incubation at room temperature


Page 38 of 71

Page 39 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


for 60 min, 15 µL acceptor and donor mixed solution was added to assay plate and incubated at room temperature and subdued light for 60 min. The signal was collected with EnSpire and analyzed in Graphpad Prism 5.0.

NMR experiment

NMR assays were conducted with 5 µM PRMT1 in phosphate buffer (20 mM NaH2PO4, 20 mM Na2HPO4, 100 mM NaCl, pH 7.4), dissolved in D2O including CPMG and STD experiments. Compounds were dissolved in 5% DMSO-d6 to concentration of 200 µM. 600 MHz (proton frequency) Bruker Avance Ⅲ spectrometer with a cryogenically cooled probe (Bruker biospin, Germany) applied in all NMR experiments performed at 25℃. Through the pulse sequence [RD-90°-(τ-180°-τ)n-ACQ], the solvent-suppressed 1D 1H CPMG (cpmgPr1d) was collected. In order to suppress water resonance, a 54.78 dB pulse during the recycle delay (RD) of 4 s was used by presaturation. We adjusted the 90° pulse length to around 11.82 µs. Finally, 4 dummy scans and 64 free induction decays (FIDs) were collected into 64K acquisition points, containing a spectral width of 12 KHz (20 ppm) and giving an acquisition time (ACQ) of 2.73 s. The STD experiment took totally 20 min in acquisition time with 128 scans, including the acquisition time of 1.71 s, 4 dummy scans, relaxation delay of 3 s and a 40 dB pulse with the irradiation frequency at 0.25 ppm or -1000 ppm alternatively.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 40 of 71

Chemistry

Commercially available chemicals were used without further purification. All products were characterized by their NMR and MS spectra. 1H NMR and

13

C NMR spectra were

obtained on Bruker Avance 400 or 500 instruments at 400/100 MHz or 500/125 MHz, respectively. Chemical shifts were reported in parts per million (ppm, δ) downfield from tetramethylsilane (TMS) as the internal standard. Proton coupling patterns were described as broad (b), singlet (s), doublet (d), triplet (t), quartet (q), multiplet (m). Low-resolution mass spectra (LRMS) was measured using a Finnigan LCQ/DECA spectrometer (ESI). High-resolution mass spectra (HRMS) was measured using a Bruker Micromass Q-Tof II spectrometer (ESI). Melting points (uncorrected) was determined using a SGWX-4B micro melting point apparatus. Yields were not optimized.

Synthesis of compounds

The synthesis of the compound 13a derivatives depicted in Scheme 1 were performed following a five-step reaction pathway. Coupling of commercially available 2-mercaptobenzoic acid with acyl halides yielded compounds 21a-21d according to the known literature,66 and successively reacted with oxalyl dichloride in the presence of DMF to give the aroyl chloride, the resultant 22a-22d were then reacted with N1,N1-dimethylethane-1,2-diamine to generate the target 23a-23d analogues by amidation reaction under standard conditions with good yield. Sodium tetrahydroborate,


Page 41 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


boron trifluoride diethyl etherate was used to reduce 23a-23d analogues to obtain the target 24a-24d analogues in tetrahydrofuran. Methylating of the compounds 24b-24d analogues with formic acid gave target 25b-25d analogues. Further, the synthesis of compound 28d was commenced with aroyl chloride (22d), which reacted with commercially available tert-butyl (2-(methylamino)ethyl)carbamate to the intermediates 26d by amidation reaction, and then sodium tetrahydroborate, boron trifluoride diethyl etherate was used to reduce 26d to obtain the intermediates 27d in tetrahydrofuran. Compound 28d was got by taking off protecting groups from compound 27d. Finally, the N1-(2-((2-chlorophenyl)thio)benzyl)-N1,N2-dimethylethane-1,2-diamine

(31d)

was

commenced with the intermediates 26d, and then methylating of the compounds 26d with iodomethane gave the intermediates 29d. Compound 31d was constructed by taking off protecting groups of amine of 30d, which was obtained by reducing 29d. The purity of the synthesized 20 derivatives was determined to be greater than 95% by HPLC analysis [HPLC: column, Poroshell 120 EC-C18, 4.630 mm, 2.7 µm or SunFire C18, 4.650 mm, 3.5 µm; mobile phase, (A: water with 0.01% TFA and B: ACN with 0.01% TFA); gradient, 5% to 95% B in 1.2 min; flow rate, 2.2 or 2.0 mL/min; UV detection, (214, 4 nm); oven temperature, 50℃. Agilent 1200, Agilent Technologies, California, USA]. In particular, a mixture of 1-bromo-2-chlorobenzene (26.45 mmol), 2-mercaptobenzoic acid (26.45 mmol), K2CO3 (52.9 mmol) and Cu (13.22 mmol) in DMF (50 mL) was stirred at 120℃ overnight. Then the mixture was diluted with 500 ml water, the solution was filtered and the filtrate was acidified with hydrochloric acid. The precipitated product



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

was filtered, washed with water and crystallized for 100 mL 70% aq. ethanol to give the product 21d (yield, 78%). To a solution of 21d (20.4 mmol) in toluene (50 mL) was added SOCl2 (61.19 mmol) at RT. Then the mixture was stirred at 100℃ for 2 h. The mixture was cooled to RT. and concentrated and the residue (22d) was used for next step without further purification. A solution of N1,N1-dimethylethane-1,2-diamine (3.6 g, 40.8 mmol) in toluene (15 mL) was stirred and treated under external cooling(10-20℃) over 10 min with a solution of 22d and the mixture was stirred for 4 h at RT. Then the mixture was diluted with EA, washed with brine, dried over Na2SO4 and concentrated. The residue was recrystallized for PE and EA to give the product 23d (55% yield of two steps). To a mixture of 23d (11.05 mmol) and NaBH4 (22.10 mmol) in THF (50 mL) was added (C2H5)2O·BF3 (3.1 g, 22.10 mmol) in drops at RT. under N2 atmosphere. The mixture was stirred at for 1 h, and then heated to reflux for 3 h. After cooling, the mixture was basified with 50 mL 20% NaOH aq. and extracted with EA. Combined with organic layers were washed with brine, dried over Na2SO4 and concentrated to give the product 24d (yield, 61%). A mixture of compound 24d (6.56 mmol), 10 mL formic acid and 2 mL 36% aq. formaldehyde was stirred and heated to 100℃ for 3h. After cooling the mixture was acidified with 2 ml HCl, washed with ether, the aq. layer was basified with NH4OH and extracted with ether. Combined organic layers were washed with brine, dried over Na2SO4 and concentrated to give the product 25d (yield, 54%). A solution of tert-butyl 2-(methylamino)ethylcarbamate (30.6 mmol) in toluene was stirred and treated


Page 42 of 71

Page 43 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


under external cooling (10~20℃) over 10 min with a solution of 22d and the mixture was stirred for 4 h at RT. Then the mixture was diluted with EA, washed with brine, dried over Na2SO4 and concentrated. The residue was recrystallized for PE and EA to give the product 26d (yield of two steps, 60%). To a mixture of compound 26d (10.0 mmol) and NaBH4 (20.0 mmol) in THF (50 mL) was added (C2H5)2O·BF3 (20.0 mmol) in drops at RT under N2 atmosphere. The mixture was stirred at for 1 h and then heated to reflux for 3 h. After cooling, HCl was added and the mixture was refluxed for 3 h. After cooling, the mixture was basified with 20% NaOH aqueous and extracted with EA. Combined with organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue (27d) was used for next step without further purification. A mixture of compound 27d (5.0 mmol) in HCl/dioxane (3.0 M) was stirred at RT for 16 h. The mixture was concentrated and the residue was purified by Pre-HPLC to give the 28d (yield of two steps, 26%). To a solution of compound 26d (10.0 mmol) in THF was added NaH (30.0 mmol) in portions at 0℃, the mixture was stirred at RT for 30 min and MeI (15.0 mmol) was added. The reaction mixture was stirred at RT for 16 h. The mixture was quenched by water and extracted with EA. Combined organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue was purified by combi-flash to give the product 29d (yield, 78%). To a mixture of compound 29d (5.0 mmol) and NaBH4 (10.0 mmol) in THF (50 mL) was added (C2H5)2O·BF3 (10.0 mmol) in drops at RT under N2 atmosphere. The mixture was stirred at for 1 h and then heated to reflux for 3 h. After cooling, HCl was added and the mixture was refluxed for 3 h. After cooling, the mixture



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

was basified with 20% NaOH aqueous and extracted with EA. Combined with organic layers were washed with brine, dried over Na2SO4 and concentrated. The residue (30d) was used for next step without further purification. A mixture of compound 30d (3.0 mmol) in HCl/dioxane (3.0 M) was stirred at RT for 16 h. The mixture was concentrated and the residue was purified by Pre-HPLC to give the 31d (yield of two steps, 23%).

Compounds had the following characteristics:

2-(Naphthalen-1-ylthio)benzoic acid (21a). 21a was prepared from 2-mercaptobenzoic acid following the general procedure indicated above. Yield, 76%; 1H NMR (500 MHz, DMSO-d6) δ 13.30 (s, 1H), 8.16 – 7.93 (m, 5H), 7.66 – 7.54 (m, 3H), 7.19 – 7.14 (m, 2H), 6.38 (d, J = 6.5 Hz, 1H); LRMS (ESI) m/z Calcd for C17H13O2S [M+H]+, 281.1; Found, 281.1; Purity: 99.0%. 2-(Phenylthio)benzoic acid (21b). 21b was prepared from 2-mercaptobenzoic acid following the general procedure indicated above. Yield, 80%; 1H NMR (500 MHz, DMSO-d6) δ 13.21 (s, 1H), 7.91 (d, J = 7.0 Hz, 1H), 7.55 – 7.50 (m, 5H), 7.38 – 7.35 (m, 1H), 7.21 (t, J = 7.0 Hz, 1H), 6.73 (d, J = 8.0 Hz, 1H); LRMS (ESI) m/z Calcd for C13H10NaO2S [M+Na]+, 253.0; Found, 253.1; Purity: 100.0%.

2-((2-Fluorophenyl)thio)benzoic acid (21c). 21c was prepared from 2-mercaptobenzoic acid following the general procedure indicated above.


Page 44 of 71

Page 45 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Yield, 81%; 1H NMR (500 MHz, DMSO-d6) δ 13.32 (s, 1H), 7.96 (d, J = 7.0 Hz, 1H), 7.66 – 7.59 (m, 2H), 7.43 – 7.34 (m, 3H), 7.24 (t, J = 7.0 Hz, 1H), 6.67 (d, J = 8.0 Hz, 1H); LRMS (ESI) m/z Calcd for C13H10FO2S [M+H]+, 249.0; Found, 249.1; Purity: 98.6%.

2-((2-Chlorophenyl)thio)benzoic acid (21d). 21d was prepared from 2-mercaptobenzoic acid following the general procedure indicated above. Yield, 78%; 1H NMR (500 MHz, DMSO-d6) δ 13.30 (s, 1H), 7.95 (d, J = 7.5 Hz, 1H), 7.69 – 7.65 (m, 2H), 7.55 – 7.38 (m, 3H), 7.26 (t, J = 7.5 Hz, 1H), 6.64 (d, J = 8.5 Hz, 1H); LRMS (ESI) m/z Calcd for C13H9ClNaO2S [M+Na]+, 287.0; Found, 287.0; Purity: 96.0%.

N-(2-(dimethylamino)ethyl)-2-(naphthalen-1-ylthio)benzamide

(23a).

23a

was

prepared from 22a and N1,N1-dimethylethane-1,2-diamine following the general procedure indicated above. Yield of two steps, 60%; mp 103-104℃; 1H NMR (400 MHz, DMSO-d6) δ 8.48 (t, J = 5.5 Hz, 1H), 8.18 (d, J = 8.0 Hz, 1H), 8.07 (d, J = 8.2 Hz, 1H), 8.05 – 8.00 (m, 1H), 7.82 (d, J = 6.9 Hz, 1H), 7.65 – 7.46 (m, 4H), 7.15 (ddd, J = 13.7, 10.7, 6.5 Hz, 2H), 6.56 (d, J = 7.6 Hz, 1H), 2.54 – 2.45 (m, 4H), 2.24 (s, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.34, 136.39, 135.26, 134.57, 134.01, 133.31, 130.14, 130.13, 129.76, 128.82, 127.83, 127.81, 127.31, 126.60, 126.23, 125.21, 125.09, 57.87, 45.08(2C), 37.21. LRMS (ESI)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 46 of 71

m/z Calcd for C21H23N2OS [M+H]+, 351.2; Found, 351.2; HRMS (ESI) m/z Calcd for C21H23N2OS [M+H]+, 351.1526; Found, 351.1531; Purity: 99.2%. N-(2-(dimethylamino)ethyl)-2-(phenylthio)benzamide (23b). 23b was prepared from 22b and N1,N1-dimethylethane-1,2-diamine following the general procedure indicated above. Yield of two steps, 65%; mp 70-71℃; 1H NMR (400 MHz, DMSO-d6) δ 8.31 (t, J = 4.8 Hz, 1H), 7.51 – 7.22 (m, 8H), 6.99 (d, J = 7.6 Hz, 1H), 3.32 (dd, J = 12.8, 6.5 Hz, 2H), 2.39 (t, J = 6.9 Hz, 2H), 2.18 (s, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.28, 137.09, 135.35, 134.23, 132.73(2C), 130.15, 129.80, 129.60(2C), 128.03, 127.78, 126.04, 57.96, 45.21(2C), 37.33. LRMS (ESI) m/z Calcd for C17H21N2OS [M+H]+, 301.1; Found, 301.1; HRMS (ESI) m/z Calcd for C17H21N2OS [M+H]+, 301.1369; Found, 301.1382; Purity: 100.0%.

N-(2-(dimethylamino)ethyl)-2-((2-fluorophenyl)thio)benzamide

(23c).

23c

was

prepared from 22c and N1,N1-dimethylethane-1,2-diamine following the general procedure indicated above. Yield of three steps, 48%; mp 225-227℃; 1H NMR (400 MHz, DMSO-d6) δ 8.40 (s, 1H), 7.63 – 7.41 (m, 3H), 7.41 – 7.20 (m, 4H), 6.86 (d, J = 7.8 Hz, 1H), 3.35 – 3.23 (m, 2H), 2.40 (t, J = 6.3 Hz, 2H), 2.19 (s, 6H). 13C NMR (100 MHz, DMSO-d6) δ 167.03, 161.52 (d, J = 245.7 Hz), 135.89, 135.57, 134.83, 131.32 (d, J = 8.0 Hz), 130.46, 128.23, 127.98,


Page 47 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


125.81, 125.60 (d, J = 3.7 Hz), 120.48 (d, J = 18.2 Hz), 116.27 (d, J = 22.4 Hz), 57.96, 45.21(2C), 37.34. LRMS (ESI) m/z Calcd for C17H20FN2OS [M+H]+, 319.1; Found, 319.1; HRMS (ESI) m/z Calcd for C17H20FN2OS [M+H]+, 319.1275; Found, 319.1284; Purity: 100.0%.

2-((2-Chlorophenyl)thio)-N-(2-(dimethylamino)ethyl)benzamide

(23d).

23d

was

prepared from 22d and N1,N1-dimethylethane-1,2-diamine following the general procedure indicated above. Yield of two steps, 55%; mp 135-137℃; 1H NMR (400 MHz, DMSO-d6) δ 11.01 (b, 1H), 8.96 (t, J = 5.4 Hz, 1H), 7.90 – 7.76 (m, 1H), 7.59 (d, J = 7.6 Hz, 1H), 7.47 – 7.28 (m, 5H), 6.95 (d, J = 7.5 Hz, 1H), 3.67 (dd, J = 11.6, 5.8 Hz, 2H), 3.28 (t, J = 6.0 Hz, 2H), 2.83 (s, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.50, 136.05, 135.34, 134.35, 133.87, 133.48, 130.87, 130.12, 129.95, 129.77, 128.55, 128.22, 126.59, 55.46, 42.19(2C), 34.43; LRMS (ESI) m/z Calcd for C17H20ClN2OS [M+H]+, 335.1; Found, 334.9; HRMS (ESI) m/z Calcd for C17H20ClN2OS [M+H]+,335.0979; Found, 335.0993; Purity: 96.0%. N1,N1-dimethyl-N2-(2-(naphthalen-1-ylthio)benzyl)ethane-1,2-diamine (24a). 24a was prepared from 23a following the general procedure indicated above and made into hydrochloride. Yield, 60%; mp 107-108℃; 1H NMR (400 MHz, DMSO-d6) δ 11.08 (b, 1H), 10.12 (b, 2H), 8.32 – 8.20 (m, 1H), 8.03 (dd, J = 7.8, 4.8 Hz, 1H), 7.99 (d, J = 8.2 Hz, 1H), 7.87 (d,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 48 of 71

J = 7.5 Hz, 1H), 7.70 – 7.58 (m, 2H), 7.52 (t, J = 7.7 Hz, 1H), 7.41 (dd, J = 12.6, 7.2 Hz, 2H), 7.31 (t, J = 7.5 Hz, 1H), 7.01 (d, J = 7.8 Hz, 1H), 4.45 (s, 2H), 3.57 (s, 4H), 2.85 (s, 6H). 13C NMR (100 MHz, DMSO-d6) δ 134.54, 133.82, 132.08, 131.99, 131.30, 130.62, 130.38(2C), 129.98, 128.90, 128.82, 127.67, 127.35, 126.80, 126.26, 124.42, 52.46, 47.81, 42.39(2C), 41.85. LRMS (ESI) m/z Calcd for C21H25N2S [M-HCl2]+, 337.2; Found, 337.2; HRMS (ESI) m/z Calcd for C21H25N2S [M-HCl2]+, 337.1733; Found, 337.1725; Purity: 100.0%. N1,N1-dimethyl-N2-(2-(phenylthio)benzyl)ethane-1,2-diamine (24b). 24b was prepared from 23b following the general procedure indicated above. Yield, 65.3%; mp 221-222℃; 1H NMR (400 MHz, DMSO-d6) δ 11.14 (b, 1H), 10.23 (b, 2H), 7.90 (d, J = 6.9 Hz, 1H), 7.58 – 7.13 (m, 8H), 4.35 (s, 2H), 3.74 – 3.49 (m, 4H), 2.83 (s, 6H);

13

C NMR (100 MHz, DMSO-d6) δ 135.18, 134.10, 133.74, 133.69, 130.64,

130.10, 129.60(2C), 129.50(2C), 128.77, 127.08, 52.27, 47.92, 42.33(2C), 41.63; LRMS (ESI) m/z Calcd for C17H23N2S [M-HCl2]+, 287.2; Found, 287.2; HRMS (ESI) m/z Calcd for C17H23N2S [M-HCl2]+, 287.1576; Found, 287.1580; Purity: 96.6%. N1-(2-((2-fluorophenyl)thio)benzyl)-N2,N2-dimethylethane-1,2-diamine

(24c).

24c

was prepared from 23c following the general procedure indicated above. Yield, 63%; mp 200-201℃; 1H NMR (400 MHz, DMSO-d6) δ 11.06 (b, 1H), 10.09 (b, 2H), 7.88 (d, J = 7.5 Hz, 1H), 7.51 (t, J = 7.2 Hz, 1H), 7.45 (t, J = 7.5 Hz, 1H), 7.42 –


Page 49 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


7.28 (m, 3H), 7.19 (t, J = 7.5 Hz, 1H), 7.09 (t, J = 7.7 Hz, 1H), 4.39 (s, 2H), 3.53 (s, 4H), 2.83 (s, 6H). 13C NMR (100 MHz, DMSO-d6) δ 159.82 (d, J = 244.2 Hz), 133.93, 133.86, 132.19, 131.79, 130.72, 130.29, 129.74 (d, J = 7.8 Hz), 129.02, 125.63 (d, J = 3.5 Hz), 122.02 (d, J = 17.3 Hz), 116.06 (d, J = 21.6 Hz), 52.39, 47.94, 42.36(2C), 41.71; LRMS (ESI) m/z Calcd for C17H22FN2S [M-HCl2]+, 305.2; Found, 305.2; HRMS (ESI) m/z Calcd for C17H22FN2S [M-HCl2]+, 305.1482; Found, 305.1482; Purity: 100.0%. N1-(2-((2-chlorophenyl)thio)benzyl)-N2,N2-dimethylethane-1,2-diamine (24d). 24d was prepared from 23d following the general procedure indicated above. Yield, 61%; mp 228-229℃; 1H NMR (400 MHz, DMSO-d6) δ 11.07 (b, 1H), 10.14 (b, 2H), 7.91 (d, J = 6.9 Hz, 1H), 7.66 – 7.38 (m, 4H), 7.28 – 7.09 (m, 2H), 6.78 – 6.56 (m, 1H), 4.27 (s, 2H), 3.64 – 3.41 (m, 4H), 2.77 (s, 3H), 2.76 (s, 3H); 13C NMR (100 MHz, DMSO-d6) δ 135.74, 135.38, 135.20, 131.26, 131.02, 130.91, 130.52, 129.98, 129.84, 128.80, 128.21, 127.83, 52.31, 47.95, 42.33(2C), 41.64; LRMS (ESI) m/z Calcd for C17H22ClN2S [M-HCl2]+, 321.1; Found, 320.9; HRMS (ESI) m/z Calcd for C17H22ClN2S [M-HCl2]+, 321.1187; Found, 321.1183; Purity: 100.0%. N1,N1,N2-trimethyl-N2-(2-(phenylthio)benzyl)ethane-1,2-diamine (25b).

25b

was

prepared from 24b following the general procedure indicated above. Yield, 61%; mp 202-203℃; 1H NMR (400 MHz, DMSO-d6) δ 11.44 (b, 2H), 8.03 (d, J = 4.5 Hz, 1H), 7.56 – 7.16 (m, 8H), 4.89 – 4.35 (m, 2H), 3.72 (s, 4H), 2.84 (s, 6H), 2.73 (s,



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

3H);

13

Page 50 of 71

C NMR (125 MHz, MeOD) δ 136.55, 134.61, 134.39, 132.93, 131.37, 130.50,

129.87(2C), 129.44(2C), 128.94, 127.33, 57.89, 51.19, 50.51, 42.62(2C), 39.27; LRMS (ESI) m/z Calcd for C18H25N2S [M-HCl2]+, 301.2; Found, 301.2; HRMS (ESI) m/z Calcd for C18H25N2S [M-HCl2]+, 301.1733; Found, 301.1713; Purity: 100.0%. N1-(2-((2-fluorophenyl)thio)benzyl)-N1,N2,N2-trimethylethane-1,2-diamine (25c). 25c was prepared from 24c following the general procedure indicated above. Yield, 58%; mp 203-205℃; 1H NMR (400 MHz, DMSO-d6) δ 11.56 (b, 1H), 11.37 (b, 1H), 8.02 (s, 1H), 7.55 – 7.29 (m, 5H), 7.24 – 7.12 (m, 2H), 4.85 – 4.41 (m, 2H), 3.93 – 3.56 (m, 4H), 2.82 (s, 6H), 2.73 (s, 3H). 13C NMR (100 MHz, DMSO-d6) δ 160.01 (d, J = 244.6 Hz), 134.23, 133.39, 132.85, 132.42, 130.93, 130.16, 130.08, 128.81, 125.68 (d, J = 3.5 Hz), 121.61 (d, J = 17.4 Hz), 116.17 (d, J = 21.7 Hz), 56.29, 50.27, 49.71, 42.32, 42.16, 42.05. LRMS (ESI) m/z Calcd for C18H24FN2S [M-HCl2]+, 319.2; Found, 319.2; HRMS (ESI) m/z Calcd for C18H24FN2S [M-HCl2]+, 319.1639; Found, 319.1634; Purity: 98.7%. N1-(2-((2-chlorophenyl)thio)benzyl)-N1,N2,N2-trimethylethane-1,2-diamine

(25d).

25d was prepared from 24d following the general procedure indicated above. Yield,54%; mp 198-199℃; 1H NMR (400 MHz, DMSO-d6) δ 11.51 (b, 1H), 11.30 (b, 1H), 8.10 (s, 1H), 7.69 – 7.39 (m, 4H), 7.39 – 7.18 (m, 2H), 6.78 (d, J = 5.5 Hz, 1H), 4.67 (s, 1H), 4.49 (s, 1H), 3.67 (s, 4H), 2.82 (s, 6H), 2.72 (s, 3H); 13C NMR (125 MHz,


Page 51 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


MeOD) δ 135.78, 134.62, 134.08, 133.23, 132.71, 131.79, 131.76, 130.02, 129.88, 129.64, 128.13, 127.79, 57.92, 51.23, 50.58, 42.63(2C), 39.30. LRMS (ESI) m/z Calcd for C18H24ClN2S [M-HCl2]+, 335.1; Found, 335.1; HRMS (ESI) m/z Calcd for C18H24ClN2S [M-HCl2]+, 335.1343; Found, 335.1346; Purity: 100.0%. Tert-butyl (2-(2-((2-chlorophenyl)thio)-N-methylbenzamido)ethyl)carbamate (26d). 26d was prepared from 22d following the general procedure indicated above. Yield of two steps, 60%; 1H NMR (500 MHz, DMSO-d6) δ 7.54 – 7.26 (m, 7H), 7.10 – 6.90 (m, 2H), 3.45 – 3.40 (m, 1H), 3.18 – 3.14 (m, 1H), 3.07 – 3.02 (m, 2H), 2.85 (s, 3H), 1.37 (s, 9H); LRMS (ESI) m/z Calcd for C16H18ClN2OS [M – C5H7O2]+, 321.1; Found, 321.1; Purity: 100.0%. N1-(2-((2-chlorophenyl)thio)benzyl)-N1-methylethane-1,2-diamine (28d). 28d was prepared from 27d following the general procedure indicated above. Yield of two steps, 26%; mp 170-171℃; 1H NMR (400 MHz, MeOD) δ 7.86 – 7.79 (m, 1H), 7.61 – 7.45 (m, 4H), 7.25 (td, J = 7.6, 1.8 Hz, 1H), 7.20 (td, J = 7.6, 1.6 Hz, 1H), 6.85 (dd, J = 7.7, 1.7 Hz, 1H), 4.48 (s, 2H), 3.55 – 3.38 (m, 4H), 2.85 (s, 3H); 13C NMR (125 MHz, MeOD) δ 135.40(2C), 134.68, 134.02, 132.94, 132.79, 131.24, 129.93, 129.84, 129.74, 128.12, 127.69, 58.22, 52.63, 39.68, 34.42; LRMS (ESI) m/z Calcd for C16H20ClN2S [M-HCl2]+, 307.1; Found, 307.1; HRMS (ESI) m/z Calcd for C16H20ClN2S [M-HCl2]+, 307.1030; Found, 307.1025; Purity: 99.1%.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 52 of 71

Tert-butyl (2-(2-((2-chlorophenyl)thio)-N-methylbenzamido)ethyl)(methyl)carbamate

(29d).

29d was prepared from 26d following the general procedure indicated above. Yield, 65%; 1H NMR (500 MHz, DMSO-d6) δ 7.55 – 7.53 (m, 1H), 7.44 – 7.43 (m, 2H), 7.32 – 7.27 (m, 4H), 7.13 (s, 1H), 3.59 – 3.57 (m, 1H), 3.42 – 3.35 (m, 1H), 3.20 – 3.18 (m, 1H), 2.97 – 2.84 (m, 1H), 2.87 (s, 3H), 1.99 (s, 3H), 1.40 (s, 6H), 1.30 (s, 3H); LRMS (ESI) m/z Calcd for C17H20ClN2OS [M – C5H7O2]+, 335.1; Found, 335.1; Purity: 91.6%. N1-(2-((2-chlorophenyl)thio)benzyl)-N1,N2-dimethylethane-1,2-diamine (31d). 31d (31d) was prepared from 30d following the general procedure indicated above. Yield of two steps, 23%; mp 210-211℃; 1H NMR (400 MHz, MeOD-d4) δ 7.97 – 7.90 (m, 1H), 7.66 – 7.53 (m, 3H), 7.49 (dd, J = 7.7, 1.6 Hz, 1H), 7.26 (td, J = 7.6, 1.8 Hz, 1H), 7.21 (td, J = 7.6, 1.6 Hz, 1H), 6.83 (dd, J = 7.7, 1.7 Hz, 1H), 4.62 (s, 2H), 3.67 (s, 2H), 3.60 (t, J = 6.2 Hz, 2H), 2.94 (s, 3H), 2.79 (s, 3H); 13C NMR (100 MHz, DMSO) δ 135.25, 134.88, 133.06, 133.01, 132.76, 131.82, 131.22, 129.95, 129.79, 129.65, 128.28, 128.24, 56.54, 50.94, 42.36, 39.43, 32.20; LRMS (ESI) m/z Calcd for C17H22ClN2S [M-HCl2]+, 321.1; Found, 321.1; HRMS (ESI) m/z Calcd for C17H22ClN2S [M-HCl2]+, 321.1187; Found, 321.1189; Purity: 99.2%.

Cell lines


Page 53 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Human leukemia cell lines were cultured in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin (Invitrogen). Human umbilical vein endothelial cell line HUV-EC-C, human lung fibroblast cell line MRC-5 and human renal cortical tubule epithelial cell line RCTEC were cultured in medium instructed by ATCC with 10% FBS and 1% antibiotics mentioned above. KOPN-8, KMS11, RCH-ACV, REH, RS4;11 were kindly offered by Yongjun Dang, RCTEC by Changlin Mei and MV4-11, THP-1, U937, HUV-EC-C and MRC-5 were purchased from ATCC. All cultures were maintained at 37°C and 5% CO2.

Cell Viability Assays

Cells were plated in 96-well plates in a volume of 100 µl and treated with compounds in corresponding concentration (DMSO as control) for 96 h. Cell Viability assays were carried out using CellTiter-Glo luminescent assay as instructed by the manufacturer (Promega). Briefly, 100 µl reconstituted CellTiter-Glo Reagent was added to each well. Then the plates were shaken for 2 min for cell lysis and incubated at room temperature for 10 min. Afterwards, 100 µl of the mixture was transferred to a white 96-well luminometer plate and the luminescence was measured on Envision luminometer (Perkin Elmer). All treatments were determined in triplicate and the data was normalized for control cells. For long-term proliferation assay, seeding densities were determined based on linear log-phase growth. Cells were counted and replanted back to the initial plating



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

density with 8d or 11d on day 4 and 8. IC50 determination were carried out as mentioned above.

shRNA construct and transfection

PRMT1 short hairpin RNA sequences (shPrmt#1 and shPrmt#2) and a control shRNA were cloned into the pSicoR backbone, a gift from Tyler Jacks (Addgene plasmid # 11579). The shRNA-pSicoR plasmid together with the lentivirus packaging plasmids psPAX2 and pMD2.G was transfected in 293T cells using polyethylenimine (Sigma-Aldrich). Supernatant containing lentivirus was collected at 48 h and 72 h post transfection and filtered through a 0.22 µm filter (Millipore). MV4-11 cells were instantly infected with lentivirus particles in the presence of 8 µg/mL polybrene. After 24 h, cultures were replaced with fresh medium. At a particular time, MV4-11 cells were collected for subsequent immunoblotting and cell viability assay. Primer sequences for PRMT1 knockdown were as follows. shPrmt1#1:TGTGTTCCAGTATCTCTGATTATTCTAGAGATAATCAGAGATACT GGAACACTTTTTTC; shPrmt1#2:TCCGGCAGTACAAAGACTACAATTCTAGAGATTGTAGTCTTTGTA CTGCCGGTTTTTTC

Western Blotting


Page 54 of 71

Page 55 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Total cell lysates were separated by 4%-16% SDS-polyacrylamide gels and transferred to nitrocellulose membranes. The blots were blocked with blocking buffer (5% nonfat milk in PBST) for 30-60 min at room temperature and incubated with primary antibodies overnight at 4°C. Then the blots were washed three times with PBST and incubated with 1:10000 dilution of donkey anti-rabbit secondary antibody (HRP conjugated) for 1 h. Followed by another three washes, bands were detected in a ChemiScope3400 imaging system using ECL substrate (Clinx). Primary antibodies used were as follows: anti-PRMT1 (Cell Signaling Technology #2449), anti-ADMA (Cell Signaling Technology #13522), anti-SDMA (Cell Signaling Technology #13222), anti-GAPDH (Cell Signaling Technology #5174), anti-H4R3me2a (Active Motif #39705), anti-H4 (Abcam #10158), anti-H3R2me2a (Millipore #04-808), and anti H3R17me2a (Abcam, ab8284).

Flow cytometric analysis

MV4-11 cells were plated in 6-well plates treated with compounds or DMSO control. For cell cycle analysis, cells were harvested at 72 h and resuspended in 70% ethanol overnight at 4°C for fixation. Then samples were washed with PBS and incubated with Propidium Iodide/RNase Staining Buffer (BD Pharmingen) for 30 min at room temperature. For cell apoptosis analysis, cells were harvested at 96 h and were measured using Annexin V-FITC Apoptosis Detection Kit (Vazyme Biotech) according to the



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

manufacturer's instructions. Samples were detected by BD FACSCalibur (BD Pharmingen) and data were analyzed by FlowJo V7.6.1.

Quantitative real time PCR

Total RNA was isolated from cells using TRIzol Reagent (Life Technologies) following the manufacturer's instructions. cDNA was obtained by reverse transcription using HiScript II Q RT SuperMix (Vazyme Biotech). qRT-PCR was performed using AceQ qPCR SYBR Green Master Mix (Vazyme Biotech) and detected by Quant Studio 6 Flex Real-Time PCR system (ABI). B2M (beta-2-microglobulin) was used as an internal control. Fold change of gene expression data was calculated by using of the ∆∆Ct = ∆Ct (GENE-B2M)normal – ∆Ct (GENE-B2M)cancer method. All Samples were run in triplicates and results were presented as mean ±SD. The primer sequences were listed in Supplementary Table S1.

Statistical Analysis

Significant differences were evaluated using a two-sample t test. All values were presented as mean±SD of three replicates.

ANCILLARY INFORMATION


Page 56 of 71

Page 57 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ASSOCIATED CONTENT

Supporting information Details on additional experimental procedures, Figures S1-S12, Table S1 and molecular formula strings.

AUTHOR INFORMATION

Corresponding Author

[email protected]; [email protected]; [email protected] and [email protected]

Author Contributions

# These authors contributed equally.

Notes The authors declare no competing financial interests.

ACKNOWLEDGMENT

The computation resources were supported by Computer Network Information Center, Chinese Academy of Sciences and Tianjin Supercomputing Center. We are extremely grateful to National Centre for Protein Science Shanghai (Shanghai Science Research Center, Protein Expression and Purification system) for their instrument support and technical assistance. We gratefully acknowledge financial support from the Ministry of Science and Technology of China (2015CB910304 to Y.Z.); the National Natural Science



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Foundation of China (21472208 and 81430084 to C.L., 21210003 and 81230076 to H.J. and 81402849 to F.Y.), Public Projects of Zhejiang Province (2015C33159 to F.Y. and 2016C31017 to J.J.), Zhejiang Province Natural Science Foundation (LY18H300008 to F.Y.), and Science Foundation of Zhejiang Sci-Tech University under grant (13042163-Y to F.Y. and 13042159-Y to J.J.), Zhejiang Provincial Top Key Discipline of Biology, and China Postdoctoral Science Foundation (2016M590391 to Y.Z. and 2016M601676 to S.C.). This project also sponsored by Shanghai Sailing Program (17YF1423100 to S.C.).

ABBREVIATIONS USED

ACN acetonitrile; aq. aqueous; ca. circa; CaH2 calcium hydride; CDCl3 chloroform-d; CHCl3 chloroform; C2O2Cl2 oxalyl chloride; DCM methylene chloride; DMF N,N-dimethylformamide; DMSO-d6 dimethylsulfoxide-d6; EA ethyl acetate; Et3N trimethylamine; Et2O acetic anhydride; EtOAc ethyl acetate; EtOH ethanol; h hour(s); 1H NMR proton nuclear magnetic resonance; HCl hydrochloric acid; HPLC high performance liquid chromatography; K2CO3 potassium carbonate; KOH potassium hydroxide; KI potassium iodide; LC/MS liquid chromatography/mass spectroscopy; MgSO4 magnesium sulfate; MeOH methanol; min minute(s); MS mass spectrometry; NaOH sodium hydroxide; Na2SO4 sodium sulfate; PE petroleum ether; RT room temperature; SOCl2 thionyl chloride; TFA Trifluoroacetic Acid; THF tetrahydrofuran; TLC thin layer chromatography; TMS tetramethysilane; AML1-ETO Acute myelogenous leukemia 1-RUNX1 translocation partner 1; MLL-EEN lysine methyltransferase 2A-SH3


Page 58 of 71

Page 59 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


domain containing GRB2 like 1; MLL-GAS7 lysine methyltransferase 2A- growth arrest specific 7; H3R2me2a histone H3 arginine 2 asymmetric dimethylation; H3R17me2a histone H3 arginine 17 asymmetric dimethylation; HOXA9 homeobox A9; HOXA10 homeobox A10; MEIS1 Meis homeobox 1; MNDA myeloid cell nuclear differentiation antigen; EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit; G9a euchromatic histone lysine methyltransferase 2; MLL1 lysine methyltransferase 2A; PRDM9 PR/SET domain 9; SMYD2 SET and MYND domain containing 2; SUV39H1 suppressor of variegation 3-9 homolog 1; DNMT1 DNA methyltransferase 1; DNMT3A/3L DNA methyltransferase 3A/DNA methyltransferase 3 like; GCN5 lysine acetyltransferase 2A.

REFERENCES 1.

Yang, Y.; Bedford, M. T. Protein Arginine Methyltransferases and Cancer. Nat. Rev.

Cancer 2013, 13, 37-50. 2.

Yoshimatsu, M.; Toyokawa, G.; Hayami, S.; Unoki, M.; Tsunoda, T.; Field, H. I.;

Kelly, J. D.; Neal, D. E.; Maehara, Y.; Ponder, B. A.; Nakamura, Y.; Hamamoto, R. Dysregulation of PRMT1 and PRMT6, Type I Arginine Methyltransferases, Is Involved in Various Types of Human Cancers. Int. J. Cancer 2011, 128, 562-573. 3.

Wei, H.; Mundade, R.; Lange, K. C.; Lu, T. Protein Arginine Methylation of

Non-Histone Proteins and Its Role in Diseases. Cell Cycle 2014, 13, 32-41.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

4.

Baldwin, R. M.; Morettin, A.; Paris, G.; Goulet, I.; Cote, J. Alternatively Spliced

Protein Arginine Methyltransferase 1 Isoform PRMT1v2 Promotes the Survival and Invasiveness of Breast Cancer Cells. Cell Cycle 2012, 11, 4597-4612. 5.

Mathioudaki, K.; Papadokostopoulou, A.; Scorilas, A.; Xynopoulos, D.; Agnanti, N.;

Talieri, M. The PRMT1 Gene Expression Pattern in Colon Cancer. Br. J. Cancer 2008, 99, 2094-2099. 6.

Papadokostopoulou A.; Mathioudaki K.; Scorilas A.; Xynopoulos D.; Ardavanis A.;

Kouroumalis E.; Talieri M., T Colon Cancer and Protein Arginine Methyltransferase 1 Gene Expression. Anticancer Res. 2009, 29, 1361-1366. 7.

Liao, H. W.; Hsu, J. M.; Xia, W.; Wang, H. L.; Wang, Y. N.; Chang, W. C.; Arold,

S. T.; Chou, C. K.; Tsou, P. H.; Yamaguchi, H.; Fang, Y. F.; Lee, H. J.; Lee, H. H.; Tai, S. K.; Yang, M. H.; Morelli, M. P.; Sen, M.; Ladbury, J. E.; Chen, C. H.; Grandis, J. R.; Kopetz, S.; Hung, M. C. PRMT1-Mediated Methylation of the EGF Receptor Regulates Signaling and Cetuximab Response. J. Clin. Invest. 2015, 125, 4529-4543. 8.

Xu, W. S.; Parmigiani, R. B.; Marks, P. A. Histone Deacetylase Inhibitors:

Molecular Mechanisms of Action. Oncogene 2007, 26, 5541-5552. 9.

Gui, C. Y.; Ngo, L.; Xu, W. S.; Richon, V. M.; Marks, P. A. Histone Deacetylase

(HDAC) Inhibitor Activation of p21WAF1 Involves Changes in Promoter-Associated Proteins, Including HDAC1. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 1241-1246. 10. Shia, W. J.; Okumura, A. J.; Yan, M.; Sarkeshik, A.; Lo, M. C.; Matsuura, S.; Komeno, Y.; Zhao, X.; Nimer, S. D.; Yates, J. R.; Zhang, D. E. PRMT1 Interacts with


Page 60 of 71

Page 61 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


AML1-ETO to Promote Its Transcriptional Activation and Progenitor Cell Proliferative Potential. Blood 2012, 119, 4953-4962. 11. Cheung, N.; Chan, L. C.; Thompson, A.; Cleary, M. L.; So, C. W. Protein Arginine-Methyltransferase-Dependent Oncogenesis. Nat. Cell Biol. 2007, 9, 1208-1215. 12. Cheung, N.; Fung, T. K.; Zeisig, B. B.; Holmes, K.; Rane, J. K.; Mowen, K. A.; Finn, M. G.; Lenhard, B.; Chan, L. C.; So, C. W. Targeting Aberrant Epigenetic Networks Mediated by PRMT1 and KDM4C in Acute Myeloid Leukemia. Cancer Cell 2016, 29, 32-48. 13. Ou, C. Y.; LaBonte, M. J.; Manegold, P. C.; So, A. Y.; Ianculescu, I.; Gerke, D. S.; Yamamoto, K. R.; Ladner, R. D.; Kahn, M.; Kim, J. H.; Stallcup, M. R. A Coactivator Role of CARM1 in the Dysregulation of β-Catenin Activity in Colorectal Cancer Cell Growth and Gene Expression. Mol. Cancer Res. 2011, 9, 660-670. 14. Morales, Y.; Caceres, T.; May, K.; Hevel, J. M. Biochemistry and Regulation of the Protein Arginine Methyltransferases (PRMTs). Arch. Biochem. Biophys. 2016, 590, 138-152. 15. Bedford, M. T.; Clarke, S. G. Protein Arginine Methylation in Mammals: Who, What, and Why. Mol. Cell 2009, 33, 1-13. 16. Yang, Y.; Hadjikyriacou, A.; Xia, Z.; Gayatri, S.; Kim, D.; Zurita-Lopez, C.; Kelly, R.; Guo, A.; Li, W.; Clarke, S. G.; Bedford, M. T. PRMT9 Is a Type II Methyltransferase That Methylates the Splicing Factor SAP145. Nat. Commun. 2015, 6, 6428.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

17. Zurita-Lopez, C. I.; Sandberg, T.; Kelly, R.; Clarke, S. G. Human Protein Arginine Methyltransferase 7 (PRMT7) Is a Type III Enzyme Forming ω-NG-monomethylated Arginine Residues. J. Biol. Chem. 2012, 287, 7859-7870. 18. Doerks, T.; Copley, R. R.; Schultz, J.; Ponting, C. P.; Bork, P. Systematic Identification of Novel Protein Domain Families Associated with Nuclear Functions. Genome Res. 2002, 12, 47-56. 19. Han, H. S.; Choi, D.; Choi, S.; Koo, S. H. Roles of Protein Arginine Methyltransferases in the Control of Glucose Metabolism. Endocrinol. Metab. 2014, 29, 435-440. 20. Snijders, A. P.; Hautbergue, G. M.; Bloom, A.; Williamson, J. C.; Minshull, T. C.; Phillips, H. L.; Mihaylov, S. R.; Gjerde, D. T.; Hornby, D. P.; Wilson, S. A.; Hurd, P. J.; Dickman, M. J. Arginine Methylation and Citrullination of Splicing Factor Proline- and Glutamine-Rich (SFPQ/PSF) Regulates Its Association with mRNA. RNA 2015, 21, 347-359. 21. Yu, Z.; Chen, T.; Hebert, J.; Li, E.; Richard, S. A Mouse PRMT1 Null Allele Defines an Essential Role for Arginine Methylation in Genome Maintenance and Cell Proliferation. Mol. Cell. Biol. 2009, 29, 2982-2996. 22. Yang, J. H.; Chiou, Y. Y.; Fu, S. L.; Shih, I. Y.; Weng, T. H.; Lin, W. J.; Lin, C. H. Arginine Methylation of hnRNPK Negatively Modulates Apoptosis Upon DNA Damage through Local Regulation of Phosphorylation. Nucleic Acids Res. 2014, 42, 9908-9924.


Page 62 of 71

Page 63 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


23. Lott, K.; Mukhopadhyay, S.; Li, J.; Wang, J.; Yao, J.; Sun, Y.; Qu, J.; Read, L. K. Arginine Methylation of DRBD18 Differentially Impacts Its Opposing Effects on the Trypanosome Transcriptome. Nucleic Acids Res. 2015, 43, 5501-5523. 24. Liu, X.; Li, H.; Liu, L.; Lu, Y.; Gao, Y.; Geng, P.; Li, X.; Huang, B.; Zhang, Y.; Lu, J. Methylation of Arginine by PRMT1 Regulates Nrf2 Transcriptional Activity During the Antioxidative Response. Biochim. Biophys. Acta 2016, 1863, 2093-2103. 25. Dhar, S.; Vemulapalli, V.; Patananan, A. N.; Huang, G. L.; Di Lorenzo, A.; Richard, S.; Comb, M. J.; Guo, A.; Clarke, S. G.; Bedford, M. T. Loss of the Major Type I Arginine Methyltransferase PRMT1 Causes Substrate Scavenging by Other PRMTs. Sci. Rep. 2013, 3, 1311. 26. Hu, H.; Qian, K.; Ho, M. C.; Zheng, Y. G. Small Molecule Inhibitors of Protein Arginine Methyltransferases. Expert Opin. Invest. Drugs 2016, 25, 335-358. 27. Iacovides, D. C.; O'Shea, C. C.; Oses-Prieto, J.; Burlingame, A.; McCormick, F. Critical Role for Arginine Methylation in Adenovirus-Infected Cells. J. Virol. 2007, 81, 13209-13217. 28. Richon, V. M.; Sandhoff, T. W.; Rifkind, R. A.; Marks, P. A. Histone Deacetylase Inhibitor Selectively Induces p21WAF1 Expression and Gene-Associated Histone Acetylation. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 10014-10019. 29. Zhang,

X.;

Cheng,

X.

Structure

of

the

Predominant

Protein

Arginine

Methyltransferase PRMT1 and Analysis of Its Binding to Substrate Peptides. Structure 2003, 11(5), 509-520.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

30. Cheng, D.; Yadav, N.; King, R. W.; Swanson, M. S.; Weinstein, E. J.; Bedford, M. T. Small Molecule Regulators of Protein Arginine Methyltransferases. J. Biol. Chem. 2004, 279, 23892-23899. 31. Xie, Y.; Zhou, R.; Lian, F.; Liu, Y.; Chen, L.; Shi, Z.; Zhang, N.; Zheng, M.; Shen, B.; Jiang, H.; Liang, Z.; Luo, C. Virtual Screening and Biological Evaluation of Novel Small Molecular Inhibitors against Protein Arginine Methyltransferase 1 (PRMT1). Org. Biomol. Chem. 2014, 12, 9665-9673. 32. Yan, L.; Yan, C.; Qian, K.; Su, H.; Kofsky-Wofford, S. A.; Lee, W.-C.; Zhao, X.; Ho, M.-C.; Ivanov, I.; Zheng, Y. G. Diamidine Compounds for Selective Inhibition of Protein Arginine Methyltransferase 1. J. Med. Chem. 2014, 57, 2611-2622. 33. Hu, H.; Owens, E. A.; Su, H.; Yan, L.; Levitz, A.; Zhao, X.; Henary, M.; Zheng, Y. G. Exploration of Cyanine Compounds as Selective Inhibitors of Protein Arginine Methyltransferases: Synthesis and Biological Evaluation. J. Med. Chem. 2015, 58, 1228-1243. 34. Sack, J. S.; Thieffine, S.; Bandiera, T.; Fasolini, M.; Duke, G. J.; Jayaraman, L.; Kish, K. F.; Klei, H. E.; Purandare, A. V.; Rosettani, P.; Troiani, S.; Xie, D.; Bertrand, J. A. Structural Basis for CARM1 Inhibition by Indole and Pyrazole Inhibitors. Biochem. J. 2011, 436, 331-339. 35. Mitchell, L. H.; Drew, A. E.; Ribich, S. A.; Rioux, N.; Swinger, K. K.; Jacques, S. L.; Lingaraj, T.; Boriack-Sjodin, P. A.; Waters, N. J.; Wigle, T. J.; Moradei, O.; Jin, L.; Riera, T.; Porter-Scott, M.; Moyer, M. P.; Smith, J. J.; Chesworth, R.; Copeland, R. A.


Page 64 of 71

Page 65 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Aryl Pyrazoles as Potent Inhibitors of Arginine Methyltransferases: Identification of the First PRMT6 Tool Compound. ACS Med. Chem. Lett. 2015, 6, 655-659. 36. Eram, M. S.; Shen, Y.; Szewczyk, M. M.; Wu, H.; Senisterra, G.; Li, F.; Butler, K. V.; Kaniskan, H. U.; Speed, B. A.; dela Sena, C.; Dong, A.; Zeng, H.; Schapira, M.; Brown, P. J.; Arrowsmith, C. H.; Barsyte-Lovejoy, D.; Liu, J.; Vedadi, M.; Jin, J. A Potent, Selective, and Cell-Active Inhibitor of Human Type I Protein Arginine Methyltransferases. ACS Chem. Biol. 2016, 11, 772-781. 37. Lipinski, C. A.; Lombardo, F.; Dominy, B. W.; Feeney, P. J. Experimental and Computational Approaches to Estimate Solubility and Permeability in Drug Discovery and Development Settings. Adv. Drug Delivery Rev. 2001, 46, 3-26. 38. Baell, J. B.; Holloway, G. A. New Substructure Filters for Removal of Pan Assay Interference Compounds (PAINS) from Screening Libraries and for Their Exclusion in Bioassays. J. Med. Chem. 2010, 53, 2719-2740. 39. Whitty, A. Growing PAINS in Academic Drug Discovery. Future Med. Chem. 2011, 3, 797-801. 40. Baell, J.; Walters, M. A. Chemistry: Chemical Con Artists Foil Drug Discovery. Nature 2014, 513, 481-483. 41. Gayatri, S.; Cowles, M. W.; Vemulapalli, V.; Cheng, D.; Sun, Z.-W.; Bedford, M. T. Using Oriented Peptide Array Libraries to Evaluate Methylarginine-Specific Antibodies and Arginine Methyltransferase Substrate Motifs. Sci. Rep. 2016, 6, 28718.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

42. Friesner, R. A.; Banks, J. L.; Murphy, R. B.; Halgren, T. A.; Klicic, J. J.; Mainz, D. T.; Repasky, M. P.; Knoll, E. H.; Shelley, M.; Perry, J. K.; Shaw, D. E.; Francis, P.; Shenkin, P. S. Glide: A New Approach for Rapid, Accurate Docking and Scoring. 1. Method and Assessment of Docking Accuracy. J. Med. Chem. 2004, 47, 1739-1749. 43. Friesner, R. A.; Murphy, R. B.; Repasky, M. P.; Frye, L. L.; Greenwood, J. R.; Halgren, T. A.; Sanschagrin, P. C.; Mainz, D. T. Extra Precision Glide: Docking and Scoring Incorporating a Model of Hydrophobic Enclosure for Protein-Ligand Complexes. J. Med. Chem. 2006, 49, 6177-6196. 44. Politzer, P.; Murray, J. S.; Clark, T. Halogen Bonding: An Electrostatically-Driven Highly Directional Noncovalent Interaction. Phys. Chem. Chem. Phys. 2010, 12, 7748-7757. 45. Zhang, R.; Li, X.; Liang, Z.; Zhu, K.; Lu, J.; Kong, X.; Ouyang, S.; Li, L.; Zheng, Y. G.; Luo, C. Theoretical Insights into Catalytic Mechanism of Protein Arginine Methyltransferase 1. PLoS One 2013, 8, e72424. 46. Strahl B. D.; Briggs S. D.; Brame C. J.; Caldwell J.A.; Koh S. S.; Ma H; Cook R. G.; Shabanowitz J.; Hunt D. F.; Stallcup M. R.; Allis C. D. Methylation of Histone H4 at Arginine 3 Occurs in Vivo and Is Mediated by the Nuclear Receptor Coactivator PRMT1. Curr. Biol. 2001, 11, 996-1000. 47. Richon, V. M.; Emiliani, S.; Verdin, E.; Webb, Y.; Breslow, R.; Rifkind, R. A.; Marks, P. A. A Class of Hybrid Polar Inducers of Transformed Cell Differentiation Inhibits Histone Deacetylases. Proc. Natl. Acad. Sci. U. S. A. 1998, 95, 3003-3007.


Page 66 of 71

Page 67 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


48. Glaser, K. B.; Staver, M. J.; Waring, J. F.; Stender, J.; Ulrich, R. G.; Davidsen, S. K. Gene Expression Profiling of Multiple Histone Deacetylase (HDAC) Inhibitors: Defining a Common Gene Set Produced by HDAC Inhibition in T24 and MDA Carcinoma Cell Lines. Mol. Cancer Ther. 2003, 2, 151-163. 49. Hockly, E.; Richon, V. M.; Woodman, B.; Smith, D. L.; Zhou, X.; Rosa, E.; Sathasivam, K.; Ghazi-Noori, S.; Mahal, A.; Lowden, P. A.; Steffan, J. S.; Marsh, J. L.; Thompson, L. M.; Lewis, C. M.; Marks, P. A.; Bates, G. P. Suberoylanilide Hydroxamic Acid, a Histone Deacetylase Inhibitor, Ameliorates Motor Deficits in a Mouse Model of Huntington's Disease. Proc. Natl. Acad. Sci. U. S. A. 2003, 100, 2041-2046. 50. Borkin, D.; He, S.; Miao, H.; Kempinska, K.; Pollock, J.; Chase, J.; Purohit, T.; Malik, B.; Zhao, T.; Wang, J.; Wen, B.; Zong, H.; Jones, M.; Danet-Desnoyers, G.; Guzman, M. L.; Talpaz, M.; Bixby, D. L.; Sun, D.; Hess, J. L.; Muntean, A. G.; Maillard, I.; Cierpicki, T.; Grembecka, J. Pharmacologic Inhibition of the Menin-MLL Interaction Blocks Progression of MLL Leukemia in Vivo. Cancer Cell 2015, 27, 589-602. 51. Milne, T. A.; Dou, Y.; Martin, M. E.; Brock, H. W.; Roeder, R. G.; Hess, J. L. MLL Associates Specifically with a Subset of Transcriptionally Active Target Genes. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 14765-14770. 52. Shao, Y.; Gao, Z.; Marks, P. A.; Jiang, X. Apoptotic and Autophagic Cell Death Induced by Histone Deacetylase Inhibitors. Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 18030-18035.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

53. Butler, L. M.; Zhou, X.; Xu, W. S.; Scher, H. I.; Rifkind, R. A.; Marks, P. A.; Richon, V. M. The Histone Deacetylase Inhibitor SAHA Arrests Cancer Cell Growth, up-Regulates Thioredoxin-Binding Protein-2, and Down-Regulates Thioredoxin. Proc. Natl. Acad. Sci. U. S. A. 2002, 99, 11700-11705. 54. Di Lorenzo, A.; Bedford, M. T. Histone Arginine Methylation. FEBS Lett. 2011, 585, 2024-2031. 55. Stopa, N.; Krebs, J. E.; Shechter, D. The PRMT5 Arginine Methyltransferase: Many Roles in Development, Cancer and Beyond. Cell. Mol. Life Sci. 2015, 72, 2041-2059. 56. Chan-Penebre, E.; Kuplast, K. G.; Majer, C. R.; Boriack-Sjodin, P. A.; Wigle, T. J.; Johnston, L. D.; Rioux, N.; Munchhof, M. J.; Jin, L.; Jacques, S. L.; West, K. A.; Lingaraj, T.; Stickland, K.; Ribich, S. A.; Raimondi, A.; Scott, M. P.; Waters, N. J.; Pollock, R. M.; Smith, J. J.; Barbash, O.; Pappalardi, M.; Ho, T. F.; Nurse, K.; Oza, K. P.; Gallagher, K. T.; Kruger, R.; Moyer, M. P.; Copeland, R. A.; Chesworth, R.; Duncan, K. W. A Selective Inhibitor of PRMT5 with in Vivo and in Vitro Potency in MCL Models. Nat. Chem. Biol. 2015, 11, 432-437. 57. Larkin, M. A.; Blackshields, G.; Brown, N. P.; Chenna, R.; McGettigan, P. A.; McWilliam, H.; Valentin, F.; Wallace, I. M.; Wilm, A.; Lopez, R.; Thompson, J. D.; Gibson, T. J.; Higgins, D. G. Clustal W and Clustal X Version 2.0. Bioinformatics 2007, 23, 2947-2948.


Page 68 of 71

Page 69 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


58. Marti-Renom, M. A.; Stuart, A. C.; Fiser, A.; Sanchez, R.; Melo, F.; Sali, A. Comparative Protein Structure Modeling of Genes and Genomes. Annu. Rev. Biophys. Biomol. Struct. 2000, 29, 291-325. 59. Sun, Q.; Liu, L.; Mandal, J.; Molino, A.; Stolz, D.; Tamm, M.; Lu, S.; Roth, M. PDGF-BB Induces PRMT1 Expression through ERK1/2 Dependent STAT1 Activation and Regulates Remodeling in Primary Human Lung Fibroblasts. Cell. Signalling 2016, 28, 307-315. 60. Shelley, J. C.; Cholleti, A.; Frye, L. L.; Greenwood, J. R.; Timlin, M. R.; Uchimaya, M. Epik: A Software Program for pK( a ) Prediction and Protonation State Generation for Drug-Like Molecules. J. Comput.-Aided Mol. Des. 2007, 21, 681-691. 61. Ewing, T. J.; Makino, S.; Skillman, A. G.; Kuntz, I. D. Dock 4.0: Search Strategies for Automated Molecular Docking of Flexible Molecule Databases. J. Comput.-Aided Mol. Des. 2001, 15, 411-428. 62. Margueron, R.; Reinberg, D. The Polycomb Complex PRC2 and Its Mark in Life. Nature 2011, 469, 343-349. 63. Feng Q.; Wang H.; Ng H. H.; Erdjument-Bromage H.; Tempst P.; Struhl K; Zhang, Y. Methylation of H3-Lysine 79 Is Mediated by a New Family of HMTases without a SET Domain. Curr. Biol. 2002, 1052–1058. 64. Robertson, K. D.; A.Jones, P. DNA Methylation: Past, Present and Future Directions. Carcinogenesis 2000, 21, 461-467.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

65. Wei, H.; Mundade, R.; Lange, K.; Lu, T. Protein Arginine Methylation of Non-Histone Proteins and Its Role in Diseases. Cell Cycle 2014, 13, 32-41.

66. Jifi J.; Karel S.; Josef P.; Vojtech K.; Zdenek S.; Marta H.; Jiri H.; Emil S.; Miroslav R.; Ivan K.; Martin V.; Antonin D.; Jirina M.; Natasa D.; P., M. Potential Antidepressants_ 2-(Methoxy- and Hydroxyphenylthio)Benzylamines as Selective Inhibitors of 5-Hydroxytryptamine Re-Uptake in the Brain. Collect. Czech. Chem. Commun. 1989, 54, 3294-3338.


Page 70 of 71

Page 71 of 71

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Table of Contents


(PRMT) Inhibitors Inhibiting Leukemia Cells ... - ACS Publications

Recommend Documents