Proteomic and Transcriptomic Analyses of Fecundity in the Brown

Article pubs.acs.org/jpr

Proteomic and Transcriptomic Analyses of Fecundity in the Brown Planthopper Nilaparvata lugens (Stål) Yifan Zhai,† Jianqing Zhang,† Zhongxiang Sun, Xiaolin Dong, Yuan He, Kui Kang, Zhichao Liu, and Wenqing Zhang* State Key Laboratory of Biocontrol and School of Life Sciences, Sun Yat-Sen University, No. 135 Xingang West Road, Guangzhou 510275, China S Supporting Information *

ABSTRACT: As an r-strategy insect species, the brown planthopper (BPH) Nilaparvata lugens (Stål) is a serious pest of rice crops in the temperate and tropical regions of Asia and Australia, which may be due to its robust fecundity. Here we combined 2-DE comparative proteomic and RNA-seq transcriptomic analyses to identify fecundity-related proteins and genes. Using high- and low-fecundity populations as sample groups, a total of 54 and 75 proteins were significantly altered in the third and sixth day brachypterous female stages, respectively, and 39 and 54 of these proteins were identified by MALDI-TOF/TOF MS. In addition, 71 966 unigenes were quantified by Illumina sequencing. On the basis of the transcriptomic analysis, 7408 and 1639 unigenes demonstrated higher expression levels in the high-fecundity population in the second day brachypterous female adults and the second day fifth instar nymphs, respectively, and 411 unigenes were up-regulated in both groups. Of these dozens of proteins and thousands of unigenes, five were differentially expressed at both the protein and mRNA levels at all four time points, suggesting that these genes may regulate fecundity. Glutamine synthetase (GS) was chosen for further functional studies. RNAi knockdown of the GS gene reduced the fecundity of N. lugens by 64.6%, disrupted ovary development, and inhibited vitellogenin (Vg) expression. Our results show that a combination of proteomic and transcriptomic analyses provided five candidate proteins and genes for further study. The knowledge gained from this study may lead to a more fundamental understanding of the fecundity of this important agricultural insect pest. KEYWORDS: 2-DE, RNA-seq, RNAi, fecundity, glutamine synthetase, Nilaparvata lugens

1. INTRODUCTION Insect fecundity is regulated by several factors such as growth factors, hormones, nutrition, and energy availability. Insulin-like peptides (ILPs), which act through the conserved insulin signaling pathway, regulate development, longevity, and female reproduction in Drosophila melanogaster.1,2 The juvenile hormone (JH) signaling pathway regulates female reproductive maturation in many insects.3,4 In mosquitoes, especially Aedes aegypti, the key factors required for the activation of vitellogenesis appear to be a combination of nutritional stimuli (specifically amino acids) and the steroid hormone 20-hydroxyecdysone.5 The nutrition-related target of rapamycin (TOR) pathway mediates vitellogenin synthesis and reproductive cycles.6 It has been shown that knockdown of genes involved in the TOR pathway significantly results in reduced egg size and therefore decreased fecundity.7−9 Recently, there has been increasing interest in using transcriptomic and proteomic analyses to comprehensively understand insect fecundity. In D. melanogaster, both the gene and protein expression profiles of the reproductive organs have been identified.10−12 To date, transcriptomic profiles related to reproduction have been analyzed in several other insects, such as the Mediterranean fruit fly Ceratitis capitata; however, the proteomic profiles involved in reproduction largely remain to be elucidated.13−15 © 2013 American Chemical Society

The brown planthopper (BPH) Nilaparvata lugens (Stål) (Hemiptera: Delphacidae) is a serious pest of rice crops in the temperate and tropical regions of Asia and Australia.16 Although the key ecological factors causing BPH outbreak are quite clear, the molecular mechanisms related to BPH fecundity have not yet been reported.17 Several genes, including JH esterase and the transcription factor FoxA, play important roles in regulating the fecundity of BPH.18,19 The only proteomic analysis related to BPH fecundity was the LC−MS/MS analysis of BPHs treated with the insecticide triazophos, and this analysis identified several novel proteins.20 To date, the transcriptomic and proteomic analyses related to BPH fecundity have not been investigated. Here we selected the high- and low-fecundity populations from field N. lugens and analyzed the differentially expressed proteins and genes in the two populations using proteomic and transcriptomic approaches. Our results may lead to a more fundamental understanding of the fecundity of this important agricultural insect pest. Special Issue: Agricultural and Environmental Proteomics Received: February 4, 2013 Published: October 2, 2013 5199

dx.doi.org/10.1021/pr400561c | J. Proteome Res. 2013, 12, 5199−5212

Journal of Proteome Research

Article

2. MATERIALS AND METHODS

destained in 7% (v/v) acetic acid until the backgrounds were clear. The stained gels were scanned using Image Scanner III (GE Healthcare), and the protein spots were analyzed using ImageMaster 2D software (version 7.0).

2.1. Insects

Approximately 1000 N. lugens individuals were collected in rice fields at four sites (Huizhou, Zhaoqing, Shaoguan, and Qingyuan) in Guangdong Province, China in 2009. The following procedure was used to select the high-fecundity population (HFP) and low-fecundity population (LFP). Within 24 h of emergence, a brachypterous male and a brachypterous female were introduced into a plastic cage (diameter 18 cm, height 70 cm) with BPH-susceptible rice plants (Huang Hua Zhan, bought from the Guangdong Academy of Agricultural Sciences, Guangzhou, China) in a basin (diameter 22 cm). On day 15, the two insects, if alive, were removed from the cage. The number of nymphs was counted 8 days later. During the first round of selection, of the 162 cages used, the 3 cages with the most nymphs were singled out as the candidate HFP, and 3 cages with approximately 50 nymphs were designated as the candidate LFP. Afterward, 70−90 cages, each with a pair separated from the candidate HFP or LFP described above, were used for every selection from April to November in a year. Because of the unfavorable weather conditions for N. lugens during the winter, the insects in the 3 HFP cages were mixed together for population maintenance; the LFP cages were also mixed.21 The screening process was maintained in a greenhouse at 26 ± 2 °C with 80 ± 10% humidity and a light−dark cycle of L16:D8 h. After nine rounds of selection, the number of offspring in the HFP was often 300, whereas it was often less than 150 in the LFP (Supplementary Figure 1 in the Supporting Information). At the eleventh round of selection, the second day fifth instar nymphs and the second day brachypterous female adults forming the two populations were used for the transcriptomic analysis, and the third and sixth day brachypterous female adults were used for the proteomic analysis.

2.3. In-Gel Digestion and MS

The silver-stained protein spots were excised from the gel, destained with 100 mM NH4HCO3 and 30% acetonitrile (ACN), and then dried in a speed vacuum. The gel pieces were covered with 10 μL of 12.5 ng/μL sequencing grade trypsin (Promega) in 25 mM NH4HCO3 buffer. The digestion was carried out overnight at 37 °C, and each sample was dissolved in 1 mg/mL HCCA in 60% ACN and 0.1% TFA. The samples were analyzed using an Ultraflex III TOF/TOF mass spectrometer (Bruker Daltonics). External calibration was performed using Bruker peptide calibration standards. Mass spectra (MH+) in the range of 800−4500 Da were acquired by flexControl (version 3.0, Bruker Daltonics), and the generated peptide sequence tags were analyzed with the MASCOT software (Matrix science). The data were searched against the NCBInr protein database, and the results that were statistically significant (p < 0.05) were accepted. 2.4. Total RNA Extraction and Transcriptome Analysis

RNA was isolated with the TRIzol method (Invitrogen) according to the manufacturer’s protocol. The samples were treated with DNase, and RNA quantity was evaluated using a microvolume spectrophotometer (NanoDrop 2000, Thermo). RNA quality was evaluated using a 2100 Bioanalyzer (Agilent) according to the Illumina manufacturer’s instructions. Poly(A)+ RNA was purified from 10 μg of pooled total RNA using oligo(dT) magnetic beads and fragmented into short sequences in the presence of fragmentation buffer. The cleaved poly(A)+ RNA was transcribed using random hexamers, and secondstrand cDNA synthesis was performed. After purification using a QIAquick PCR purification kit and end-repair and ligation of sequencing adaptors, the products were amplified by PCR to create a cDNA library. Each cDNA library was sequenced by Beijing Genomics Institute (BGI, Shenzhen, China) using the Illumina sequencing platform (GAII). The raw reads from the images were generated using Solexa GA pipeline 1.6. The low-quality reads, including those without adaptors, with an N percentage >5% or over 50% base quality values Q ≤ 10 were filtered. The clean reads were assembled using the SOAP de novo software. The following assembling parameters were used: k-mer value of 29, average insert length of 200 bp, mapping length of 35 bp, an identity value of 95%, and a coverage length of 200 bp. To compare the differences in gene expression between the samples, the tag frequency in each library was statistically analyzed according to the method described.25 The false discovery rate (FDR) was used to determine the threshold P value in multiple tests. An FDR ≤ 0.001 and an absolute value of the |log2 ratio| ≥ 1 were used as the thresholds to determine significant differences in gene expression.

2.2. Separation of the Abdominal Proteins by 2-DE and Image Analysis

For each sample, the abdominal region of the adult females was dissected in insect saline containing 0.85% NaCl and stored at −80 °C until use. The abdomens were ground into powder in liquid nitrogen, homogenized in 1 mL of lysis buffer (7 M urea, 2 M thiourea, 4% CHAPS, 2 mM TBP, and protease inhibitor cocktail), and then centrifuged at 12 000 rpm at 4 °C. The supernatant was precipitated with 10% trichloroacetic acid (TCA)/acetone and centrifuged at 12 000 rpm at 4 °C, and the pellet was dissolved in rehydration buffer (8 M urea, 2 M thiourea, 4% CHAPS, 2 mM TBP, 0.5% (v/v) IPG buffer 3− 10NL, and 0.005% (w/v) bromophenol blue). The protein concentration was determined using the Bradford method.22,23 Each protein sample (500 μg) was resuspended in 400 μL of rehydration buffer and was then used to rehydrate 18 cm IPG strips (pH 3−10 NL) (GE Healthcare) overnight. IEF was performed at 20 °C in an IPGphor II apparatus (GE Healthcare) under the following gradient procedures: 200 V for 1 h, 500 V for 1 h, 1000 V for 2 h, gradient to 10 000 V for 1 h, and 10 000 V for 5 h. The gel strips were soaked for 15 min in equilibration buffer (50 mM Tris-HCl (pH 8.8), 6 M urea, 30% glycerol, 2% SDS, and 2 mM TBP) and then for an additional 15 min in a modified equilibration buffer that contained 2.5% iodoacetamide instead of TBP. The second dimension was performed using 12% SDS-polyacrylamide gels, and electrophoresis was performed at 80 V per gel for 2 h, followed by 120 V until the bromophenol blue reached the end of the gel. The gels were stained with silver stain24 and then

RPKM =

106C NL /103

In this equation, C represents the number of reads that only map to one unigene, N represents the total number of C, and L represents the number of bases in one unigene. 2.5. Quantitative Real-Time PCR Analysis

The primers used for real-time PCR are listed in Table 1. The synthesized first-strand cDNA was amplified by PCR in 10 μL 5200

dx.doi.org/10.1021/pr400561c | J. Proteome Res. 2013, 12, 5199−5212

Nl64307 Nl13785 Nl19214 Nl4354 Nl40840 Nl11496 Nl19139 Nl2794 Nl36579 Nl8740 Nl19112 Nl1058 Nl2096 Nl2572 Nl2731 Nl5846 Nl6402 Nl7919 Nl7961 Nl8322 Nl16284 Nl16452 Nl16567 Nl17592 Nl18625 Nl20970 Nl22630 Nl23137 Nl23652 Nl23867

gene ID

gene or protein

GFP Vg D-xylose-proton symporter no annotation integrin, β chain-like no annotation no annotation cation translocating P-type ATPase endoprotease sugar phosphate exchanger no annotation no annotation no annotation sodium-independent sulfate anion transporter Rab escort protein no annotation no annotation serine/threonine-protein kinase pyruvate carboxylase ATPase phosphoglycerate kinase no annotation polyketide synthase Pks7 serine/threonine kinase receptor associated protein Ras and Rab interactor no annotation carboxylesterase HMG-box transcription factor sequence orphanprotein protein kinase 6-phosphofructokinase hypothetical protein β-actin

GS

Table 1. Primers Used for RT-PCR and Real-Time PCR

PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR PCR

PCR

PCR type RT-PCR real-time RT-PCR real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time real-time

forward AATGCTGAGGTTATGCCATCG CAATCGGAGGGCAGCAACT AAGGGCGAGGAGCTGTTCACCG GCATCAATGAACCCAGCTAACTC CACTGATGACAGTTGAGACCCTA CGTGGCTCTTTGTTTCTGC GAAGTCAAGTTGGACGAAGAG TGATTTTCGGCTTGCTTTC AAAATGCAAGCGGATTCAA GGTTCCAGGGGATGTGATT GTGTATCAGTAATTGAACAGGGAG GTGGAATAGTGGCTGAGCG GGACGAGAAACTGAAGGAAG ACAGGAGTAAGAAACTTTG AGGTGGGAAAGGTCTGGTT CTCGGAGCAGGACAAGATG GGAAGGAACGAAGGATAGT TGTCTCAGGATGCTATGCG TCATGAGTGCGTTGTTTCT ACTCCAATTCCAACTCCTCC AGTCGGTGGTTGAGTTCCT GAACACTACAGACCGACAA CCCACCACCCCTCAAACT AATTCCTTTCAGATTCGAG CAAGGAGTCCGACAATAAGG AATCCAGACCGAACCATAT GATGATGGAACGGGCAGTA TACCCTGCCTTCTGTTCATTC GGCTTACATGCTGGGACAC TCGTGAAACAAGCGAATA GGACATTTCGCAGTTGGAT GACACGATAAACCTGTACCTG AGGCATCGCCGTCTTCACC ACACTCTACCCTGAACTGG TGCGTGACATCAAGGAGAAGC

reverse TGTCCTCCAGGTATCCTTTCTTCT TTCCTGGGCCATCCAAAAG CAGCAGGACCATGTGATCGCGC TGGACGGCTCTTTGCATACTCC CGTCGCAATAGAACCACCC TATCATTTTCCGCTTGTCC TCACCCGTATCCCATTTAGC CCTCCGCTGCTGTCTCTCT GAACAGGAACGAAGGAGGG GTTGCCTTTTGCCGTTAGG GTTTATCAATGGGTTCGTCC GACATCTTTGGGAGAGGGG TGTTGGCGATGAAAGAAGA ATTTAGATGGCTTGAATAA CACGACCCTACACTGAAAA AGGAGTGGGACCAATGAAA CACCCAGATAAGTCAGCAC TGTGGTGTTCGTCAGGTGT CTAATGGTGGATTGGTTGT TTCCCTGGTCATTTTATCCA CTCTCTCCGTTTGGTGTGA TCAATCTACTAAACACAGG GTCAATGGCGGCCACTAG ATTTGGTTGACCTTTCACA GGAATAACAGCCTGAGGAAC AATTTCAGTTAGCGACCACT GTTCTAGGCCAGGCTATTTT CTCTTCCGGCGTCAGCGTCTA CAAACTACCCTCGTTGCTG TCAACAATGGACCAAGGA TTAGCGACCTTCTCCTTTT CCTCTAGCGTCCAACAATAG AGAGCCGTCTCCGCCAATC CTGTAACGAACCGTATCTT CCATACCCAAGAAGGAAGGCT

sequence (5′→3′)

Journal of Proteome Research Article

5201

dx.doi.org/10.1021/pr400561c | J. Proteome Res. 2013, 12, 5199−5212

Journal of Proteome Research

Article

Figure 1. 2-DE gel images of the abdominal proteome of Nilaparvata lugens. The proteins were separated by IEF and SDS-PAGE and were stained using the MS-compatible silver stain. The differentially expressed protein spots are marked with a letter and numbers; the letters “a” and “b” represent 3D and 6D adults, respectively. The protein spots that were observed in all three biological replicates were excised and analyzed by MALDI-TOF/TOF. 3DH and 6DH: third and sixth day brachypterous adults, respectively, of the high-fecundity population (HFP); 3DL and 6DL: third and sixth day brachypterous adults, respectively, of the low-fecundity population (LFP).

and goat antirabbit antibodies conjugated to HRP were used for secondary antibodies (1:5000, Abcam), and the membranes were visualized by ECL (enhanced chemiluminescence). Quantification of the protein bands was conducted by scanning the films and importing the images into the Quantity One 1-D analysis software (Bio-Rad, Hercules, CA). Scanning densitometry was used for semiquantitative analysis of the data. Three biological replicates were performed for each protein.

reaction mixtures using a Light Cycler 480 system (Roche Diagnostics, Indianapolis, IN) and SYBR Premix Ex Taq (Takara, Japan) using the following procedure: 94 °C for 5 min, followed by 45 cycles of 94 °C for 15 s, 60 °C for 20 s, and 72 °C for 15 s. The β-actin gene was used as an internal standard.26After the amplification protocol, a melting curve analysis was performed in triplicate, and the results were averaged. The quantitative variation for each gene was calculated using a relative quantitative method (2−ΔΔCT) for three independent biological samples.27

2.7. RNA Interference and Sampling

2.6. Western Blot Analysis

The full coding sequence of the glutamine synthetase (NlGS) gene (GenBank accession no.: KC445137) was subcloned into a pMD18-T vector and was used as a template, and the ligated vector was sequenced by BGI before dsRNA synthesis. The target gene sequence was amplified by PCR, with forward and reverse primers conjugated to 25 nucleotides of the T7 primer sequence at the 5′ ends. The T7 RiboMAX Express RNAi System (Promega, USA) was used for synthesis. After synthesis, the dsGS (439 bp) was quantified using a microvolume spectrophotometer (NanoDrop 2000, Thermo), and its purity and integrity were determined by agarose gel electrophoresis. The dsGS oligonucleotide was kept at −80 °C until use. The GFP gene (ACY56286) was used as a control, and the PCR

Western blot analyses were modified according to the methods previously described.28 In brief, 100 μg of total protein was separated on a 12% SDS-PAGE gel and transferred to PVDF membranes (0.4 μm, Millipore), and the membranes were immunoblotted with the anti-PGK2 (phosphoglycerate kinase (PGK), 1:3000), anti-Hsp90 (heat shock protein 90, 1:3000), anti-SOD (superoxide dismutase, 1:3000), anti-PDH (pyruvate dehydrogenase, 1:3000), antiproteasome (proteasome ζ subunit, 1:3000, Abcam, U.K.), antibodies, or anti-NlGS (glutamine synthetase 2, 1:5000) and anti-NlVg (vitellogenin, 1:5000) serum. Our laboratory constructed the last two antibodies, whereas the others were bought from Abcam. IgG goat antimouse, goat antirat, 5202

dx.doi.org/10.1021/pr400561c | J. Proteome Res. 2013, 12, 5199−5212

Journal of Proteome Research

Article

primers GFP-F and GFP-R were used to amplify the GFP fragment (688 bp). The sequence was verified by sequencing (Invitrogen Company, Shanghai, China). Before injection, dsRNA and phenol red solution were mixed for observation. Under carbon dioxide anesthesia, insects (first day brachypterous female adults) were immobilized on the injection plate with their ventral side upward using brushes. Fifty nanoliters of purified dsGS, dsGFP (5 ng/nL), or ddH2O was slowly injected using 3.5 Drummond needles and a microinjector (NARISHIGE IM-31, Nikon, Japan). The injection site was located on one side of the metathorax, and the injected brachypterous females were reared on fresh rice plants at 26 ± 2 °C with 80 ± 10% humidity and a light−dark cycle of L16:D8 h.29 In the ovary development observation experiments, the ovaries from at least 15 females from each group were dissected and observed 48 and 72 h after injection. In the target gene/ protein and Vg detection experiments, each group included 35 individuals with three biological replicates, and 25 females were selected randomly for detection 24, 48, and 72 h after injection. In the offspring number experiment, each group included 10 pairs of brachypterous adults with three biological replicates, and the method described in 2.1 was used to obtain the offspring data. 2.8. Statistical Analysis

Data are expressed as the means ± SE, and the differences between the two groups were analyzed using a t test. Results were considered statistically significant if the p value was