Production of Cinnamyl Alcohol Glucoside from Glucose in

Article pubs.acs.org/JAFC

Production of Cinnamyl Alcohol Glucoside from Glucose in Escherichia coli Wei Zhou,†,‡,§ Huiping Bi,†,‡ Yibin Zhuang,†,‡ Qinglin He,†,‡ Hua Yin,†,‡ Tao Liu,*,†,‡ and Yanhe Ma† †

Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, China Key Laboratory of Systems Microbial Biotechnology, Chinese Academy of Sciences, Tianjin 300308, China § University of Chinese Academy of Sciences, Beijing, China ‡

ABSTRACT: Rosin, a cinnamyl alcohol glucoside, is one of the important ingredients in Rhodiola rosea, which is a valuable medicinal herb used for centuries. Rosin displayed multiple biological activities. The traditional method for producing rosin and derivatives is direct extraction from R. rosea, which suffers from limited availability of natural resources and complicated purification procedure. This work achieved de novo biosynthesis of rosin in Escherichia coli. First, a biosynthetic pathway of aglycon cinnamyl alcohol from phenylalanine was constructed. Subsequently, the UGT genes from Rhodiola sachalinensis (UGT73B6) or Arabidopsis thaliana (UGT73C5) were introduced into the above recombinant E. coli strain to produce rosin. Then the phenylalanine metabolic pathway of E. coli was optimized by genetic manipulation, and the production of rosin by the engineered E. coli reached 258.5 ± 8.8 mg/L. This study lays a significant foundation for microbial production of rosin and its derivatives using glucose as the renewable carbon source. KEYWORDS: cinnamyl alcohol, rosin, Rhodiola rosea, E. coli, biosynthesis, UGT73B6, UGT73C5

■

INTRODUCTION Many phenylpropanoid derivatives have important biological activities. For example, rosavins (rosin, rosavin, rosarin), also known as cinnamyl glycosides, are one of the major class ingredients of “golden root” Rhodiola rosea and were found to have antioxidative, neurostimulant, and cardiprotective activities.1,2 Structurally, rosin is the glucoside of cinnamyl alcohol, which is further modified by sugars to form rosavin or rosarin.3 The production of rosin and its derivatives mainly depends on direct extraction of R. rosea collected from natural resources and field cultivation. However, the natural resources are limited, and because of its slow growth and overharvesting, wild R. rosea has been listed as endangered species in many countries.4,5 Field plant cultivation requires at least 5−7 years for the accumulation of those compounds.6 Plant extraction cannot satisfy the increasing demands by human society. Thus, many studies have been devoted to the production of rosin using organic synthesis and biotechnological approaches. The total synthesis of rosin has been achieved using the Mizoroki−Heck type reaction with only 11% yield.7 Rosin and its derivatives were also produced through biotransformation by feeding the precursor cinnamyl alcohol to the callus or the hairy root culture of R. rosea.3,8,9 Plant biotechnology offers the opportunity to obtain natural products, but it is difficult to adapt to industrial-scale production. Construction of a microbial cell factory is a promising strategy for producing high-value-added natural products.10 Many plant-derived natural products have been produced in microbes. Escherichia coli is one of the most “user-friendly” hosts for metabolic engineering, because its metabolism and regulation are well characterized and a variety of genetic tools are widely available. The biosynthetic pathway of rosin and its derivatives has been proposed. The biosynthesis of cinnamyl alcohol starts © 2017 American Chemical Society

from deamination of phenylalanine. Phenylalanine was transformed into cinnamic acid, cinnamyl-CoA, cinnamaldehyde, and cinnamyl alcohol by sequential actions of phenylalanine ammonia-lyase (PAL), hydroxycinnamate:CoA ligase (4CL), cinnamyl-CoA reductase (CCR), and alcohol dehydrogenase (ADH). Rosin is synthesized by the glucosylation of cinnamyl alcohol, and finally rosavin and rosarin are formed by adding an arabinopyranose or an arabinofuranose unit to rosin. PAL, 4CL, and CCR from various species have been characterized and functionally expressed in microbes for the biosynthesis of natural products, such as (2S)-pinocembrin, coumarins, cinnamaldehyde, and monolignols.11−15 The enzymes responsible for the glycosylation of cinnamyl alcohol have not been described yet. In this study, we aimed to engineer E. coli to produce rosin (Figure 1). First, we constructed a biosynthetic pathway of cinnamyl alcohol from phenylalanine catalyzed by the enzymes AtPAL, Pc4CL, AtCCR, and endogenous alcohol dehydrogenases or aldo-keto reductases. Furthermore, the candidate UGT genes from Rhodiola sachalinensis (UGT73B6) and Arabidopsis thaliana (UGT73C5) were utilized for glucosylation of cinnamyl alcohol, and we successfully achieved de novo biosynthesis of rosin from glucose in E. coli. We then optimized the phenylalanine metabolic pathway of E. coli by genetic manipulation, and the production of rosin by the engineered E. coli reached 258.2 ± 8.8 mg/L. Our study lays a significant foundation for the production of rosin and its derivatives using glucose as the renewable carbon source in microbial factories. Received: Revised: Accepted: Published: 2129

January 6, 2017 February 23, 2017 February 23, 2017 February 23, 2017 DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135

Article

Journal of Agricultural and Food Chemistry

Figure 1. Biosynthetic pathway from glucose to rosin.

■

AtPAL (GenBank: AY133595.1) were obtained from mRNA of A. thaliana, which was isolated by RNAprep pure Plant Kit from Tiangen Biotech Co. (Beijing, China). A First Strand cDNA Synthesis Kit from Toyobo Co., Ltd. (Osaka, Japan), was used for reverse transcription. Pc4CL (GenBank: X13325.1) from Petroselinum crispum, UGT72B14 (GenBank: EU567325.1), UGT74R1 (GenBank: EF508689.1) and UGT73B6 (GenBank: AY547304) from Rhodiola sachalinensis, and UGT73C5 (GenBank: NM_129235.4) from A. thaliana were synthesized by Shanghai Generay Biotech Co., Ltd. (Shanghai, China) and codon optimized for expression in E. coli. All of the genes were amplified by high-fidelity DNA polymerase from Thermo Fisher Scientific Inc. AtCCR was amplified by PCR using the pair of primers AtCCR-F/AtCCR-R and cloned into pCDFDuet-1 through NdeI/KpnI sites to generate plasmid pCDFDuet-AtCCR. Pc4CL fragment was PCR-amplified with primers Pc4CL-F/Pc4CL-R and cloned into NcoI/BamHI sites of plasmid pCDFDuet-AtCCR to form plasmid pCDFDuet-AtCCR-Pc4CL. AtPAL fragment was PCRamplified with primers AtPAL-F/AtPAL-R, digested, and cloned into pET28a through NcoI/EcoRI, yielding the intermediate expression plasmid pET28a-AtPAL. The T7-atPAL fragment with a T7 promoter and an N-terminal His tag was PCR-amplified from pET28a-AtPAL with primer pair T7AtPAL-F/T7AtPAL-R, digested, and ligated into pCDFDuet-AtCCR-Pc4CL via EcoRI/NotI to generate the final recombinant plasmid pCDFDuet-AtCCR-Pc4CL-AtPAL. UGT72B14, UGT74R1, UG73B6, and UGT73C5 were PCR-amplified by using primer pairs UGT72B14-F/UGT72B14-R, UGT74R1-F/UGT74R1R, UGT73B6-F/UGT73B6-R, and UGT73C5-F/UGT73C5-R and ligated into pET28a via NcoI/XhoI to yield plasmids pET28aUGT72B14, pET28a-UGT74R1, pET28a-UGT73B6, and pET28aUGT73C5, respectively. By deleting the termination codon TAA in the reverse primers, a C-terminal His tag was fused to the UDPglucosyltransferase (UGT) proteins. Feeding Experiments. Feeding experiments were conducted to examine the activity of endogenous alcohol dehydrogenases and aldoketo reductases for converting cinnamaldehyde into cinnamyl alcohol in E. coli. Single clones of E. coli BL21 (DE3) were inoculated into 5 mL of LB liquid medium and were grown at 37 °C overnight with shaking at 200 rpm. Then 1 mL of the seed culture was diluted into 50 mL of LB liquid medium and cultured at 30 °C with shaking at 200 rpm. When the optical density at 600 nm (OD600) reached 3.0, the cells were harvested by centrifugation at 3220g for 10 min and transferred into 50 mL of M9 medium. Subsequently, 3 mM cinnamaldehyde was added into the cultures, which were further incubated for 3 h. The supernatant was sampled at regular time intervals for HPLC analysis. Microbial Production of Cinnamyl Alcohol. Single clones of the recombinant E. coli strain BWT01 with plasmid pCDFDuetAtCCR-Pc4CL-AtPAL were inoculated into 3 mL of LB liquid medium and grown at 37 °C overnight with shaking at 200 rpm. Then 1 mL of the preinoculums were transferred to 50 mL of LB liquid medium and were grown at 37 °C with shaking at 200 rpm. When OD600 reached 0.6−0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM to induce gene expression at 16 °C for 12−16 h. The cells were harvested by

MATERIALS AND METHODS

Plasmids, Strains, and Media. All of the strains and plasmids used in this study are listed in Table 1. E. coli XL1-blue was used for

Table 1. Bacterial Strains and Plasmids Used in This Study name plasmids pCDFDuet pET28a pET28a-AtPAL pCDFDuetAtCCR-Pc4CL pCDFDuetAtCCR-Pc4CLAtPAL pET28aUGT72B14 pET28aUGT74R1 pET28aUGT73B6 pET28aUGT73C5 strains BPHE BWT01 BWT02 BWT03 BWT04 BWT05 BPHE01 BPHE02

description

reference

CDF ori with PT7; SMR pBR322 ori with PT7; KanR pET28a carrying AtPAL pCDFDuet carrying AtCCR and Pc4CL pCDFDuet carrying AtCCR, Pc4CL and AtPAL

Novagen Novagen this study this study

pET28a carrying UGT72B14

this study

pET28a carrying UGT74R1

this study

pET28a carrying UGT73B6

this study

pET28a carrying UGT73C5

this study

E. coli BL21 (DE3) with gene tyrR, tyrA and trpE deleted E. coli BL21 (DE3) containing pCDFDuet-AtCCR-Pc4CL-AtPAL E. coli BWT01 containing pET28aUGT72B14 E. coli BWT01 containing pET28aUGT74R1 E. coli BWT01 containing pET28aUGT73B6 E. coli BWT01 containing pET28aUGT73C5 E. coli BPHE containing pCDFDuetAtCCR-Pc4CL-AtPAL E. coli BPHE01 containing pET28aUGT73C5

this study

this study

this study this study this study this study this study this study this study

gene cloning and plasmid propagation, and E. coli BL21 (DE3) and its derivatives were used for protein expression and the production of targeted compounds. Mutant strains used in this study were created from wild type strain BL21 (DE3) by using λ-Red recombination.16 Luria−Bertani (LB) medium was used for the cultivation of E. coli cells for gene cloning, plasmid propagation, and inoculum preparation. Modified M9 medium containing 1×M9 minimal salts, 20 g/L glucose, 2 mM MgSO4, and 0.1 mM CaCl2 was used as the fermentation medium. Kanamycin (50 mg/L) and streptomycin (100 mg/L) were added to the medium as needed. Plasmid Construction. All of the oligonucleotide primers used in this study are listed in Table 2. AtCCR (GenBank: NM_101463.4) and 2130

DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135

Article

Journal of Agricultural and Food Chemistry Table 2. Primers Used in This Study primer

sequence

AtCCR-F AtCCR-R Pc4CL-F Pc4CL-R AtPAL-F AtPAL-R T7AtPAL-F T7AtPAL-R UGT72B14-F UGT72B14-R UGT74R1-F UGT74R1-R UGT73B6-F UGT73B6-R

AACAACTCCATATGCCAGTCGACGTAGCCTCACC AACAACTCGGTACCTCAAGACCCGATCTTAATGCCAT AACAACTCCCATGGTTGGTGACTGCGTTGCG AACAACTCGGATCCTTATTTCGGCAGGTCACCAGAC AACAACTCCCATGGTGGATCAAATCGAAGCAATGTTG AACAACTCGAATTCTTAGCAAATCGGAATCGGAGCTC AACAACTCGAATTCCGAAATTAATACGACTCACTATAGG AACAACTCGCGGCCGCTTAGCAAATCGGAATCGGAGCTC AACAACTCCCATGGCGGGCAGCGGCACGGGTGC AACAACTCCTCGAGATGTTTAACGCTGCTACGCCAT AACAACTCCCATGGCGACCAAAAAGACGCAAATCC AACAACTCCTCGAGGTCCTTCAGTGCCAGACCCGTC AACAACTCCCATGGGCTCTGAAACTCGCCCGCTG AACAACTCCTCGAGAACCTTCTTCAGCTTCAGTTC

source this this this this this this this this this this this this this this

study study study study study study study study study study study study study study

Figure 2. Biotransformation of cinnamyl alcohol from cinnamaldehyde in E. coli BL21 (DE3). (A) Scheme depicting endogenous alcohol dehydrogenases and aldo-keto reductases convert cinnamaldehyde into cinnamyl alcohol in E. coli. (B) HPLC analysis of biotransformation products: (I) cinnamyl alcohol (CA) commercial standard; (II) cinnamaldehyde (CD) commercial standard; (III) conversion of 3 mM cinnamaldehyde in 10 min by strain E. coli BL21 (DE3). The new products eluted at 23.5 min correspond to the cinnamyl alcohol commercial standard. (C) Time course of the transformation rate of cinnamaldehyde using strain E. coli BL21 (DE3) fed with 3 mM cinnamaldehyde. centrifugation at 3220g for 10 min at 4 °C, then transferred into 50 mL of M9 liquid medium, and incubated at 30 °C for 12 h. The cultures were harvested by centrifugation at 12390g for 10 min, and the supernatant was stored at −20 °C until further analysis. Microbial Production of Rosin. Plasmids pET28a-UGT72B14, pET28a-UGT74R1, pET28a-UGT73B6, and pET28a-UGT73C5 were individually transformed into the cinnamyl alcohol-producing strain BWT01, generating recombinant strains BWT02, BWT03, BWT04, and BWT05, respectively. A two-stage cultivation procedure was employed for the production of rosin. At the first stage, single clones of the recombinant strains derived from BWT01 harboring UGT gene were pre-inoculated in LB liquid medium, respectively, and cultured overnight at 37 °C with shaking at 200 rpm. Then 1 mL cultures of different strains were transferred into 50 mL of LB liquid medium, respectively. When OD600 reached 0.6−0.8, 0.1 mM IPTG was added to the medium to induce gene expression at 16 °C for 12−16 h with shaking at 200 rpm. In the second stage, the cells were collected by centrifugation at 3220g for 10 min and subsequently resuspended in 50 mL of M9 medium. The cultivation of the second phase was continued for 48 h at 30 °C with shaking at 200 rpm. Samples were taken at regular time intervals for LC-MS analyses. Rosin Purification. One liter of fermentation broth of the recombinant strain BWT05 with plasmids pCDFDuet-AtCCRPc4CL-AtPAL and pET28a-UGT73C5 was centrifuged to collect supernatant. The supernatant was adsorbed by macroporous adsorption resin. Then different concentrations of ethanol (5, 10,

20, 50, and 60%) were used to elute the target compound gradually. The elution volume of each fraction was kept constant at 1 bed volume (BV). The concentrations of rosin in the eluents were determined by HPLC. The fractions containing rosin were concentrated to dryness by a vacuum rotary evaporator. The crude extract was resuspended in 3 mL of methanol. Purification of rosin was conducted by semipreparative HPLC performed on a Shimadzu LC-6 AD with an SPD20A detector. The elution conditions for separating rosin were as follows: solvent A, H2O; solvent B, methanol; flow, 4 mL/min; 0−15 min, 60% A and 40% B, 16−20 min, 60% A and 40−80% B (linear gradient). A YMC-pack ODS-A (10 × 250 mm; particle size = 5 μm) was used for compound separation. The elution was monitored at UV = 254 nm. Chemical Analysis and Quantification. The secondary metabolites of the recombinant strains were analyzed by LC-MS using an Agilent 1260 system coupled with a 1260 Infinity UV detector and a Bruker microQ-TOF II mass spectrometer equipped with an ESI ionization probe. An Innoval C18 column (4.6 × 250 mm; 5 μm particle size) was used for HPLC analysis. The elution conditions for cinnamyl alcohol and rosin were as follows: solvent A, H2O (containing 0.1% formic acid); solvent B, methanol; flow rate, 1 mL/min; 0−5 min, 80% A and 20% B, 6−25 min, 80% A and 20% B to 100% B (linear gradient). All of these products were detected at 254 nm. MS analysis was performed in a positive-ion mode. Standard calibration curves were prepared by HPLC analyses of cinnamyl alcohol (commercial standard) or rosin (purified products). All 2131

DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135

Article

Journal of Agricultural and Food Chemistry

Figure 3. Selection of UGTs for producing rosin in engineering strains. (a) HPLC analysis of the products in the fermentation supernatant of recombinant strains: strain BWT01 harboring plasmid pCDFDuet-AtCCR-Pc4CL-AtPAL (as control), strain BWT02 harboring plasmids pCDFDuet-AtCCR-Pc4CL-AtPAL and pET28a-UGT72B14, strain BWT03 harboring plasmids pCDFDuet-AtCCR-Pc4CL-AtPAL and pET28aUGT74R1, strain BWT04 harboring plasmids pCDFDuet-AtCCR-Pc4CL-AtPAL and pET28a-UGT73B6, strain BWT05 harboring plasmids pCDFDuet-AtCCR-Pc4CL-AtPAL and pET28a-UGT73C5. (b) Mass spectrum of product I eluted at 23.5 min having molecular ion [M − H2O + H]+ at m/z 117.0688, representing cinnamyl alcohol. (c) Mass spectrum of product II eluting at 21.5 min having molecular ion [M + Na]+ at m/z 319.1143, representing rosin. (d) Comparison of the production of rosin in strains BWT04 and BWT05. experiments were carried out in triplicate and repeated at least twice. The yield was presented as means ± SD. NMR Analysis. The NMR experiments were performed on a Bruker Avance 400 (Karlsruhe, Germany). The sample was dissolved in 500 μL of CD3OD. Chemical shifts are expressed in δ (ppm), and coupling constants (J) are given in hertz (Hz). 1 H NMR (400 MHz, CD3OD) δ 7.43 (2H, m, H-3′, 5′), 7.31 (2H, m, H-2′, 6′), 7.25 (1H, dd, J = 5.0, 3.7 Hz, H-4′), 6.70 (1H, d, J = 16.0 Hz, H-3), 6.39 (1H, dt, J = 16.0, 6.3 Hz, H-2), 4.55 (1H, ddd, J = 12.8, 5.7, 1.6 Hz, H-1a), 4.38 (1H, d, J = 7.8, Hz, H-1″), 4.34 (1H, ddd, J = 12.8, 6.5, 1.4 Hz, H-1b), 3.90 (1H, dd, J = 12.8, 2.4 Hz, H-6″a), 3.70 (1H, dd, J = 11.9, 5.5 Hz, H-6″b), 3.25−3.41 (4H, H-2″, -3″, -4″, -5″). 13 C NMR (100 MHz, CD3OD) δ 69.4 (C-1), 125.3 (C-2), 132.4 (C-3), 136.9 (C-1′), 126.1 (C-2′, 6′), 128.1 (C-3′, C-5′), 127.2 (C-4′), 101.9 (C-1″), 73.7 (C-2″), 76.6 (C-3″), 70.3 (C-4″), 76.7 (C-5″), 61.4 (C-6″).

■

the HPLC chromatogram at a retention time 23.5 min with a molecular ion at m/z 117.0688, which was identical with the cinnamyl alcohol standard. Three millimolar cinnamaldehyde was totally transformed into cinnamyl alcohol at 30 °C for 1.5 h as determined by HPLC analysis. The results of whole cell bioconversion experiments converting cinnamaldehyde to cinnamyl alcohol with E. coli BL21 (DE3) cells are summarized in Figure 2. Biosynthesis of Cinnamyl Alcohol in E. coli. On the basis of the biosynthetic pathways of monolignols in plants,20,21 we constructed the biosynthetic pathway of cinnamyl alcohol as Figure 1. The enzymes Pc4CL from P. crispum and AtCCR and AtPAL2 from A. thaliana were chosen to establish the biosynthetic pathway of cinnamyl alcohol, which has been successfully utilized for producing secondary metabolites with high efficiency. No additional heterologous ADHs or AKRs were further overexpressed, as high enzymatic activities of these endogenous enzymes in E. coli BL21 (DE3) have been detected. BWT01 containing pCDFDuet-AtCCR-Pc4CL-AtPAL was cultured by a two-stage cultivation procedure. Cinnamyl alcohol was determined and characterized by LC-MS analysis with the standard cinnamyl alcohol as the positive control (Figure 3). The titer of cinnamyl alcohol produced by BWT01 reached 197.8 ± 10.5 mg/L in 24 h. We quantified the intracellular and extracellular cinnamyl alcohol, and nearly all cinnamyl alcohol was transported outside the cell. UGT Selection for Rosin Biosynthesis in E. coli. Genes UGT73B6, UGT72B14, UGT74R1, and UGT73C5 were introduced into the cinnamyl alcohol-producing strain BWT01, yielding BWT02, BWT03, BWT04, and BWT05, respectively. HPLC analysis of metabolites showed that there

RESULTS

Conversion of Cinnamaldehyde to Cinnamyl Alcohol by E. coli BL21 (DE3). It was reported that alcohol dehydrogenases (ADHs) and aldo-keto reductases (AKRs) could catalyze the reduction of aldehydes or ketones to alcohols in the presence of NADH or NADPH. In E. coli, many endogenous ADHs (adhE, adhP, eutG, yiaY, yahK, yjgB, yqhD), and AKRs (dkgB, yeaE, dkgA) have been identified.17−19 These enzymes with broad substrate specificities could convert aliphatic or aromatic aldehydes to corresponding alcohols. In this study, we first investigated the efficiency of ADHs or AKRs of E. coli BL21 (DE3) converting cinnamaldehyde into cinnamyl alcohol. Three millimolar cinnamaldehyde was fed to the E. coli BL21 (DE3) and incubated for 10 min. The fermented broth was submitted for LC-MS analysis. Besides the substrate cinnamaldehyde (tR = 23.2 min), there was a new peak in 2132

DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135

Article

Journal of Agricultural and Food Chemistry

Figure 4. Production of cinnamyl alcohol and rosin in wild type strain and knockout strain. (a) Comparison of the titer of cinnamyl alcohol in strain BWT01 (BL21 (DE3) harboring plasmid pCDFDuet-AtCCR-Pc4CL-AtPAL) and strain BPHE01 (BL21 (DE3) ΔtyrR, ΔtyrA, and ΔtrpE harboring plasmid pCDFDuet-AtCCR-Pc4CL-AtPAL). (b) Time profile of cell growth and production of rosin in strain BWT02 (BL21 (DE3) transformed with plasmids pCDFDuet-AtCCR-Pc4CL-AtPAL and pET28a-UGT73C5) and strain BPHE02 (BL21 (DE3) ΔtyrR, ΔtyrA, and ΔtrpE transformed with plasmids pCDFDuet-AtCCR-Pc4CL-AtPAL and pET28a-UGT73C5).

was a new compound with tR = 21.5 min produced by both BWT02 harboring UGT73B6 and BWT05 carrying UGT73C5 as in Figure 3. MS analysis showed that the new metabolite has a molecular ion at m/z 319.1143 ([M + Na]+), which is identical with that of rosin. Subsequently, the structure of this compound was further confirmed as rosin by 1D-NMR spectroscopy analysis and comparison with the data of the previous papers.22−24 The titers of cinnamyl alcohol and rosin produced by the recombinant strain BWT04 were 151.5 ± 6.9 and 57.3 ± 5.4 mg/L in 24 h, respectively. The titers of cinnamyl alcohol and rosin produced by strain BWT05 reached 118.4 ± 4.3 and 168.9 ± 8.1 mg/L, respectively. Thus, UGT73C5 was the best enzyme for converting cinnamyl alcohol into rosin. Nearly all of the rosin was accumulated in the fermentation broth as cinnamyl alcohol. Improvement of Rosin Production by Enhancing Precursor Supply. To enhance the precursor supply, genes tyrR, tyrA, and trpE were deleted from the BL21 (DE3) genome, and a phenylalanine high-producing strain (BPHE) was generated. Subsequently, we introduced plasmid pCDFDuet-AtCCR-Pc4CL-AtPAL harboring genes encoding enzymes for cinnamyl alcohol biosynthesis into strain BPHE, generating a new strain BPHE01. The recombinant strain BPHE01 was cultivated for the production of cinnamyl alcohol with strain BWT01 as the control. After cultivation for 24 h, the production of cinnamyl alcohol in the culture broths was analyzed by HPLC. The titer of cinnamyl alcohol was 197.8 ± 10.5 mg/L produced by BL21 (DE3) strain and was elevated to 285.3 ± 15.2 mg/L after precursor enhancement in strain BPHE01 (Figure 4a). We transformed plasmid pET28aUGT73C5 into the above two strains to yield strains BPHE02 and BWT05 for rosin production, respectively. The cultivation supernatants of these two strains were taken at regular time intervals for HPLC analyses. Figure 4b shows that the titer of rosin produced by strain BWT05 reached the maximum in 24 h with a value of 168.9 ± 8.1 mg/L. The titer of rosin produced by BPHE02 reached the maximum in 36 h with a value of 258.5 ± 8.8 mg/L. The cell growth rate decreased after the deletion of the genes tyrR, tyrA, and trpE from E. coli BL21 (DE3).

from plant extract or synthesized by chemical methods. However, the direct extraction is limited by natural sources and complicated downstream processing methods. Chemical synthesis often has disadvantages such as the use of expensive intermediates, causing serious pollution, and using harsh reaction conditions, etc. R. rosea has been used for several centuries as a valuable medicinal herb for the treatment of fatigue, exhaustion, anxiety, hysteria, headache, and hernia. Studies revealed that the most important classes of the pharmacological components are phenylethanol derivatives (salidroside, tyrosol) and phenylpropanoid derivatives (rosin, rosavin, rosarin, usually referred to as rosavins).25−27 In this work, we constructed an artificial biosynthetic pathway of rosin by utilizing functional enzymes from different organisms. To the best of our knowledge, it is the first time to achieve biosynthesis of rosin in microbes. Cinnamyl alcohol is an important chemical raw material in the fragrance and flavoring industries.28 Previous studies have showed that cinnamyl alcohol could be produced from cinnamaldehyde by employing ADHs, and the biocatalytic process has been used for achieving cinnamyl alcohol on a preparative scale.29,30 De novo biosynthesis of cinnamyl alcohol in microbes has not been reported. In this study, we constructed an artificial biosynthetic pathway of cinnamyl alcohol by combining heterologous and endogenous enzymes. In previous studies, endogenous alcohol dehydrogenases and aldo-keto reductases of E. coli have been exploited for aromatic alcohol production, such as tyrosol, 4-aminophenylethanol, 2phenylethanol, and 2-(4-hydroxyphenyl)ethanol.31 The feeding experiment results showed that endogenous ADHs and AKRs displayed high catalytic efficiency with cinnamaldehyde as the substrate. Then on the basis of this result, we transported the biosynthetic pathway of cinnamaldehyde to achieve de novo biosynthesis of cinnamyl alcohol in E. coli. The production of cinnamyl alcohol reached 285.3 ± 15.2 mg/L by strain BPHE. The biosynthesis of cinnamaldehyde in E. coli has been realized, and surprisingly the production of cinnamyl alcohol was not reported.12 There was no cinnamaldehyde detected in our engineered E. coli strain. Glycosides with diverse bioactivities are present in various plants. Glycosylation can not only improve the solubility of aglycones but also increase their bioactivity and even endow a new pharmacological property.32 Rosin, a cinnamyl alcohol glycoside, is one of the important ingredients in R. rosea. As

■

DISCUSSION Plants produce various valuable phytochemicals with multiple biological activities. Those compounds are generally isolated 2133

DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135

Article

Journal of Agricultural and Food Chemistry Notes

native UGTs involved in the biosynthesis of rosin have not been identified in R. rosea, we need to screen substituted UGTs for glucosylation of cinnamyl alcohol. It is well documented that many UGTs from plants demonstrate flexibility toward substrates, especially aglycons.33 Previous studies reported that UGT73B6, UGT74R1, and UGT72B14 were the candidate enzymes involved in the salidroside biosynthesis in R. sachalinensis.34,35 In our previous work, we showed that UGT73B6 has good substrate tolerance toward aglycons including 4hydroxybenzyl alcohol, 4-hydroxybenzyl aldehyde, 4-hydroxybenzoic acid, and 4-methylumbelliferone, besides tyrosol.36,37 As cinnamyl alcohol shows structural similarity with tyrosol, the enzymes UGT73B6, UGT72B14, and UGT74R1 were tested for rosin biosynthesis. UGT73C5 from A. thaliana was originally identified as a mycotoxin-detoxifying enzyme.38 Studies showed that it had the ability of glucosylating a number of structurally diverse acceptor substrates, such as brassinolide, sapogenins, oleanolic acid, hederagenin, betulinic acid, and small aromatic compounds.39−41 Therefore, we also recruited UGT73C5 for the biosynthesis of rosin. The results of biosynthesis of rosin using the four candidate UGTs showed that UGT73B6 and UGT73C5 could glucosylate cinnamyl alcohol, forming rosin. The results implied that UGT73C5 was a better biocatalyst for glucosylation of cinnamyl alcohol in our experiments. However, cinnamyl alcohol was not totally transformed, which indicated the glucosylation was still the limiting step for the biosynthesis of rosin. We sought to further enhance rosin production by metabolic flux enhancement toward the precursor. Phenylalanine, an essential precursor for the synthesis of rosin, was overproduced by genetic manipulations of host strain BL21 (DE3). First, the regulatory gene tyrR was deleted for alleviating transcriptional control of relevant genes involved in phenylalanine biosynthesis. In addition, two competing pathways leading to the biosynthesis of tyrosine and tyrptophan were blocked by knocking out the key genes tyrA and trpE, respectively. The biosynthesis of rosin was improved 52.4% after enhancement of phenylalanine biosynthesis. In summary, this work lays a significant foundation for not only fermenting the production of rosin but also elucidating the biosynthetic pathway of rosavin and rosarin in the future. Improvement of UGT activity is being conducted by enzyme mining or protein engineering in our laboratory.

■

The authors declare the following competing financial interest(s): This work has been included in a patent application by the Tianjin Institute of Industrial Biotechnology.

■

ABBREVIATIONS USED PAL, phenylalanine ammonia-lyase; 4CL, hydroxycinnamate:CoA ligase; CCR, cinnamyl-CoA reductase; ADH, alcohol dehydrogenase; UGT, UDP-glucosyltransferase; PCR, polymerase chain reaction; AKR, aldo-keto reductase; IPTG, isopropyl-β-D-thiogalactopyranoside; OD600, optical density at 600 nm; HPLC, high-performance liquid chromatography; LCMS, liquid chromatography−mass spectrometry; NMR, nuclear magnetic resonance; BV, bed volume; tyrR, transcriptional regulator gene; tyrA, fused chorismate mutase T/prephenate dehydrogenase gene; trpE, tryptophan synthase gene

■

REFERENCES

(1) van Diermen, D.; Marston, A.; Bravo, J.; Reist, M.; Carrupt, P. A.; Hostettmann, K. Monoamine oxidase inhibition by Rhodiola rosea L. roots. J. Ethnopharmacol. 2009, 122 (2), 397−401. (2) Huang, S. C.; Lee, F. T.; Kuo, T. Y.; Yang, J. H.; Chien, C. T. Attenuation of long-term Rhodiola rosea supplementation on exhaustive swimming-evoked oxidative stress in the rat. Chin. J. Physiol. 2009, 52 (5), 316−324. (3) Zsuzsanna, G. Glucoside production by in vitro Rhodiola rosea cultures. Acta Universitatis Ouluensis C Technica 244; Oulu University Press: Oulu, Finland, 2006. (4) Sidjimova, B.; Valyovska-Popova, N.; Peev, D. Reproductive capacity of four medicinal plants in Nature Park “Rilsky Manastir” − West Bulgaria. J. BioSci. Biotechnol. 2014, 177−180. (5) Platikanov, S.; Evstatieva, L. Introduction of wild golden root (Rhodiola rosea L.) as a potential economic crop in Bulgaria. Econ. Bot. 2008, 62 (4), 621−627. (6) Kołodziej, B.; Sugier, D. Selected elements of biology and morphology of roseroot in south-eastern Poland. Acta Sci. Pol.− Hortorum Cultus 2012, 11 (5), 127−142. (7) Kishida, M.; Akita, H. Simple synthesis of phenylpropenoid β-Dglucopyranoside congeners based on Mizoroki-Heck type reaction of organoboron reagents. Tetrahedron Lett. 2005, 46 (23), 4123−4125. (8) Grech-Baran, M.; Syklowska-Baranek, K.; Pietrosiuk, A. Biotechnological approaches to enhance salidroside, rosin and its derivatives production in selected Rhodiola spp. in vitro cultures. Phytochem. Rev. 2015, 14 (4), 657−674. (9) Grech-Baran, M.; Syklowska-Baranek, K.; Krajewska-Patan, A.; Wyrwal, A.; Pietrosiuk, A. Biotransformation of cinnamyl alcohol to rosavins by non-transformed wild type and hairy root cultures of Rhodiola kirilowii. Biotechnol. Lett. 2014, 36 (3), 649−656. (10) Wang, J.; Guleria, S.; Koffas, M. A.; Yan, Y. Microbial production of value-added nutraceuticals. Curr. Opin. Biotechnol. 2016, 37, 97−104. (11) Wu, J.; Du, G.; Zhou, J.; Chen, J. Metabolic engineering of Escherichia coli for (2S)-pinocembrin production from glucose by a modular metabolic strategy. Metab. Eng. 2013, 16, 48−55. (12) Bang, H. B.; Lee, Y. H.; Kim, S. C.; Sung, C. K.; Jeong, K. J. Metabolic engineering of Escherichia coli for the production of cinnamaldehyde. Microb. Cell Fact. 2016, 15, 16. (13) van Summeren-Wesenhagen, P.; Voges, R.; Dennig, A.; Sokolowsky, S.; Noack, S.; Schwaneberg, U.; Marienhagen, J. Combinatorial optimization of synthetic operons for the microbial production of p-coumaryl alcohol with Escherichia coli. Microb. Cell Fact. 2015, 14, 79. (14) Jansen, F.; Gillessen, B.; Mueller, F.; Commandeur, U.; Fischer, R.; Kreuzaler, F. Metabolic engineering for p-coumaryl alcohol production in Escherichia coli by introducing an artificial phenylpropanoid pathway. Biotechnol. Appl. Biochem. 2014, 61 (6), 646−654.

AUTHOR INFORMATION

Corresponding Author

*(T.L.) E-mail: [email protected]. Phone: 0086-22-24828718. ORCID

Tao Liu: 0000-0002-7076-1273 Author Contributions

T.L., H.B., W.Z., and Y.M. designed the project. W.Z., H.B., Y.Z., Q.H., and Y.H. performed the experiments. W.Z., H.B., Y.Z., and T.L. analyzed the data. W.Z., T.L., H.B., and Y.Z. wrote the manuscript. Funding

This work was supported by grants from the 973 Program of China (2012CB721100), the National Natural Science Foundation of China (31300040, 21302214, and 31400026), the Biological Resources Service Plan of CAS (ZSTH-023), the Sciences and Technology Planning Projects of Tianjin city (13ZCZDSY05100), and the Youth Innovation Promotion Association CAS (2017207). 2134

DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135

Article

Journal of Agricultural and Food Chemistry (15) Chen, Z.; Sun, X.; Li, Y.; Yan, Y.; Yuan, Q. Metabolic engineering of Escherichia coli for microbial synthesis of monolignols. Metab. Eng. 2017, 39, 102. (16) Wanner, K. A. D. B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 2000, 97 (12), 6640−6645. (17) Atsumi, S.; Wu, T. Y.; Eckl, E. M.; Hawkins, S. D.; Buelter, T.; Liao, J. C. Engineering the isobutanol biosynthetic pathway in Escherichia coli by comparison of three aldehyde reductase/alcohol dehydrogenase genes. Appl. Microbiol. Biotechnol. 2010, 85 (3), 651− 657. (18) Pick, A.; Ruhmann, B.; Schmid, J.; Sieber, V. Novel CAD-like enzymes from Escherichia coli K-12 as additional tools in chemical production. Appl. Microbiol. Biotechnol. 2013, 97 (13), 5815−5824. (19) Ko, J.; Kim, I.; Yoo, S.; Min, B.; Kim, K.; Park, C. Conversion of methylglyoxal to acetol by Escherichia coli aldo-keto reductases. J. Bacteriol. 2005, 187 (16), 5782−5789. (20) Vanholme, R.; Storme, V.; Vanholme, B.; Sundin, L.; Christensen, J. H.; Goeminne, G.; Halpin, C.; Rohde, A.; Morreel, K.; Boerjan, W. A systems biology view of responses to lignin biosynthesis perturbations in Arabidopsis. Plant Cell 2012, 24 (9), 3506−3529. (21) Boerjan, W.; Ralph, J.; Baucher, M. Lignin biosynthesis. Annu. Rev. Plant Biol. 2003, 54, 519−546. (22) Zapesochnaya, G. G.; Kurkin, V. A. Glycosides of cinnamyl alcohol from the rhizomes of Rhodiola rosea. Chem. Nat. Compd. 1982, 18 (6), 685−688. (23) Ioset, K. N.; Nyberg, N. T.; Van Diermen, D.; Malnoe, P.; Hostettmann, K.; Shikov, A. N.; Jaroszewski, J. W. Metabolic profiling of Rhodiola rosea rhizomes by 1H NMR spectroscopy. Phytochem. Anal. 2011, 22 (2), 158−165. (24) Mudge, E.; Lopes-Lutz, D.; Brown, P. N.; Schieber, A. Purification of phenylalkanoids and monoterpene glycosides from Rhodiola rosea L. roots by high-speed counter-current chromatography. Phytochem. Anal. 2013, 24 (2), 129−134. (25) Ma, C. Y.; Tang, J.; Wang, H. X.; Gu, X. H.; Tao, G. J. Simultaneous determination of six active compounds in Rhodiola L. by RP-LC. Chromatographia 2008, 67 (5), 383−388. (26) Kurkin, V. A.; Dubishchev, A. V.; Ezhkov, V. N.; Titova, I. N.; Avdeeva, E. V. Antidepressant activity of some phytopharmaceuticals and phenylpropanoids. Pharm. Chem. J. 2006, 40 (11), 614−619. (27) Brown, R. P.; Gerbarg, P.; Zakir, R. Rhodiola rosea: a phytomedicinal overview. Herbal Gram 2002, 56, 40−52. (28) Letizia, C. S.; Cocchiara, J.; Lalko, J.; Lapczynski, A.; Api, A. M. Fragrance material review on cinnamyl alcohol. Food Chem. Toxicol. 2005, 43 (6), 837−866. (29) Pennacchio, A.; Rossi, M.; Raia, C. A. Synthesis of cinnamyl alcohol from cinnamaldehyde with Bacillus stearothermophilus alcohol dehydrogenase as the isolated enzyme and in recombinant E. coli cells. Appl. Biochem. Biotechnol. 2013, 170 (6), 1482−1490. (30) Chamouleau, F.; Hagedorn, C.; May, O.; Gröger, H. Biocatalytic aldehyde reduction using tailor-made whole-cell catalysts: a novel synthesis of the aroma chemical cinnamyl alcohol. Flavour Fragrance J. 2007, 22 (3), 169−172. (31) Koma, D.; Yamanaka, H.; Moriyoshi, K.; Ohmoto, T.; Sakai, K. Production of aromatic compounds by metabolically engineered Escherichia coli with an expanded shikimate pathway. Appl. Biochem. Biotechnol. 2012, 78 (17), 6203−6216. (32) Kren, V.; Martinkova, L. Glycosides in medicine: the role of glycosidic residue in biological activity. Curr. Med. Chem. 2001, 8 (11), 1303−1328. (33) Vogt, T.; Jones, P. Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci. 2000, 5 (9), 380−386. (34) Ma, L. Q.; Liu, B. Y.; Gao, D. Y.; Pang, X. B.; Lu, S. Y.; Yu, H. S.; Wang, H.; Yan, F.; Li, Z. Q.; Li, Y. F.; Ye, H. C. Molecular cloning and overexpression of a novel UDP-glucosyltransferase elevating salidroside levels in Rhodiola sachalinensis. Plant Cell Rep. 2007, 26 (7), 989− 999.

(35) Yu, H. S.; Ma, L. Q.; Zhang, J. X.; Shi, G. L.; Hu, Y. H.; Wang, Y. N. Characterization of glycosyltransferases responsible for salidroside biosynthesis in Rhodiola sachalinensis. Phytochemistry 2011, 72, 862− 870. (36) Bai, Y.; Bi, H.; Zhuang, Y.; Liu, C.; Cai, T.; Liu, X.; Zhang, X.; Liu, T.; Ma, Y. Production of salidroside in metabolically engineered Escherichia coli. Sci. Rep. 2014, 4, 6640. (37) Bai, Y.; Yin, H.; Bi, H.; Zhuang, Y.; Liu, T.; Ma, Y. De novo biosynthesis of gastrodin in Escherichia coli. Metab. Eng. 2016, 35, 138−147. (38) Poppenberger, B.; Berthiller, F.; Lucyshyn, D.; Sieberer, T.; Schuhmacher, R.; Krska, R.; Kuchler, K.; Glossl, J.; Luschnig, C.; Adam, G. Detoxification of the Fusarium mycotoxin deoxynivalenol by a UDP-glucosyltransferase from Arabidopsis thaliana. J. Biol. Chem. 2003, 278 (48), 47905−47914. (39) Poppenberger, B.; Fujioka, S.; Soeno, K.; George, G. L.; Vaistij, F. E.; Hiranuma, S.; Seto, H.; Takatsuto, S.; Adam, G.; Yoshida, S.; Bowles, D. The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids. Proc. Natl. Acad. Sci. U. S. A. 2005, 102 (42), 15253−15258. (40) Weis, M.; Lim, E. K.; Bruce, N.; Bowles, D. Regioselective glucosylation of aromatic compounds: screening of a recombinant glycosyltransferase library to identify biocatalysts. Angew. Chem., Int. Ed. 2006, 45 (21), 3534−3538. (41) Caputi, L.; Lim, E. K.; Bowles, D. J. Discovery of new biocatalysts for the glycosylation of terpenoid scaffolds. Chem.−Eur. J. 2008, 14 (22), 6656−6662.

2135

DOI: 10.1021/acs.jafc.7b00076 J. Agric. Food Chem. 2017, 65, 2129−2135