Proteomic Analysis of Hearts from Akita Mice Suggests That Increases

Article pubs.acs.org/jpr

Proteomic Analysis of Hearts from Akita Mice Suggests That Increases in Soluble Epoxide Hydrolase and Antioxidative Programming Are Key Changes in Early Stages of Diabetic Cardiomyopathy Shannamar Dewey,† Xianyin Lai,§ Frank A. Witzmann,§ Mandeep Sohal,† and Aldrin V. Gomes*,†,‡ †

Department of Neurobiology, Physiology and Behavior and ‡Department of Physiology and Membrane Biology, University of California, Davis, Davis, California 95616, United States § Department of Cellular & Integrative Physiology, Indiana University School of Medicine, Indianapolis, Indiana 46202, United States S Supporting Information *

ABSTRACT: Cardiovascular disease is the leading cause of diabetic morbidity with more than 10% of type 1 diabetes mellitus (T1DM) patients dying before they are 40 years old. This study utilized Akita mice, a murine model with T1DM progression analogous to that of humans. Diabetic cardiomyopathy in Akita mice presents as cardiac atrophy and diastolic impairment at 3 months of age, but we observed cardiac atrophy in hearts from recently diabetic mice (5 weeks old). Hearts from 5 week old mice were analyzed with a rigorous label-free quantitative proteomic approach to identify proteins that may play a critical role in the early pathophysiology of diabetic cardiomyopathy. Eleven proteins were differentially expressed in diabetic hearts: products of GANC, PLEKHN1, COL1A1, GSTK1, ATP1A3, RAP1A, ACADS, EEF1A1, HRC, EPHX2, and PKP2 (gene names). These proteins are active in cellular defense, metabolism, insulin signaling, and calcium handling. Further analysis of Akita hearts using biochemical assays showed that the cellular defenses against oxidative stress were increased, including antioxidant capacity (2−3-fold) and glutathione levels (20%). Immunoblots of five and twelve week old Akita heart homogenates showed 30% and 145% increases in expression of soluble epoxide hydrolase (sEH (gene name EPHX2)), respectively, and an approximate 100% increase in sEH was seen in gastrocnemius tissue of 12 week old Akita mice. In contrast, 12 week old Akita livers showed no change in sEH expression. Our results suggest that increases in sEH and antioxidative programming are key factors in the development of type 1 diabetic cardiomyopathy in Akita mice and reveal several other proteins whose expression may be important in this complex pathophysiology. KEYWORDS: diabetes mellitus (DM), diabetic cardiomyopathy (DC), heart, mass spectrometry (MS), murine

■

INTRODUCTION

investigation of bio-breeding diabetes-prone (BB-DP) rats, a spontaneous type 1 diabetes mellitus (T1DM) model, identified 43 proteins altered in the hearts of diabetic rats.8 Whole heart investigations of these models were conducted when the animals had diabetes for several weeks to months, and one common finding is significant changes in metabolic proteins, specifically mitochondrial enzymes. Hence, many subsequent proteomic approaches have chosen to focus on mitochondrial fractions.12−16 Previously, mitochondrial enriched fractions from 12 week old Akita Type 1 diabetic mouse tissues were assessed with LCMS/MS.16 This study, which analyzed brain, kidney, liver, and heart, found tissue specific changes in mitochondrial protein content.16 However, the only mitochondrial functional effects

Cardiac disease is the leading cause of morbidity and mortality in patients with diabetes.1 While ventricular dysfunction in diabetics can result from multiple cardiac etiologies, idiopathic failure of the diabetic heart, referred to as diabetic cardiomyopathy (DC), was first described in 1972.2 Different diabetic triggers result in intracellular cardiac disturbances, which include increased fatty acid oxidation, decreased glucose oxidation,3 disrupted protein synthesis, altered Ca2+ handling,4 build-up of advanced glycation end products, and accumulation of intracellular fatty acids.5,6 Currently, the increased incidence of heart failure in this diseased population is evidence that the current therapies are not sufficient. Proteomic approaches are valuable for identifying new hypotheses regarding disease pathogenesis7 and have been utilized in several diabetic models.8−11 High-throughput semiquantitative proteomics and 2D gel electrophoresis © 2013 American Chemical Society

Received: March 6, 2013 Published: July 12, 2013 3920

dx.doi.org/10.1021/pr4004739 | J. Proteome Res. 2013, 12, 3920−3933

Journal of Proteome Research

Article

Figure 1. Characterization of Akita mouse hearts. (A) Blood glucose levels of plasma at 2, 3, 4, 5, and 12 weeks of age indicate diabetic onset around 4 weeks. (B) Heart weight to tibia length ratios at 2, 3, 4, 5, and 12 weeks of age indicate significant cardiac atrophy at 5 weeks (n in each panel represents the number of animals used for these measurements). *P < 0.05. (C) Representative agarose gel displaying genotype results following FnuHI/SatI restriction digest of the 280 bp PCR product of the INS2 gene in Akita mice.

affected soon after hyperglycemic onset in the earliest stages of cardiomyopathy (5 weeks old). Hearts from 5 and 12 week old Akita mice were found to have increased antioxidant capacity, indicating an important role of cellular defense mechanisms in the early stages of diabetic cardiomyopathy. Increases in sEH levels have not been identified in previous proteomic investigations of diabetic mouse hearts. These findings suggest that cellular defense distress and impaired insulin signaling are potential determinants of early diabetic cardiomyopathy in Akita mice.

were observed in cardiac tissue, suggesting that cardiomyopathy associated with diabetes results from unique effects of diabetes on the heart.16 In total, 123 mitochondrial proteins (69 membrane proteins and 54 matrix proteins) were altered in the 12 week Akita diabetic hearts revealing trends of increased beta oxidation enzymes, decreased tricarboxylic acid cycle enzymes, and reduced oxidative phosphorylation machinery.16 Analysis of mRNA levels showed that expression level changes correlated with protein amounts regarding oxidative phosphorylation changes but were opposite to the protein effects seen in the beta oxidation pathway.16 This suggests that mRNA levels do not necessarily predict protein levels in diabetes, especially for proteins involved in oxidative metabolism. A study conducted in humans on asymptomatic cardiac T1DM patients suggests that diabetic cardiomyopathy pathogenesis begins early in diabetes.17 To investigate the pathophysiology of diastolic failure during early stages of diabetes, we conducted a label-free quantitative cardiac proteomics study of the young Akita mouse utilizing the newly developed IdentiQuantXL software.18 This method rigorously detects proteomic differences providing quality comparisons between two proteomes.18 Akita mice are a naturally occurring model of T1DM shown to have diastolic failure in the absence of systolic dysfunction at 12 and 24 weeks.19 One characteristic of Akita diabetic cardiomyopathy is cardiac atrophy,19 which we found to be significant in male mice as early as 5 weeks of age when the mice have been diabetic for approximately 1 week. This investigation identifies for the first time 11 proteins that are

■

EXPERIMENTAL ANIMALS This investigation was approved by the University of California, Davis, Institutional Animal Care and Use Committee and all aspects conformed to requirements set by the American Physiological Society’s Guiding Principles in the Care and Use of Animals. Wild type C57BL/6J females and diabetic C57BL/6J heterozygote Akita (Ins2WT/C96Y) males were purchased from Jackson Laboratories (Sacramento, CA, USA). Male heterozygote offspring and their male littermate wild type controls were used in all studies. Mice were given standard chow and water ad libitum and kept on a 12 h light/ dark cycle. DNA was purified from tail snips taken on weaning or after sacrifice for the purpose of genotyping. Heterozygotes were identified by restriction enzyme digest with FnuHI/SatI (Thermo Fisher Scientific, Waltham, MA) of the 280 bp PCR product of the Ins2 gene (forward primer TGC TGA TGC CCT GGC CTG CT; reverse primer TGG TCC CAC ATA TGC ACA TG). The FnuHI/SatI site is interrupted by the 3921



Article

normalized collision energy of 35%. Dynamic exclusion settings were set to repeat count 1, repeat duration 30 s, exclusion duration 120 s, and exclusion mass width 0.60 m/z (low) and 1.6 m/z (high). Six tandem mass spectra were acquired after each precursor scan. The parent mass width was set at ±0.5 m/ z. Peptide/Protein Identification and Quantification. The acquired data were searched against the UniProt mouse protein sequence database containing 55,191 protein sequences (released on April 18, 2012) using SEQUEST (v. 28, rev. 12) algorithms in Bioworks (v. 3.3). General parameters were set as follows: mass type set as “monoisotopic precursor and fragments”, enzyme set as “trypsin (KR)”, enzyme limits set as “fully enzymatic - cleaves at both ends”, missed cleavage sites set at 2, peptide tolerance set as 2.0 amu, fragment ion tolerance set as 1.0 amu, fixed modification set as +44 Da on cysteine, and no variable modifications were used. The searched peptides and proteins were validated by PeptideProphet,24 and ProteinProphet,25 in the Trans-Proteomic Pipeline (TPP, v. 3.3.0; http://tools.proteomecenter.org/software.php). Only proteins with probability ≥0.9000 and peptides with probability ≥0.8000 were reported. Protein quantification was performed using IdentiQuantXL software as described.18 Student’s t test was performed to determine the significance of differences between the two groups. Myoglobin/ABTS Antioxidant Assay. The antioxidant assay measured total antioxidant capacity of cardiac tissue based on the oxidation rate of ABTS (2,2′-azino-di-[3-ethylbenzthiazoline sulfonate]) by metmyoglobin.26,27 Tissue samples were homogenized in a glass dounce (Wheaton, USA) in ice-cold 1× assay buffer (50 mM potassium phosphate, 9% NaCl, 1% glucose, pH 7.4). Homogenates were centrifuged at 12 000g for 20 min at 4 °C. Supernatant was removed, immediately aliquoted, and stored at −80 °C. In a clear 96 well plate, 0.19 μM equine myoglobin (Sigma-Aldrich) was combined with 130.18 mM ABTS (Sigma-Aldrich) and either 30 μg of protein homogenate or Trolox standard (Calbiochem, San Diego, CA) was added. The reaction was started with addition of 84 μM hydrogen peroxide, incubated for 20 min, and absorbance was read at 415 nm. Trolox equivalent units were calculated from a Trolox standard curve, which ranged from 0 to 0.4 mM. RNA Extraction and cDNA Synthesis. Total RNA from each sample was extracted from frozen powdered tissue using the RNeasy mini kit (Qiagen Inc., Germany) according to the manufacturer’s protocol. The integrity and quantity of total RNA were measured by denaturing agarose gels. The quality of the isolated RNA was the expected 2:1 ratio of 28S to 18S rRNA and showed minimal smearing. One microgram of total mRNA from each sample was used for cDNA synthesis using a mix of random hexamer primers and oligo(dT) (QuantiTect Reverse Transcription kit, Qiagen) according to the manufacturer’s instructions. After cDNA synthesis, 20 μL of cDNA was diluted 20 times by addition of 380 μL of RNase-free water and used for quantitative PCR (qPCR). Quantification of Gene Expression by Quantitative RT-PCR (qRT-PCR). Quantitative PCR assays were performed using 25 ng of template cDNA and fast SYBR-green master mix (Applied Biosystems, Carlsbad, CA). A final reaction volume of 10 μL was used in 384-well qPCR plates. The reactions were performed on an AB 7900HT instrument (Applied Biosystems) using the following steps: an initial 5-min denaturation step at 95 °C followed by forty 40 s cycles at 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 15 s. All reactions were run in technical

C96Y mutation. Agarose gel electrophoresis identified WT mice as single 140 bp bands and heterozygote mutants as double bands, one at 240 bp and one at 140 bp (Figure 1). Tissue Collection

Prior to sacrifice, animals were fasted 3−4 h, and all sacrifices were performed between 12:00 and 2:00 pm. Mice were euthanized with isoflurane (3% inhalation), and blood glucose was measured from a tail tip puncture with a Contour glucometer (Bayer, Canada) followed by cervical dislocation. Hearts were immediately removed upon sacrifice, rinsed in icecold PBS, blotted, and weighed prior to being flash frozen (total time to freezing was less than 3 min). Hearts prepared in this manner have been previously shown to be excellent for subsequent proteomic analysis.20,21 The anterior left tibia was removed, cleared of soft tissue, and measured from the intercondylar ridge to the medial malleolus with a digital micrometer (Pittsburgh Pro, Calabasas, CA). Label-Free Quantitative Proteomics

Materials. DL-Dithiothreitol (DTT), urea, triethylphosphine, iodoethanol, and ammonium bicarbonate (NH4HCO3) were purchased from Sigma-Aldrich (St. Louis, MO, USA). LCMS grade 0.1% formic acid in acetonitrile (ACN) and 0.1% formic acid in water (H2O) were purchased from Burdick & Jackson (Muskegon, MI, USA). Modified sequencing grade porcine trypsin was obtained from Princeton Separations (Freehold, NJ, USA). Protein Extraction. Flash frozen hearts were powdered. Each tissue sample (about 30 mg) was immersed in 240 μL of lysis buffer (8 M urea, 10 mM DTT solution freshly prepared) and vortexed until no more tissue was dissolved. The homogenates were centrifuged at 15 000g for 20 min at 4 °C to remove insoluble materials. Fully solubilized samples were then stored at −80 °C until analysis. Protein concentration was determined by the Bradford protein assay using Bio-Rad protein assay dye reagent concentrate.22 Protein Reduction, Alkylation, and Digestion for LCMS/MS. Protein reduction, alkylation, and digestion were carried out using a conventional method previously published by Lai et al.23 Briefly, a 100 μg aliquot of protein sample was placed in a 2 mL tube. The volume of the sample was adjusted to 200 μL. Reduction/alkylation cocktail (200 μL) consisting of 0.5% of triethylphosphine and 2% of iodoethanol was added to the protein solution. The sample was incubated at 35 °C for 60 min, dried by SpeedVac, and reconstituted with 100 μL of 100 mM NH4HCO3 at pH 8.0. A 150 μL aliquot of a 20 μg/mL trypsin solution was added to the sample, and the sample was incubated at 35 °C for 3 h, after which another 150 μL of trypsin was added, and the solution was incubated at 35 °C for 3 h. LC-MS/MS. The digested samples were analyzed using a Thermo-Finnigan linear ion-trap (LTQ) mass spectrometer coupled with a Surveyor autosampler and MS HPLC system (Thermo-Finnigan). Tryptic peptides were injected onto a C18 reversed phase column (TSKgel ODS-100 V, 3 μm, 1.0 mm × 150 mm) at a flow rate of 50 μL/min. The mobile phases A, B, and C were 0.1% formic acid in water, 50% ACN with 0.1% formic acid in water, and 80% ACN with 0.1% formic acid in water, respectively. The gradient elution profile was as follows: 10% B (90% A) for 7 min, 10−67.1% B (90−32.9% A) for 163 min, 67.1−100% B (32.9−0% A) for 10 min, and 100−50% B (0−50% C) for 10 min. Data was collected in the “Data dependent MS/MS” mode with the ESI interface using 3922



Article

Medicine Pathology Core). Paraffin was removed from the slides by three 5 min washes in Histo-Clear (National Diagnostics, Atlanta Georgia). Slides were then rehydrated with the following sequence: 100% ethanol (Sigma Aldrich) two times for 10 min, 95% ethanol two times for 10 min, and finally distilled water two times for 5 min. Antigen unmasking was carried out in Pro-Histo unmasking solution (ProHisto, LLC, SC). Slides were blocked for 60 min with diluted goat serum (Vectastatin). Blocking solution was aspirated and antisEH (1:500) diluted in Pro-Histo antibody dilution buffer was applied and incubated overnight at 4 °C. Following incubation, slides were rinsed three times for 5 min with PBS buffer and incubated for 90 min with fluorochrome-conjugated secondary antibody, Alexa 649 or Dylight 549 (1:1000), diluted in ProHisto antibody dilution buffer. Slides were rinsed in PBS as before, and coverslips were applied with Prolong Gold AntiFade Reagent (Invitrogen) and cured overnight at room temperature in the dark. Hearts were imaged with an inverted Olympus IX81 microscope equipped with a Fluoview FV1000 laser module and an oil immersion object lens. Images were taken using the Fluoview software. All images were taken using the lasers at the same intensity. National Institutes of Health Image J software was used for merging images. Statistics. Results are expressed as mean ± SD from at least three independent experiments. The comparisons were performed using the Student’s t test or one-way ANOVA. Values of P < 0.05 were defined as statistically significant.

triplicates, and the expression of all target genes was detected in four different biological samples (n = 4). The results were calculated using the Pfaffl quantification method,28 normalized to GAPDH. The primer sets used were as follows: GANC forward CAGCTCACCAAGACTACCACC, reverse CCACGAGAGGAATCTTAGTTGCT; EPHX2 forward ACCACTCATGGATGAAAGCTACA, reverse TCAGGTAGATTGGCTCCACAG; GAPDH forward CCAGCCTCGTCCCGTAGAC, reverse ATGGCAACAATCTCCACTTTGC; GPX1 forward CCTCAAGTACGTCCGACCTG, reverse CAATGTCGTTGCGGCACACC; HOXO1 forward TCGGAGGGGGTAGATGAGTC, reverse GCTTCCTTGGTCCCTTCCTT; SODCUZN forward AAGGCCGTGTGCGTGCTGAA, reverse CAGGTCTCCAACATGCCTCT. Western Blot Analysis. Heart lysates were prepared in lysis buffer (50 mM Tris, 1 mM EDTA, 150 mM NaCl, 5 mM MgCl2, 0.5 mM DTT). Equal amounts of protein were subjected to electrophoresis on 4−20% Criterion polyacrylamide gels (Bio-Rad, CA) under reducing conditions and transferred to nitrocellulose membranes (Bio-Rad, CA). Membranes were stained with Ponceau S and then blocked for 1 h with 3% nonfat dry milk in TBS, pH 7.4, containing 0.05% (w/v) Tween 20 (TTBS). The membranes were washed three times in TTBS and probed for 2 h with anti-mouse-sEH (kindly provided by Dr. Bruce Hammock, UC Davis). Following primary antibody incubation, the membranes were washed and incubated with horseradish peroxidase-conjugated sheep anti-rabbit IgG (Sigma, St. Louis) for 1 h. HRP detection was done using Pierce Dura West ECL substrate, and images were obtained on a ChemiDoc MP imager (Bio-Rad) controlled by Image Lab 4.1 (Bio-Rad). Quantitation of blots was performed using Image Lab 4.1. Oxyblot Procedure. Carbonyl content of total protein was measured by conjugation of 2,4-dinitrophenylhydrazine (DNPH) to carbonyl groups followed by immunoblot probing of DNPH and quantification. This measurement is representative of the general oxidative conditions within the tissue being evaluated. Equal volumes of heart lysate (∼25 μg) and 12% sodium dodecyl sulfate (SDS) were combined. A volume of 2× DNPH equal to the volume of heart lysate was added, and the mixture was incubated at room temperature for 15 min. A volume equal to half the current reaction volume of neutralization solution (Millipore, Temecula, CA) was added followed by 3 μL of 2-mercaptoethanol. The samples were then subjected to electrophoresis on 4−20% Criterion polyacrylamide gels (Bio-Rad, CA) and transferred to nitrocellulose membranes (Bio-Rad, CA). The membranes were treated as described in the Western Blot Analysis section utilizing the primary antibody rabbit anti-DNP (Millipore, Temecula, CA). Glutathione Quantification Assay. Total GSH per gram of protein was determined utilizing a GSH/GSSH kit from Cayman Chemical following their protocol. Powdered heart tissue was homogenized in ice-cold phosphate buffer (50 mM potassium phosphate, 1 mM EDTA, pH 6.7). Immunofluorescence Microscopy. Immediately following sacrifice, hearts were rinsed and incubated in ice-cold relaxing solution (100 mM KCl, 10 mM imidazole, 2 mM EGTA, 5 mM MgCl2, 4 mM ATP, pH 7.0) for 5 min. Hearts were blotted, sliced longitudinally, submerged in 4% paraformaldehyde, and incubated for 24 h at room temperature with continuous rotation. Hearts were then rinsed in ice-cold PBS and transferred to 70% ethanol (Sigma Aldrich) at 4 °C, embedded in paraffin, and sliced (performed by UC Davis Vet

■

RESULTS

Characterization of Male Akita Mice

These mice were found to be diabetic beginning around 4 weeks of age when blood glucose reached above 400 mg/dL (Figure 1A). By 5 weeks of age, the heart weight to tibia length ratio showed statistically significant cardiac atrophy (Figure 1B). It is well established that 12 week old male Akita mice show diastolic heart failure and among other complications, pronounced cardiac atrophy resulting from a decrease in myocyte volume.19 However, this model has never been investigated early in diabetic cardiomyopathy pathogenesis. The decrease in heart size shown in Figure 1 is the first indication that cardiomyopathy in the Akita mouse is detectable soon after becoming diabetic. Label-Free Proteomic Quantification

Several methods of label-free protein quantification exist. In this study, we utilized IdentiQuantXL, a novel alignment approach utilizing four different filters.18 Each sample digest (n = 3 per group) was injected twice, in random order. Following the application of four filters (peptide frequency, peptide retention time, peptide CV, and peptide correlation), 919 unique proteins were identified from 5,747 peptides. This high-quality information was compared between wild-type and 5 week old diabetic Akita mice, revealing 11 proteins that were significantly different (P < 0.05). The average CV across all proteins in controls and diabetics was 18.3% and 13.2%, respectively. In general, several insulin signaling related proteins as well as cellular defense/stress response cardiac proteins were affected at this early stage of diabetes (Figure 2). Plekhn1, Eef1a1, Atp1a3, Col1a1, Hrc, and Pkp2 were suppressed and Acads, Gstk1, Ganc, Rap1a, and sEH were elevated (Table 1). Spectra of peptides from four of the differentially expressed proteins are shown in Figure 3. 3923



Article

human samples, they do not work well for murine samples although they are sold as recognizing the respective murine target. The only antibody that reacted with a single band at the appropriate molecular weight for that protein was the sEH (soluble epoxide hydrolase) antibody. sEH inhibition has been shown to regulate blood glucose level during type 1 diabetes in the absence of insulin replacement.29 This protein hydrolyzes epoxyeicosatrienoic acids (EETs) into diols (DHETs) thus removing the beneficial EET, negatively impacting the EET/ DHET ratio.30 Inhibition of sEH has proven cardioprotective results.30,31 Thus we further investigated sEH protein levels in male Akita mice before they were diabetic (3 weeks), at a transitional age (4 weeks), when they were recently diabetic (5 weeks), and when they had established diabetes (12 weeks). Three and four week mice had no changes is sEH levels, but at 5 weeks, sEH was elevated by approximately 30%, and by 12 weeks, the increase in sEH in diabetic mice compared with levels in healthy mice was over 140% (Figure 4). This is the first time that sEH levels have been shown to correlate with disease progression in diabetic hearts, and these results suggest that arachidonic acid metabolism, specifically the fate of EETs, may play a key role in the pathophysiology of diabetic cardiomyopathy. Furthermore, the protein level of sEH was investigated in two other tissues, skeletal muscle and liver (Figure 5). Interestingly, the levels of sEH in the liver were not increased in 5 week and 12 week old diabetic mice, while sEH levels in skeletal muscle were not affected at 5 weeks of age but were increased approximately 140% by 12 weeks (similar to

Figure 2. Summary of results for the proteomic analysis of Akita and wild-type mouse hearts. Biological processes in which differentially expressed proteins are involved as identified using the gene ontology (GO) biological processes classification.

Independent Validation by Western blotting

Several antibodies were tested to complement the proteomic results via Western blotting. These antibodies included Hrc, Pkp2, Ganc, and Gstk1 (Santa Cruz) and Gstk1 (Protein Tech), as well as sEH (generously donated by Dr. Hammock, UCD). While many of these antibodies seem to work well with

Table 1. Proteins That Are Differentially Expressed in Hearts from 5 Week Old Akita Mice

protein entry

gene name

A2AQJ8_MOUSE PKHN1_MOUSE

Ganc Plekhn1

F8WGB7_MOUSE GSTK1_MOUSE Q8VCE0_MOUSE RAP1A_MOUSE F6RAZ3_MOUSE

D3YZ68_MOUSE G5E8J6_MOUSE HYES_MOUSE Q9CQ73_MOUSE protein entry A2AQJ8_MOUSE PKHN1_MOUSE F8WGB7_MOUSE GSTK1_MOUSE Q8VCE0_MOUSE RAP1A_MOUSE F6RAZ3_MOUSE D3YZ68_MOUSE G5E8J6_MOUSE HYES_MOUSE Q9CQ73_MOUSE

protein name

protein probability

protein coverage, %

glucosidase alpha neutral C 0.9822 1.31 probable pleckstrin homology 0.9161 2.84 domain-containing family N member 1, isoform 2 Col1a1 collagen α-1(I) chain 0.9982 3.1 Gstk1 glutathione S-transferase κ1 0.9706 8.85 0.9832 1.04 Atp1a3 ATPase, Na+/K+ transporting, α3 polypeptide Rap1a Ras-related protein Rap-1A 0.9907 6.52 Acads short-chain-specific acyl-CoA 1 25.5 dehydrogenase, mitochondrial (fragment) Eef1a1 elongation factor 1-α1 1 9.64 (fragment) Hrc histidine-rich calcium binding 0.9985 1.76 protein, isoform CRA_a Ephx2 isoform 2 of epoxide 1 7.09 hydrolase 2 Pkp2 plakophilin 2 0.9998 6.67 mean control mean diabetic STDEV control STDEV diabetic 734 750 2 444 050 1 606 753 1 550 433 544 071 223 955 8 008 636 2 631 290 800 583 679 018 1 648 037

996 858 1 685 058 1 320 800 1 904 417 390 142 304 843 9 018 683 1 727 550 675 372 972 784 1 356 363

21 773 130 032 60 930 91 671 42 725 31 102 270 017 334 298 18 632 131 746 92 028

35 554 192 641 78 879 101 030 62 301 26 628 508 194 395 728 70 646 111 850 159 653 3924

no. of unique sequences/no. of identified peptides/total no. of identified spectra

protein frequency (entire project), %

protein frequency (group C)/protein frequency (group D), %

1/1/1 1/1/2

8.3 8.3

0.0/16.7 16.7/0.0

2/2/2 1/1/1 1/1/1

41.7 16.7 8.3

66.7/16.7 33.3/0.0 16.7/0.0

1/1/1 6/6/10

25.0 100.0

16.7/33.3 100.0/100.0

2/2/3

16.7

16.7/16.7

1/1/1

41.7

66.7/16.7

2/2/2

25.0

33.3/16.7

3/3/3 CV(%) control

CV(%) diabetic

3.0 5.3 3.8 5.9 7.9 13.9 3.4 12.7 2.3 19.4 5.6

3.6 11.4 6 5.3 16.0 8.7 5.6 22.9 10.5 11.5 11.8

41.7 50.0/33.3 FC diabetic/control p value 1.4 −1.5 −1.2 1.2 −1.4 1.4 1.1 −1.5 −1.2 1.4 −1.2

0.0004 0.005 0.008 0.01 0.02 0.03 0.04 0.04 0.04 0.04 0.05



Article

Figure 3. Annotated mass spectra of peptides from four of the proteins found to be differentially expressed in 5 week old Akita hearts. Annotated peptides from sEH, Hrc, pkp2, and eEF1A-1 are shown.

12 weeks of age (Figure 8A). These results suggest that the proteomic alterations discovered in this study are not all due to transcriptional activation or suppression.

what was observed in hearts). These results suggest that the EET/DHET ratio is affected by diabetes in contractile muscle in general but that the heart may be affected before skeletal muscle.

Localization of sEH in Hearts

Characterization of Oxidized Protein Levels in Akita Hearts

The localization of sEH in hearts was determined by immunofluorescence (Supplementary Figure 3, Supporting Information). Epoxide hydrolase seems to be predominantly cytosolic in the heart. The nuclei (stained with DAPI) showed no staining for sEH. While we observed stronger fluorescence for sEH in 12 week old Akita hearts compared with that in wildtype hearts, the relative localization of sEH was similar in all six hearts investigated (three Akita and three wild-type).

The level of oxidized protein was assessed by derivatization of protein carbonyl groups with DNPH and then detection of the derivatized groups by antibodies specific to the attached DNP moiety of the proteins (Figure 6). The oxidized protein levels in 5 and 12 week old hearts were found to be similar between Akita and wild-type hearts. RT-qPCR of sEH and GANC Gene Expression

RT-qPCR of Oxidative Defense Related Gene Expression

Protein expression sometimes correlates with transcriptional regulation; however, post-translational alterations in protein stability or half-life effects can equally determine the amount of viable protein present in a cell. To determine whether the elevated sEH levels were due to changes in transcriptional regulation, qPCR was carried out on hearts from 3 to 12 week old male mice. The gene for sEH, EPHX2, was unchanged at 3 and 4 weeks but increased approximately 40% at five and 140% at twelve weeks of age (Figure 7). Hence the mRNA expression correlates well with the sEH protein expression in Akita hearts. These results indicate that sEH is under heavy transcriptional regulation, which is affected significantly by the diabetic pathology, either by extracellular hyperglycemia or hypoinsulinemia. GANC, the gene encoding neutral α-glucosidase C, a member of the glycosyl hydrolase gene family 31, was the most statistically significantly differentially expressed protein.32 Because no commercial antibody that recognizes murine GANC exists, we also utilized RT-qPCR to determine whether this gene expression is affected in Akita mice. Our results suggest that this gene is not affected in the diabetic mice at 5 or

Because the proteomic results suggest that glutathione transferase K1 (GSTK1) protein levels were increased in 5 week old diabetic hearts, the genes of several other oxidative defense proteins were investigated (Figure 8B). While glutathione peroxidase 1 (GPX1) and heme oxygenase 2 (HOMOX2) were not affected at the transcriptional level, Cu/ Zn superoxide dismutase (SODCUZN) was increased about 50% in 5 week old diabetic hearts. Superoxide dismutases are key antioxidant enzymes, and this increased expression supports the findings that antioxidant capacity is altered in diabetic mice at least partly via transcriptional regulation. Antioxidant Capacity of Akita Hearts

To further analyze the antioxidant function in these mice, specifically through the function of glutathione, we measured the absolute amount of glutathione (GSH) present in the cardiac tissue (Figure 9). Hearts from 12 week old Akita mice had 0.25 μmol/g of GSH compared with 0.22 μmol/g of GSH in hearts from age-matched wild-type mice (P < 0.03). Increased glutathione content implicates an enhanced ability 3925



Article

Figure 4. Validation of increased soluble epoxide hydrolase in hearts from Akita mice by Western blotting. Western blots of sEH levels and total protein ponceau stains (used as loading controls) and corresponding semiquantitative bar graphs for hearts at (A) 3 weeks, (B) 4 weeks, (C) 5 weeks, and (D) 12 weeks of age. *P < 0.05.

Figure 5. Soluble epoxide hydrolase protein expression in skeletal muscle from Akita mice. Western blots of sEH levels and total protein ponceau stains (used as loading controls) and corresponding semiquantitative bar graphs for skeletal muscle at 5 weeks and 12 weeks of age. *P < 0.05.

ability of diabetic Akita hearts to face the increased oxidative challenge associated with diabetes. The antioxidant capacities of the hearts were measured utilizing the myoglobin/ABTS

to remove oxidative challenges from the cell. This adaptation may be important for cardiac survival but could have negative effects on cellular efficiency. We also measured the overall 3926



Article

Figure 6. Characterization of levels of oxidized proteins in Akita hearts. Oxidized proteins in heart lysates from 5 and 12 week old hearts were determined by the oxyblot method. Carbonyl residues were derivatized with DNPT and subsequently detected by Western blotting using anti-DNP (n = 4).

Figure 7. Gene expression analysis of soluble epoxide hydrolase. Gene expression at 3, 4, 5, and 12 weeks of age (n = 4) was carried out using RTqPCR. Values represent fold change in mRNA transcript levels relative to wild-type mice and normalized to GAPDH expression. *P < 0.05.

antioxidant assay.26,33 This assay revealed an approximate 3-fold increased antioxidant capacity in Akita hearts at both 5 and 12 weeks. Antioxidant capacity is determined by several cellular defense mechanisms, which could all be affected independently

by diabetes. While increases in GSTK1 protein and SODCUZN mRNA levels suggested that antioxidant capacity could be increased, this assay collectively analyzes the entire antioxidative system within cardiac cells. The early response of cardiac 3927



Article

Figure 8. Gene expression analysis of GANC and stress-related genes. (A) GANC gene expression at 5 and 12 weeks of age (n = 4) was carried out using RT-qPCR. (B) HOMOX2, SODCUZN, and GPX1 gene expression at 5 and 12 weeks of age (n = 4) was carried out using RT-qPCR. Values represent fold change in mRNA transcript levels relative to wild-type mice and normalized to GAPDH expression. *P < 0.05.

cells to minimize oxidative stress is an important finding of this study.

■

Proteins Involved in Cellular Defense

At 5 and 12 weeks of age, oxidative stress as determined by oxyblots was not elevated in hearts from Akita mice, but the overall antioxidant capacity was increased by almost 200%. The increased antioxidant capacity may be important in preventing increased protein oxidation. The glutathione (GSH) concentration was also increased approximately 20% at 12 weeks. In addition, as sEH inhibition has been implicated as a possible treatment for several cardiac conditions, we investigated its expression through the development of diabetes and found an age-related response. The results of this study highlight several proteins whose altered expression may play a role in the early pathogenesis of diabetic cardiomyopathy and specifically support a role for stressed cellular defense mechanisms and suppressed insulin signaling.

DISCUSSION

Humans with T1DM have shown early diastolic failure prior to experiencing cardiac disease symptoms.17 The pathogenesis of diabetic cardiomyopathy (DC), failure of the left ventricle in the absence of typical heart failure etiologies, begins early in diabetes. Proteomic analysis at this stage may provide useful insight into its prevention and treatment. The Akita mouse model is a spontaneously occurring model of T1DM with a disease progression that recapitulates that of humans and allows for investigation at early stages of heart disease.19 Akita mice experience diabetic cardiomyopathy characterized by diastolic heart failure, atrophy, and expression of fetal genes in the absence of fibrosis.19 Utilizing this model and a rigorous gelfree proteomics approach, we identified 11 proteins altered early in T1DM progression. Plekhn1, Eef1a1, Atp1a3, Col1a1, Hrc, and Pkp2 were suppressed, while Acads, Gstk1, Ganc, Rap1a, and sEH were elevated in hearts from male Akita mice at 5 weeks of age. Since several of these proteins are linked to oxidative stress, which is often associated with diabetes, we assessed the oxidative stress, antioxidant capacity, and glutathione content in diabetic hearts.

Soluble Epoxide Hydrolase (sEH)

In this study, sEH gene and protein expression were found to be greatly increased in Akita mice at 5 weeks of age and further increased by 12 weeks. This is the first time that expression of sEH has been analyzed during diabetic disease progression. Quantitative PCR results suggest that the elevated protein levels are largely due to transcriptional regulation, indicating a cellular program targeted at activating this pathway. It is interesting to note that sEH protein levels were also increased in diabetic gastrocnemius tissue by 12 weeks of age with no 3928



Article

Figure 9. Antioxidant capacity of hearts from Akita mice and Quantitation of Glutathione levels in Akita mouse hearts. (A) Antioxidant capacity of cardiac homogenates at 5 and 12 weeks of age were carried out using 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS)/metmyoglobin. Antioxidant activity is measured relative to the antioxidant Trolox and reported in Trolox equivalent units (n = 5). *P < 0.05. (B) Glutathione levels in 12 week old mice were measured using a colorimetric glutathione reductase recycling assay provided in a kit from Cayman Chemical (n = 4). *P < 0.05.

changes seen in liver sEH protein levels (Figure 5 and Supplementary Figure 1, Supporting Information). In the BBDP diabetic rat model, 341 differentially expressed proteins were found in rat liver compared with only 43 differentially expressed proteins in the heart.8 These findings suggest that increased levels of sEH are important for diabetic effects on striated muscle but not necessarily all insulin-responsive organs. Since 5 week old gastrocnemius tissue from Akita mice did not show any increases in sEH levels, these results also suggest that sEH may be functionally more important in heart muscle than gastrocnemius tissue in early stages of diabetes. If increased sEH levels are associated with muscle atrophy, then we would expect atrophy in the 12 week old gastrocnemius tissue, which is what was observed (Supplementary Figure 1, Supporting Information). While the amount of sEH in the Akita heart increases relative to wild-type hearts, immunofluorescence of heart sections suggests that the localization of sEH was not significantly changed between the two groups of mice. sEH, encoded by the gene EPHX2, converts the arachidonic acid metabolites, epoxyeicosatrienoic acids (EETs), into diols (DHETs).30 Mutations in sEH have been shown to be associated with familial hypercholesterolemia, progression of human IgA nephropathy, and subclinical cardiovascular disease.34−36 EETs have been shown to affect cardiovascular homeostasis through anti-inflammatory action, vasodilation, angiogenesis, and platelet aggregation; and they are generally beneficial to the heart.31,37 Vascular actions of EETs include dilation, angiogenesis, increased coronary blood flow, decreased inflammation, and platelet aggregation and maintenance of vascular homeostasis. As such, any increase in sEH would reduce EET levels and disturb the EET/DHET ratio, producing deleterious effects. sEH inhibitors have been shown to provide cardioprotection against ischemia reperfusion injury, hyper-

tension, cardiac hypertrophy, atherosclerosis, and ischemic stroke.30,38,39 The beneficial effects of pharmacological inhibition of sEH on hypertension were demonstrated to be directly related to its role in EET conversion.40 Data from a high fat fed T2DM murine model suggested a role of sEH in insulin signaling and glucose homeostasis,41 while another investigation on sEH and T1DM concluded that inhibition of sEH or knocking out the EPHX2 gene attenuated hyperglycemic development, prevented islet cell apoptosis, and improved glucose-stimulated insulin release in streptozotocintreated mice.29 Interestingly, this model of diabetes is created by toxic assault on the pancreas, which may conceivably be directly impacted by the anti-inflammatory effect of EETs. Inhibition of sEH has been shown to have beneficial effects on glucose homeostasis and islet damage in a streptozotocininduced diabetic mouse model and to provide cardioprotection in hyperglycemic rats.31,42 These results are interesting considering recent results that suggest that high glucose levels suppress sEH expression.43 Interestingly, one promising pharmacological approach to prevent the development of diabetic cardiovascular complications is to improve endothelial function through increased availability of EETs.44 It seems that most of the damage that is prevented by sEH inhibition is at the mitochondrial level. Recently, a sEH inhibitor was shown to protect mitochondrial function following stress associated with ischemia reperfusion injury.45 While the evidence in streptozotocin-treated mice is compelling support for a role of sEH inhibition as treatment for diabetes, we show for the first time that sEH levels are elevated at diabetic onset and increase with diabetes progression. Since the Akita mouse model of T1DM is naturally occurring, it is free from toxic side effects as are sometimes observed in druginduced diabetes or transgenic animals. Our findings 3929



Article

regulator of glycogen metabolism through cleavage of glycogen hydrolysis products into glucose.52 Inhibition of GANC by miglitol was shown to normalize blood glucose levels and reduce cytokine production in T2DM.53 GANC activity was increased in hypertensive diabetic rat aortas,54 and multiple GANC inhibitors are available on the market for T2DM treatment.53 While the chromosomal location of GANC has been associated with susceptibility to T2DM in humans,55 its role in the T1DM heart has not been investigated. Deficiency in GANC has been associated with lysosomal storage or Pompe disease in both heart and skeletal muscle.56 However, the likely effects of elevated GANC levels on the diabetic heart are unknown. Perhaps elevated GANC levels result in increased intracellular glucose levels as a compensation for deficient insulin signaling. Certainly enhanced breakdown of glycogen could lead to depletion or deficiency in that source over time. Cardiac glycogen has been demonstrated to play a critical role in cardiac development and is the preferred source for cardiac glucose.57 Impaired glycogen storage would become more critical during stress situations such as exercise or during the flight response. This is likely one of the contributing stresses that result in major metabolic pathway disturbances including increased reliance on β-oxidation and decreased glycolytic pathway enzymes.16,19 In agreement with previous literature on metabolic enzyme effects in diabetes, mitochondrial short-chain-specific-acyl-CoA dehydrogenase (Acad) was increased in 5 week old Akita mice.16 Acyl-CoA dehydrogenases are among the first enzymes active in β-oxidation. A variant of the Acad allele was found to impair β-oxidation, and in a study of over 8,000 Danish people, the variant was correlated with reduced glucose-stimulated insulin release58 suggesting a role in T2DM pathogenesis. Basu et al.19 discovered increased expression of mitochondrial longchain acyl-CoA dehydrogenase and pyruvate dehydrogenase kinase isoform 4 (PDK4) in 3 month old hearts from Akita mice. We observed elevated PDK4 mRNA expression as early as 3 weeks of age (Supplementary Figure 1, Supporting Information). Our results suggest that the elevation in fatty acid oxidation previously reported in diabetic tissue19 is in fact important during the earliest stages of DC pathogenesis. Metabolic challenges faced by mitochondria in the diabetic heart significantly affect cardiac function, and it is likely that these disturbances affect oxidative stress related gene levels thus providing one influence on the antioxidative pathways previously discussed.

independently support that sEH inhibition may be a beneficial pharmaceutical approach to managing T1DM and could be particularly useful in targeting diabetic cardiomyopathy development, especially early in diabetes progression. Glutathione Transferase κ1 (GSTK1)

Our results suggest that glutathione transferase κ1 (GSTK1) is up-regulated in the heart in early stages of T1DM. The GST superfamily is composed of six subfamilies, α, μ, ω, π, θ, and ζ, which are active in antioxidant and detoxification pathways.46 GSTK1 is a GST-like enzyme first described in 1996,47 and its active site is 19% homologous with the θ family in humans.48 Canonical GST detoxification occurs through the conjugation of the thiol group of glutathione (GSH) to electrophilic regions of multiple hydrophobic substrates facilitating their removal from the cell.49 Mouse GSTK1 was previously shown to be expressed highly in liver and kidneys and to a lesser extent in heart, skeletal muscle, lung, and brain.50 These tissues, particularly liver and kidneys, are exposed to high levels of oxidative challenges, indicating that GSTK1 is positioned appropriately for a role in detoxification. In addition, its GSH conjugating activity was previously confirmed in vitro through the high transferase function carried out by recombinant mGSTK1 and tested on several aryl halides.50 Indeed, as we show here, hearts from diabetic mice have elevated antioxidant capacity, which could be partly attributed to the increase in GSTK1 protein. In addition, glutathione (GSH) itself is elevated approximately 20% with advanced diabetes (12 weeks) indicating that several aspects of this cellular defense pathway are affected by diabetes in the heart. In addition to elevated GSTK1 protein, we found a transcriptional increase in SODCZN of approximately 50% in 5 week old Akita hearts. The increased expression of this superoxide dismutase, a key antioxidant enzyme, further supports an enhanced antioxidant capacity in diabetic mice. While this programming is likely to be protective initially, the longer term consequences or the demands placed on cellular homeostasis by up-regulation of antioxidant pathways may affect cardiomyocyte efficiency. Because mitochondrial stress has been studied extensively in diabetes and is widely acknowledged as a key component of the detrimental effects of the disease, it is interesting to note that mGSTK1 was shown to associate almost exclusively with mitochondrial fractions in the liver50 and contains an Nterminal mitochondrial location sequence.49 It is known that several GSH-dependent enzymes play a role in mitochondrial ROS defenses, but the additional presence of a peroxisome signal on GSTK1 suggests that it may have a nontraditional function. In 2008, GSTK1 was suggested to be associated with adiponectin processing and found to negatively correlate with obesity and T2DM.51 The present study implicates GSTK1 expression as a possible component of a ramped-up oxidative protection state; however, it is interesting to imagine a noncanonical function that could affect cellular performance through peroxisome activity. Due to the distinct nature of disease pathogenesis between type 1 and type 2 diabetes, it is likely that GSTK1 regulation has independent impacts on T2DM and T1DM.

Proteins Involved in the Insulin Signaling Network

A few of the proteins found affected at this early stage of diabetes seem to be related to suppressed insulin pathway activity. Plekhn1, probable pleckstrin homology domaincontaining family N member 1, isoform 2, was decreased approximately 1.5-fold in diabetic versus nondiabetic 5 week old mice (P = 0.005, Table 1). This protein contains one plecktstrin homology (PH) domain, binds to phospholipids, and has two probable isoforms [UniProt Q8C886]. While little information is available regarding Plekhn1, PH domain containing proteins are known to interact with the lipid second messenger phosphatidylinositol 3,4,5-triphosphate (PIP3).59 PIP3 is a second messenger in insulin and growth factor signaling, and it is possible that the down regulation of Plekhn1 may be a direct consequence of the suppressed insulin production inherent in the Akita T1DM pathology.

Proteins Involved in Metabolism

Several other proteins were indicated significantly altered in early diabetic cardiomyopathy pathophysiology. Among these proteins, GANC (neutral α-glucosidase C), a member of the glycosyl hydrolase gene family 31,32 was increased in diabetic hearts 1.4-fold (P = 0.0004, Table 1). This protein is a key 3930



Article

Plakophilin 2, a cardiac desmosome protein, was decreased 1.2 fold (P = 0.02). Mutations in plakophilin 2 are linked to arrhythmogenic right ventricular cardiomyopathy (ARVC).66 The desmosome is important for cell-to-cell adhesion, and the cooperative nature of cardiac contraction dictates that the heart is particularly susceptible to disturbances in cell-to-cell interactions. This abnormality may affect signal transduction and relaxation in cardiomyocytes contributing to the development of impaired relaxation kinetics.

The 1.5-fold decreased expression (P = 0.04) of eEF1A-1, an elongation factor that binds aminoacyl-tRNA to the ribosome during translation, may also be a direct consequence of deficient insulin signaling.60 eEF1A-1 was also decreased in the liver of the T1DM BB-DP rat model.8 Interestingly, eEF1A-1 was found to be a critical player in lipotoxic cell death, likely through cytoskeletal remodeling, and was up-regulated in a murine model of lipotoxic cardiac disease.61 Akita mice at 12 weeks of age have cardiac lipotoxicity,19 which could be a factor in early cardiomyopathy development. Further studies would be needed to determine whether eEF1A-1 is linked to diabetic cardiomyopathy pathogenesis through lipotoxic generation. Ras-related protein Rap-1A (Rap1a) was increased 1.4-fold. Rap1a is a Ras-related protein that interferes with the mitogenic effects of RAS.62 Rap1 was shown to affect islet cell proliferation through mTOR; 63 however, it has never previously been implicated in diabetes. An increase in Rap1a and thus a subsequent increase in RAS inhibition could potentially handicap the myocytes’ ability to divide. This may play a role in the susceptibility of diabetic hearts to ischemic damage. However, further studies would be needed to make any definitive conclusions regarding this.

■

CONCLUSIONS This study presents the first unbiased investigation of early DC pathogenesis using proteomic analysis. The study utilized a nontransgenic rodent model of T1DM, the Akita mouse, as well as an advanced label-free quantitative proteomic method with the rigorous IdentiQuantXL software. Our results reveal five up-regulated proteins (Acads, Gstk1, Ganc, Rap1a, and sEH) and six downregulated proteins (Plekhn1, Eef1a1, Atp1a3, Col1a1, Hrc, and Pkp2). These proteins affect cellular defense mechanisms, metabolism, the insulin signaling network, and calcium handling. Akita mice at 5 weeks of age also have no apparent elevation in oxidative stress in the presence of elevated antioxidant capacity and glutathione levels. sEH was found to be dramatically increased with disease progression in the heart and skeletal muscle while remaining unaffected in the liver. Increased levels of sEH correlate with muscle atrophy in Akita mice, and future studies targeting this protein expression may be useful for controlling diabetic cardiomyopathy. Our findings reveal several interesting pathways of investigation that are useful for understanding and eventually preventing the pathogenesis of DC particularly related to diastolic impairment. These findings also suggest that sEH and GANC inhibition may be feasible avenues to target this disease.

Proteins Involved in Fibrosis

In the initial characterization of Akita DC, hearts were found to be dysfunctional in the absence of fibrosis. Indeed, the expression levels of procallagen-type I, procollagen-type II, and fibronectin were all unchanged in Akita at 3 and 6 months of age.19 In this study, we detect an early decrease in collagen I α I (Col1a1), which builds collagen chains. Heart failure is commonly associated with fibrosis and restructuring of the heart, which requires collagen synthesis. The absence of fibrosis at later stages of DC and the early suppression of a fibrosis genesis protein indicate that diastolic failure in the Akita mice is unrelated to fibrosis.

■

Proteins Involved with Calcium Handling

Atp1a3 was suppressed 1.4-fold (P = 0.02). This is a subunit of the Na+/K+-ATPase integral membrane protein responsible for maintaining the cellular electrochemical gradient of sodium and potassium. Electrochemical gradients are critical for cardiomyocyte function, because both action potential transduction and contraction itself depend on movement of ions. However, the primary ion responsible for cardiac contraction is calcium. While the Na+/K+-ATPase could affect calcium regulation via perturbations in electrical driving forces, it is also important to note that removal of Ca2+ from the cardiomyocyte depends largely on sodium exchange. If the decreased presence of this subunit of the Na+/K+-ATPase indicates an overall decrease in the capacity to maintain the balance of sodium and potassium in the cell, intracellular sodium would be higher than under normal conditions, and thus the driving force for calcium removal elevated. This seemingly contradicts the impaired relaxation seen in Akita DC, and the actual effects of decreasing this protein are likely complex and multifactorial. Another protein identified in this study that could affect calcium handling is Hrc. Histidine-rich calcium binding protein, isoform CRA_a, was suppressed 1.2-fold (P = 0.04). The Hrc protein has high affinity for low-density lipoprotein and plays a role in the release of calcium into the sarcoplasmic reticulum.64 Down-regulation of Hrc is implicated in the failing heart.65 Thus, Hrc suppression could be directly affecting diastolic function through the delay of calcium uptake and subsequent relaxation of cardiomyocytes.

ASSOCIATED CONTENT

S Supporting Information *

Tables showing identification of proteins and peptides and figures showing gastrocnemius weight, sEH protein expression, pyruvate dehydrogenase kinase, isozyme 4 (PDK4) mRNA expression, and localization of sEH in Akita mice. This material is available free of charge via the Internet at http://pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Mailing address: 191 Briggs Hall, One Shields Avenue, Department of Neurobiology, Physiology and Behavior, University of California, Davis, Davis, CA 95616, USA. Email: [email protected]. Phone: 530-752-3207 Fax: 530752-5582. Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This research was supported by UC Davis research funds and grants from the American Heart Association, the Achievement Rewards for College Scientists (ARCS), and UCDavis/HHMIIMBS (S.D.). S.D. is part of the MCIP graduate group. AntisEH was kindly provided by Dr. Bruce Hammock, UC Davis. 3931



■

Article

enhance label-free quantification using peptide intensity in LC-MS/ MS. J. Proteome Res. 2011, 10 (10), 4799−4812. (19) Basu, R.; Oudit, G. Y.; Wang, X.; Zhang, L.; Ussher, J. R.; Lopaschuk, G. D.; Kassiri, Z. Type 1 diabetic cardiomyopathy in the Akita (Ins2WT/C96Y) mouse model is characterized by lipotoxicity and diastolic dysfunction with preserved systolic function. Am. J. Physiol.: Heart Circ. Physiol. 2009, 297 (6), H2096−H2108. (20) Gomes, A. V.; Young, G. W.; Wang, Y.; Zong, C.; Eghbali, M.; Drews, O.; Lu, H.; Stefani, E.; Ping, P. Contrasting proteome biology and functional heterogeneity of the 20 S proteasome complexes in mammalian tissues. Mol. Cell. Proteomics 2009, 8 (2), 302−315. (21) Gomes, A. V.; Zong, C.; Edmondson, R. D.; Li, X.; Stefani, E.; Zhang, J.; Jones, R. C.; Thyparambil, S.; Wang, G. W.; Qiao, X.; Bardag-Gorce, F.; Ping, P. Mapping the murine cardiac 26S proteasome complexes. Circ. Res. 2006, 99 (4), 362−371. (22) Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248−254. (23) Lai, X.; Bacallao, R. L.; Blazer-Yost, B. L.; Hong, D.; Mason, S. B.; Witzmann, F. A. Characterization of the renal cyst fluid proteome in autosomal dominant polycystic kidney disease (ADPKD) patients. Proteomics: Clin. Appl. 2008, 2 (7−8), 1140−1152. (24) Keller, A.; Nesvizhskii, A. I.; Kolker, E.; Aebersold, R. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal. Chem. 2002, 74 (20), 5383−5392. (25) Nesvizhskii, A. I.; Keller, A.; Kolker, E.; Aebersold, R. A statistical model for identifying proteins by tandem mass spectrometry. Anal. Chem. 2003, 75 (17), 4646−4658. (26) Rice-Evans, C.; Miller, N. J. Total antioxidant status in plasma and body fluids. Methods Enzymol. 1994, 234, 279−293. (27) Miller, N. J.; Rice-Evans, C. A. Factors influencing the antioxidant activity determined by the ABTS.+ radical cation assay. Free Radical Res. 1997, 26 (3), 195−199. (28) Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29 (9), No. e45. (29) Luo, P.; Chang, H. H.; Zhou, Y.; Zhang, S.; Hwang, S. H.; Morisseau, C.; Wang, C. Y.; Inscho, E. W.; Hammock, B. D.; Wang, M. H. Inhibition or deletion of soluble epoxide hydrolase prevents hyperglycemia, promotes insulin secretion, and reduces islet apoptosis. J. Pharmacol. Exp. Ther. 2010, 334 (2), 430−438. (30) Imig, J. D. Epoxides and soluble epoxide hydrolase in cardiovascular physiology. Physiol. Rev. 2012, 92 (1), 101−130. (31) Guglielmino, K.; Jackson, K.; Harris, T. R.; Vu, V.; Dong, H.; Dutrow, G.; Evans, J. E.; Graham, J.; Cummings, B. P.; Havel, P. J.; Chiamvimonvat, N.; Despa, S.; Hammock, B. D.; Despa, F. Pharmacological inhibition of soluble epoxide hydrolase provides cardioprotection in hyperglycemic rats. Am. J. Physiol.: Heart Circ. Physiol. 2012, 303 (7), H853−H862. (32) Hirschhorn, R.; Huie, M. L.; Kasper, J. S. Computer assisted cloning of human neutral alpha-glucosidase C (GANC): A new paralog in the glycosyl hydrolase gene family 31. Proc. Natl. Acad. Sci. U. S. A. 2002, 99 (21), 13642−13646. (33) Rice-Evans, C.; Miller, N. Measurement of the antioxidant status of dietary constituents, low density lipoproteins and plasma. Prostaglandins, Leukotrienes Essent. Fatty Acids 1997, 57 (4−5), 499− 505. (34) Lee, J. P.; Yang, S. H.; Kim, D. K.; Lee, H.; Kim, B.; Cho, J. Y.; Yu, K. S.; Paik, J. H.; Kim, M.; Lim, C. S.; Kim, Y. S. In vivo activity of epoxide hydrolase according to sequence variation affects the progression of human IgA nephropathy. Am. J. Physiol.: Renal, Fluid Electrolyte Physiol. 2011, 300 (6), F1283−F1290. (35) Oguro, A.; Fujita, N.; Imaoka, S. Regulation of soluble epoxide hydrolase (sEH) in mice with diabetes: high glucose suppresses sEH expression. Drug Metab. Pharmacokinet. 2009, 24 (5), 438−445. (36) Burdon, K. P.; Lehtinen, A. B.; Langefeld, C. D.; Carr, J. J.; Rich, S. S.; Freedman, B. I.; Herrington, D.; Bowden, D. W. Genetic analysis of the soluble epoxide hydrolase gene, EPHX2, in subclinical

REFERENCES

(1) Thomas, J. E.; Foody, J. M. The pathophysiology of cardiovascular disease in diabetes mellitus and the future of therapy. J. CardioMetab. Syndr. 2007, 2 (2), 108−113. (2) Rubler, S.; Dlugash, J.; Yuceoglu, Y. Z.; Kumral, T.; Branwood, A. W.; Grishman, A. New type of cardiomyopathy associated with diabetic glomerulosclerosis. Am. J. Cardiol. 1972, 30 (6), 595−602. (3) Buchanan, J.; Mazumder, P. K.; Hu, P.; Chakrabarti, G.; Roberts, M. W.; Yun, U. J.; Cooksey, R. C.; Litwin, S. E.; Abel, E. D. Reduced cardiac efficiency and altered substrate metabolism precedes the onset of hyperglycemia and contractile dysfunction in two mouse models of insulin resistance and obesity. Endocrinology 2005, 146 (12), 5341− 5349. (4) Singh, J.; Chonkar, A.; Bracken, N.; Adeghate, E.; Latt, Z.; Hussain, M. Effect of streptozotocin-induced type 1 diabetes mellitus on contraction, calcium transient, and cation contents in the isolated rat heart. Ann. N.Y. Acad. Sci. 2006, 1084, 178−190. (5) Poornima, I. G.; Parikh, P.; Shannon, R. P. Diabetic cardiomyopathy: The search for a unifying hypothesis. Circ. Res. 2006, 98 (5), 596−605. (6) Boudina, S.; Abel, E. D. Diabetic cardiomyopathy, causes and effects. Rev. Endocr. Metab. Disord. 2010, 11 (1), 31−39. (7) Cui, Z.; Dewey, S.; Gomes, A. V. Cardioproteomics: Advancing the discovery of signaling mechanisms involved in cardiovascular diseases. Am. J. Cardiovasc. Dis. 2011, 1 (3), 274−292. (8) Johnson, D. T.; Harris, R. A.; French, S.; Aponte, A.; Balaban, R. S. Proteomic changes associated with diabetes in the BB-DP rat. Am. J. Physiol.: Endocrinol. Metab. 2009, 296 (3), E422−E432. (9) Ares-Carrasco, S.; Picatoste, B.; Camafeita, E.; Carrasco-Navarro, S.; Zubiri, I.; Ortiz, A.; Egido, J.; Lopez, J. A.; Tunon, J.; Lorenzo, O. Proteome changes in the myocardium of experimental chronic diabetes and hypertension: Role of PPARalpha in the associated hypertrophy. J. Proteomics 2012, 75 (6), 1816−1829. (10) Shen, X.; Zheng, S.; Thongboonkerd, V.; Xu, M.; Pierce, W. M., Jr.; Klein, J. B.; Epstein, P. N. Cardiac mitochondrial damage and biogenesis in a chronic model of type 1 diabetes. Am. J. Physiol.: Endocrinol. Metab. 2004, 287 (5), E896−E905. (11) Hamblin, M.; Friedman, D. B.; Hill, S.; Caprioli, R. M.; Smith, H. M.; Hill, M. F. Alterations in the diabetic myocardial proteome coupled with increased myocardial oxidative stress underlies diabetic cardiomyopathy. J. Mol. Cell. Cardiol. 2007, 42 (4), 884−895. (12) Baseler, W. A.; Dabkowski, E. R.; Williamson, C. L.; Croston, T. L.; Thapa, D.; Powell, M. J.; Razunguzwa, T. T.; Hollander, J. M. Proteomic alterations of distinct mitochondrial subpopulations in the type 1 diabetic heart: Contribution of protein import dysfunction. Am. J. Physiol.: Regul., Integr. Comp. Physiol. 2011, 300 (2), R186−R200. (13) Essop, M. F.; Chan, W. A.; Hattingh, S. Proteomic analysis of mitochondrial proteins in a mouse model of type 2 diabetes. Cardiovasc. J. Afr. 2011, 22 (4), 175−178. (14) Dabkowski, E. R.; Baseler, W. A.; Williamson, C. L.; Powell, M.; Razunguzwa, T. T.; Frisbee, J. C.; Hollander, J. M. Mitochondrial dysfunction in the type 2 diabetic heart is associated with alterations in spatially distinct mitochondrial proteomes. Am. J. Physiol.: Heart Circ. Physiol. 2010, 299 (2), H529−H540. (15) Bugger, H.; Riehle, C.; Jaishy, B.; Wende, A. R.; Tuinei, J.; Chen, D.; Soto, J.; Pires, K. M.; Boudina, S.; Theobald, H. A.; Luptak, I.; Wayment, B.; Wang, X.; Litwin, S. E.; Weimer, B. C.; Abel, E. D. Genetic loss of insulin receptors worsens cardiac efficiency in diabetes. J. Mol. Cell. Cardiol. 2012, 52 (5), 1019−1026. (16) Bugger, H.; Chen, D.; Riehle, C.; Soto, J.; Theobald, H. A.; Hu, X. X.; Ganesan, B.; Weimer, B. C.; Abel, E. D. Tissue-specific remodeling of the mitochondrial proteome in type 1 diabetic akita mice. Diabetes 2009, 58 (9), 1986−1997. (17) Schannwell, C. M.; Schneppenheim, M.; Perings, S.; Plehn, G.; Strauer, B. E. Left ventricular diastolic dysfunction as an early manifestation of diabetic cardiomyopathy. Cardiology 2002, 98 (1−2), 33−39. (18) Lai, X.; Wang, L.; Tang, H.; Witzmann, F. A. A novel alignment method and multiple filters for exclusion of unqualified peptides to 3932



Article

cardiovascular disease in the Diabetes Heart Study. Diabetes Vasc. Dis. Res. 2008, 5 (2), 128−134. (37) Thomson, S. J.; Askari, A.; Bishop-Bailey, D. Anti-inflammatory effects of epoxyeicosatrienoic acids. Int. J. Vasc. Med. 2012, 2012, No. 605101. (38) Morisseau, C.; Hammock, B. D. Impact of Soluble Epoxide Hydrolase and Epoxyeicosanoids on Human Health. Annu. Rev. Pharmacol. Toxicol. 2012, 53, 37−58. (39) Merabet, N.; Bellien, J.; Glevarec, E.; Nicol, L.; Lucas, D.; RemyJouet, I.; Bounoure, F.; Dreano, Y.; Wecker, D.; Thuillez, C.; Mulder, P. Soluble epoxide hydrolase inhibition improves myocardial perfusion and function in experimental heart failure. J. Mol. Cell. Cardiol. 2012, 52 (3), 660−666. (40) Chiamvimonvat, N.; Ho, C. M.; Tsai, H. J.; Hammock, B. D. The soluble epoxide hydrolase as a pharmaceutical target for hypertension. J. Cardiovasc. Pharmacol. 2007, 50 (3), 225−237. (41) Luria, A.; Bettaieb, A.; Xi, Y.; Shieh, G. J.; Liu, H. C.; Inoue, H.; Tsai, H. J.; Imig, J. D.; Haj, F. G.; Hammock, B. D. Soluble epoxide hydrolase deficiency alters pancreatic islet size and improves glucose homeostasis in a model of insulin resistance. Proc. Natl. Acad. Sci. U. S. A. 2011, 108 (22), 9038−9043. (42) Chen, L.; Fan, C.; Zhang, Y.; Bakri, M.; Dong, H.; Morisseau, C.; Maddipati, K. R.; Luo, P.; Wang, C. Y.; Hammock, B. D.; Wang, M. H. Beneficial effects of inhibition of soluble epoxide hydrolase on glucose homeostasis and islet damage in a streptozotocin-induced diabetic mouse model. Prostaglandins Other Lipid Mediators 2013, 104105, 42−48. (43) Wang, Z. H.; Davis, B. B.; Jiang, D. Q.; Zhao, T. T.; Xu, D. Y. Soluble Epoxide Hydrolase Inhibitors and Cardiovascular Diseases. Curr. Vasc. Pharmacol. 2013, 11, 105−111. (44) Lorthioir, A.; Guerrot, D.; Joannides, R.; Bellien, J. Diabetic CVD–soluble epoxide hydrolase as a target. Cardiovasc. Hematol. Agents Med. Chem. 2012, 10 (3), 212−222. (45) Batchu, S. N.; Lee, S. B.; Samokhvalov, V.; Chaudhary, K. R.; ElSikhry, H.; Weldon, S. M.; Seubert, J. M. Novel soluble epoxide hydrolase inhibitor protects mitochondrial function following stress. Can. J. Physiol. Pharmacol. 2012, 90 (6), 811−823. (46) Nebert, D. W.; Vasiliou, V. Analysis of the glutathione Stransferase (GST) gene family. Hum. Genomics 2004, 1 (6), 460−464. (47) Pemble, S. E.; Wardle, A. F.; Taylor, J. B. Glutathione Stransferase class Kappa: Characterization by the cloning of rat mitochondrial GST and identification of a human homologue. Biochem. J. 1996, 319 (Pt 3), 749−754. (48) Li, J.; Xia, Z.; Ding, J. Thioredoxin-like domain of human kappa class glutathione transferase reveals sequence homology and structure similarity to the theta class enzyme. Protein Sci. 2005, 14 (9), 2361− 2369. (49) Sheehan, D.; Meade, G.; Foley, V. M.; Dowd, C. A. Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem. J. 2001, 360 (Pt 1), 1−16. (50) Jowsey, I. R.; Thomson, R. E.; Orton, T. C.; Elcombe, C. R.; Hayes, J. D. Biochemical and genetic characterization of a murine class Kappa glutathione S-transferase. Biochem. J. 2003, 373 (Pt 2), 559− 569. (51) Liu, M.; Zhou, L.; Xu, A.; Lam, K. S.; Wetzel, M. D.; Xiang, R.; Zhang, J.; Xin, X.; Dong, L. Q.; Liu, F. A disulfide-bond A oxidoreductase-like protein (DsbA-L) regulates adiponectin multimerization. Proc. Natl. Acad. Sci. U. S. A. 2008, 105 (47), 18302− 18307. (52) Lin, A. H.; Lee, B. H.; Nichols, B. L.; Quezada-Calvillo, R.; Rose, D. R.; Naim, H. Y.; Hamaker, B. R. Starch Source Influences Dietary Glucose Generation at the Mucosal alpha-Glucosidase Level. J. Biol. Chem. 2012, 287 (44), 36917−36921. (53) Standl, E.; Schnell, O. Alpha-glucosidase inhibitors 2012 cardiovascular considerations and trial evaluation. Diabetes Vasc. Dis. Res. 2012, 9 (3), 163−169. (54) Wolinsky, H.; Capron, L.; Goldfischer, S.; Capron, F.; ColtoffSchiller, B.; Kasak, L. E. Hydrolase activities in the rat aorta. II. Effects

of hypertension alone and in combination with diabetes mellitus. Circ. Res. 1978, 42 (6), 831−839. (55) Hanis, C. L.; Boerwinkle, E.; Chakraborty, R.; Ellsworth, D. L.; Concannon, P.; Stirling, B.; Morrison, V. A.; Wapelhorst, B.; Spielman, R. S.; Gogolin-Ewens, K. J.; Shepard, J. M.; Williams, S. R.; Risch, N.; Hinds, D.; Iwasaki, N.; Ogata, M.; Omori, Y.; Petzold, C.; Rietzch, H.; Schroder, H. E.; Schulze, J.; Cox, N. J.; Menzel, S.; Boriraj, V. V.; Chen, X.; Lim, L. R.; Lindner, T.; Mereu, L. E.; Wang, Y. Q.; Xiang, K.; Yamagata, K.; Yang, Y.; Bell, G. I. A genome-wide search for human non-insulin-dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nat. Genet. 1996, 13 (2), 161− 166. (56) Kroos, M. A.; van Leenen, D.; Verbiest, J.; Reuser, A. J.; Hermans, M. M. Glycogen storage disease type II: Identification of a dinucleotide deletion and a common missense mutation in the lysosomal alpha-glucosidase gene. Clin. Genet. 1998, 53 (5), 379−382. (57) Pederson, B. A.; Chen, H.; Schroeder, J. M.; Shou, W.; DePaoliRoach, A. A.; Roach, P. J. Abnormal cardiac development in the absence of heart glycogen. Mol. Cell. Biol. 2004, 24 (16), 7179−7187. (58) Hornbak, M.; Banasik, K.; Justesen, J. M.; Krarup, N. T.; Sandholt, C. H.; Andersson, A.; Sandbaek, A.; Lauritzen, T.; Pisinger, C.; Witte, D. R.; Sorensen, T. A.; Pedersen, O.; Hansen, T. The minor C-allele of rs2014355 in ACADS is associated with reduced insulin release following an oral glucose load. BMC Med. Genet. 2011, 12, No. 4. (59) Dowler, S.; Currie, R. A.; Campbell, D. G.; Deak, M.; Kular, G.; Downes, C. P.; Alessi, D. R. Identification of pleckstrin-homologydomain-containing proteins with novel phosphoinositide-binding specificities. Biochem. J. 2000, 351 (Pt 1), 19−31. (60) McKeehan, W. L.; Hardesty, B. Purification and partial characterization of the aminoacyl transfer ribonucleic acid binding enzyme from rabbit reticulocytes. J. Biol. Chem. 1969, 244 (16), 4330− 4339. (61) Borradaile, N. M.; Buhman, K. K.; Listenberger, L. L.; Magee, C. J.; Morimoto, E. T.; Ory, D. S.; Schaffer, J. E. A critical role for eukaryotic elongation factor 1A-1 in lipotoxic cell death. Mol. Biol. Cell 2006, 17 (2), 770−778. (62) Kawata, M.; Matsui, Y.; Kondo, J.; Hishida, T.; Teranishi, Y.; Takai, Y. A novel small molecular weight GTP-binding protein with the same putative effector domain as the ras proteins in bovine brain membranes. Purification, determination of primary structure, and characterization. J. Biol. Chem. 1988, 263 (35), 18965−18971. (63) Kelly, P.; Bailey, C. L.; Fueger, P. T.; Newgard, C. B.; Casey, P. J.; Kimple, M. E. Rap1 promotes multiple pancreatic islet cell functions and signals through mammalian target of rapamycin complex 1 to enhance proliferation. J. Biol. Chem. 2010, 285 (21), 15777−15785. (64) Hofmann, S. L.; Topham, M.; Hsieh, C. L.; Francke, U. cDNA and genomic cloning of HRC, a human sarcoplasmic reticulum protein, and localization of the gene to human chromosome 19 and mouse chromosome 7. Genomics 1991, 9 (4), 656−669. (65) Pritchard, T. J.; Kranias, E. G. Junctin and the histidine-rich Ca2+ binding protein: Potential roles in heart failure and arrhythmogenesis. J. Physiol. 2009, 587 (Pt 13), 3125−3133. (66) Gerull, B.; Heuser, A.; Wichter, T.; Paul, M.; Basson, C. T.; McDermott, D. A.; Lerman, B. B.; Markowitz, S. M.; Ellinor, P. T.; MacRae, C. A.; Peters, S.; Grossmann, K. S.; Drenckhahn, J.; Michely, B.; Sasse-Klaassen, S.; Birchmeier, W.; Dietz, R.; Breithardt, G.; Schulze-Bahr, E.; Thierfelder, L. Mutations in the desmosomal protein plakophilin-2 are common in arrhythmogenic right ventricular cardiomyopathy. Nat. Genet. 2004, 36 (11), 1162−1164.

3933


Proteomic Analysis of Hearts from Akita Mice Suggests That Increases

Recommend Documents