Proteomic Screen Identifies IGFBP7 as a Novel ... - ACS Publications

Article pubs.acs.org/jpr

Proteomic Screen Identifies IGFBP7 as a Novel Component of Endothelial Cell-Specific Weibel-Palade Bodies Dorothee van Breevoort,†,‡ Ellen L. van Agtmaal,†,‡ Bieuwke S. Dragt,† Jacqueline Klein Gebbinck,† Ilze Dienava-Verdoold,† Astrid Kragt,† Ruben Bierings,† Anton J. G. Horrevoets,§ Karine M. Valentijn,∥ Jeroen C. Eikenboom,⊥ Mar Fernandez-Borja,¶ Alexander B. Meijer,†,# and Jan Voorberg*,† †

Department of Plasma Proteins, Sanquin-AMC Landsteiner Laboratory, Amsterdam, The Netherlands Department of Molecular Cell Biology and Immunology, VU Medical Center, Amsterdam, The Netherlands ∥ Department of Molecular Cell Biology, Section Electron Microscopy, Leiden University Medical Center, Leiden, The Netherlands ⊥ Department of Thrombosis and Hemostasis, Einthoven Laboratory for Experimental Vascular Medicine, Leiden University Medical Center, Leiden, The Netherlands ¶ Department of Molecular Cell Biology, Sanquin-AMC Landsteiner Laboratory, Amsterdam, The Netherlands # Utrecht Institute for Pharmaceutical Sciences, Utrecht University, Utrecht, The Netherlands §

S Supporting Information *

ABSTRACT: Vascular endothelial cells contain unique storage organelles, designated Weibel-Palade bodies (WPBs), that deliver inflammatory and hemostatic mediators to the vascular lumen in response to agonists like thrombin and vasopressin. The main component of WPBs is von Willebrand factor (VWF), a multimeric glycoprotein crucial for platelet plug formation. In addition to VWF, several other components are known to be stored in WPBs, like osteoprotegerin, monocyte chemoattractant protein-1 and angiopoetin-2 (Ang-2). Here, we used an unbiased proteomics approach to identify additional residents of WPBs. Mass spectrometry analysis of purified WPBs revealed the presence of several known components such as VWF, Ang-2, and P-selectin. Thirty-five novel candidate WPB residents were identified that included insulin-like growth factor binding protein-7 (IGFBP7), which has been proposed to regulate angiogenesis. Immunocytochemistry revealed that IGFBP7 is a bona fide WPB component. Cotransfection studies showed that IGFBP7 trafficked to pseudo-WPB in HEK293 cells. Using a series of deletion variants of VWF, we showed that targeting of IGFBP7 to pseudo-WPBs was dependent on the carboxy-terminal D4-C1-C2-C3-CK domains of VWF. IGFBP7 remained attached to ultralarge VWF strings released upon exocytosis of WPBs under flow. The presence of IGFBP7 in WPBs highlights the role of this subcellular compartment in regulation of angiogenesis. KEYWORDS: endothelial cells, Weibel-Palade bodies, IGFBP7, proteome, angiogenesis

■

INTRODUCTION Weibel-Palade bodies (WPBs) are secretory granules found in endothelial cells (ECs).1 The main component of these cigarshaped organelles is von Willebrand factor (VWF),2 an important mediator of primary hemostasis. The formation of WPBs from the trans-Golgi network (TGN) is driven by highly ordered condensation of VWF multimers into helical structures that appear as tubular striations at the level of electron microscopy.3−6 WPBs are rapidly released upon stimulation by several agonists including thrombin, histamine and epinephrine.7 In response to secretagogues, WPBs fuse with the plasma membrane and ultralarge VWF (ULVWF) filaments are released providing a platform for adhesion of blood platelets.5,8,9 In addition to VWF, WPBs contain a number of other proteins involved in vascular homeostasis.7,10 P-selectin and interleukin 8 (IL-8) are WPB components involved in inflammation, mediating leukocyte recruitment and adhesion.11,12 Osteoprotegerin (OPG) antagonizes a receptor © 2012 American Chemical Society

activator of nuclear factor-kappaB (NF-κB) ligand (RANKL) which promotes vascular calcification.13−15 The WPB component Ang-2 promotes destabilization of the vasculature by antagonizing the binding of angiopoietin-1 to the Tie-2 receptor.16 Endothelin-1 and endothelin converting enzyme are involved in regulation of vascular tone.17,18 The presence of vaso-active, inflammatory and hemostatic proteins implies that release of bioactive components from WPBs is crucial for maintaining vascular homeostasis. The plasticity of WPBs is exemplified by the observation that IL-8 and eotaxin-3 are only present in WPBs following up-regulation by interleukin 1β (IL1β) and interleukin 4 (IL-4).11,12,19 Chemokines interleukin 6 (IL-6), monocyte chemoattractant protein-1 (MCP-1) and growth-regulated oncogene-α (GROα) have also been shown to localize to WPBs following up-regulation by IL-1β. Sorting Received: January 5, 2012 Published: April 2, 2012 2925

dx.doi.org/10.1021/pr300010r | J. Proteome Res. 2012, 11, 2925−2936

Journal of Proteome Research

Article

the cells were homogenized by subjecting them to 20 strokes in a ball-bearing cell homogenizer (Isobiotec, Heidelberg, Germany) with a 14 μm clearance. Cellular debris and nuclei were removed by centrifugation for 10 min at 153× g at 4 °C. The perinuclear supernatant was collected and loaded on a selfgenerating density gradient (40% Percoll in buffer containing 0.42 M sucrose, 33.7 mM Tris pH 7.4, 1.68 mM EDTA) and a 2 mL cushion of 2.5 M sucrose was carefully underlayered. The Percoll gradient centrifugation was performed using an ultracentrifuge (Beckman) with a fixed angle Ti 50.2 rotor for 30 min at 100000× g, 4 °C. Fractions of 1.15 mL were manually collected from the bottom of the gradient. Percoll fractions containing the WPBs were identified by VWF ELISA as described previously.26 Fractions containing the highest amounts of WPBs were pooled and loaded on a 10−50% Nycodenz gradient. Nycodenz solutions were made in STE buffer. The Nycodenz gradient centrifugation was performed for 90 min at 100000× g at 4 °C. Fractions of 0.6 mL were collected manually from the bottom of the gradient. Nycodenz fractions containing WPBs were identified by VWF ELISA. The two fractions containing the highest amount of VWF were pooled and concentrated using an Amicon Ultra-4 Centrifugal Filter Unit (Millipore, Billerica, MA). Concentrated WPBcontaining fractions were analyzed by SDS-PAGE (10%) under reducing conditions; proteins were visualized using silver staining. Following silver staining the gel was washed with ultrapure water and lanes containing the samples were cut in 27 or 28 pieces. Each piece was processed for in-gel digestion using 6.25 ng/μL trypsin essentially as described previously.27,28

of these and other chemokines to WPBs has been proposed to result from “overload” of the constitutive secretory pathway.20 Other studies have suggested that active sorting of proteins to WPBs requires a direct interaction with VWF. This is illustrated by OPG and also IL-8, which can bind to VWF and are targeted specifically to WPBs.15,21 To gain more insight in the physiological role of WPBs and to identify novel WPB cargo proteins, we performed mass spectrometry analysis of WPB-enriched endothelial subcellular fractions. Thirty-five novel candidate WPB-residents were identified, including insulin-like growth factor binding protein-7 (IGFBP7), which is reported to be involved in angiogenesis. Immunocytochemisty revealed that IGFBP7 is a bona fide component of WPBs. Agonist-induced release of WPBs resulted in release of IGFBP7 from endothelial cells, which remains associated to VWF strings. The presence of IGFBP7 in WPBs emphasizes the crucial role of this storage compartment in regulating release of mediators of angiogenesis.

■

MATERIAL AND METHODS

Cell Culture

Human umbilical vein endothelial cells (HUVECs) were isolated from human umbilical cords and grown in EGM-2 medium (Lonza, Walkersville, MD). Cells were cultured on fibronectin and were used at passage 1 to 4. Stimulations of endothelial cells were performed in the following manner; HUVECs were grown at 100% confluency for several days, washed with serum free (SF) medium containing 50% M199, 50% RPMI1640, 300 mg/L L-glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin (all obtained from Invitrogen, Breda, The Netherlands) and preincubated for 1 h with SF medium at 37 °C. Subsequently, SF medium was replaced with SF medium alone or SF medium containing either 100 μM histamine, 50 ng/mL phorbol 12-myristate 13-acetate (PMA) or 10 μM forskolin +100 μM 3-isobutyl-1-methylaxanthine (IBMX) (all obtained from Sigma-Aldrich Chemie, Zwijndrecht, The Netherlands). Blood outgrowth endothelial cells (BOECs) were isolated as previously described.22 Fifty ml of venous blood was drawn from healthy anonymous volunteers, with written consent, in accordance with Dutch regulations and approval from the Sanquin Ethical Advisory Board. Mock and KLF2 lentivirus were prepared as described previously.23 Passage 6 BOECs were transduced by a single exposure to KLF2 or mock lentivirus in the presence of 8 μg/mL Polybrene and centrifuged for 90 min at 153xg and 37 °C. After a total incubation time of 4 h at 37 °C, the medium was refreshed. Transduced BOECs were cultured as described previously.24

Preparation of TMT-labeled Samples for Mass Spectrometry

After stimulation of the cells with forskolin plus IBMX in HEPES buffer or HEPES buffer alone, the medium was collected and concentrated to a final volume of 100 μL using an Amicon Ultra-4 Centrifugal Filter Unit (Millipore). Proteins in stimulated medium samples were chemically labeled with TMT127, unstimulated medium samples were labeled with TMT126 respectively, according to the manufacturer’s recommendations for intact protein labeling (TMT Mass Tagging Kits and Reagents, Thermo Scientific, Bremen, Germany). After TMT labeling the samples were mixed and a silverstaining and an in-gel digestion were performed as described for the WPB-enriched fractions. TMT-labeled samples were subjected to chymotrypsin digestion (6.25 ng/ μL chymotrypsin). Analysis of Samples by Mass Spectrometry

Preparation of WPB Enriched Fractions for Mass Spectrometry

Eluted peptides were separated using a reverse-phase C18 column (50 μm × 20 cm, 5 μm particles) (Nanoseparations, Nieuwkoop, The Netherlands), at a flow rate of 100 nL/min with a 40 min gradient from 0% to 35% (v/v) acetonitrile with 0.5% acetic acid. Eluted peptides were sprayed directly into the LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific Inc.) using a nanoelectrospray source with a spray voltage of 1.9 kV. For the WPB-enriched fractions, the five most intense precursor ions in the full scan (300−2000 m/z, resolving power 60.000) with a charge state of 2+ or higher were selected for CID using an isolation width of 3 Da, a 30% normalized collision energy, and an activation time of 30 ms. For the relative quantitation by TMT-labeling, the three most intense precursor ions in the full scan (300−2000 m/z, resolving power 60.000) with a charge state of 2+ or higher

Isolation of WPBs by density gradient centrifugation was performed by a modification of a previously described procedure.25 HUVECs were grown to confluency, the medium was refreshed and cells were kept at 100% confluency for 4 to 5 days. On the day of the fractionation cells were washed with prewarmed PBS. Cells were harvested by incubation with trypsin in PBS at 37 °C. Soybean Trypsin Inhibitor (0.2 mg/ mL) in ice-cold STE buffer (1.25 M sucrose, 100 mM Tris pH 7.4, 5 mM EDTA) was added to the cell suspension. The cells were pelleted at 153× g for 10 min at 4 °C, washed 2 times with ice-cold STE buffer and resuspended in 2 mL ice-cold STE buffer. Two-hundred microliters of Protease inhibitor Cocktail (Sigma-Aldrich Chemie) were added to the cell suspension and 2926



Article

Table 1. List of Known and Potentially Novel Components of Weibel-Palade Bodiesa coverage

# Peptides

P11021 P02765 O15123 P21810 P27797 P43121 P10909 P02452 P02461 Q12805

15.75 3.27 13.91 2.99 3.36 2.32 22.05 0.82 0.75 1.83

P14625 Q9UNN8 Q9Y2E5 P14616 Q16270 P8648 Q86SG7 P08493 Q13201 Q02818 P26022 Q9BTY2 Q9Y646 P05121 P16284 Q9Y4D7 P30101 P13667 P07237 P16109 A6NEC2 P50454 P09486 P07996 Q5TIE3 P04275 Q5VU13

accession

score

MW (kDa)

8 1 6 1 1 1 8 1 1 1

72.7 26.6 29.9 3.1 14.1 10.3 92.5 4.7 4.8 9.0

72.3 39.3 56.9 41.6 48.1 71.6 52.5 138.9 138.5 54.6

7.35 5.46 0.99 0.54 5.67 1.72 5.19 10.68 7.49 2.17 2.62 5.57 6.99 18.16 5.15 0.99 4.75 6.67 9.45 3.37 5.02 2.87 4.29 12.14 1.39

5 1 1 1 1 1 1 1 6 1 1 2 3 5 3 1 2 4 4 2 2 1 1 12 1

32.7 5.5 4.8 4.2 4.8 3.9 2.7 2.8 74.3 3.0 2.7 7.4 13.5 34.4 16.2 4.3 16.2 19.0 34.5 13.1 7.9 5.6 7.2 181.3 2.5

92.4 26.7 113.9 143.6 29.1 114.5 23.5 12.3 138.0 53.8 41.9 54.0 51.9 45.0 82.5 211.9 56.7 72.9 57.1 90.8 53.7 48.4 346 129.3 133.7

41.17 7

88 3

3225.8 17.6

309.1 43.9

description

reference

78 kDa-regulated protein Alpha-2-HS-glycoprotein Angiopoietin-2 Biglycan Calreticulin Cell Surface glycoprotein MUC18 Clusterin Collagen alpha-1(I) chain Collagen alpha-1(III) chain EGF-containing fibulin-like extracellular matrix protein 1 Endoplasim Endothelial protein C receptor Epididymis-specific alpha-mannosidase Insulin receptor-related protein Insulin-like growth factor-binding protein 7 Integrin alpha-5 Lysozyme g-like protein 2 Matrix Gla protein Multimerin-1 Nucleobindin-1 Pentraxin-related protein PTX3 Plasma alpha-L-fucosidase Plasma glutamate carboxypeptidase Plasminogen activator inhibitor 1 Platelet endothelial cell adhesion molecule Plexin-D1 Protein disulfide-isomerase A3 Protein disulfide-isomerase A4 Protein disulfide-isomerase P-selectin Puromycin-sensitive aminopeptidase-like protein Serpin H1 SPARC Thrombospondin-1 von Willebrand factor A domain-containing protein 5B1 von Willebrand factor V-set and immunoglobulin domain-containing protein 8

Fiedler et al., 2004

new WPB component

Bonfanti et al., 1989 and McEver et al., 1989

Wagner et al., 1982

a The accession number, sequence coverage (in % of total number of amino acids), number of peptides identified, protein score as calculated using Proteome Discoverer 1.1, molecular weight (MW) and a description of known and potentially novel components of WPBs are provided. A reference is provided for the established WPB components or WPB-associated proteins. Annotated spectra of all proteins identified on the basis of a single peptide assignment are provided in the Supplemental spectra (Supporting Information).

and the dynamic modification oxidation of methionines. For the WPB-enriched fractions the peptides were searched against a decoy database with a FDR of 1%. All peptides with a charge state of 2 have a minimal Xcorr score of 2.43. Peptides with a charge state of 3 have a minimal Xcorr score of 3.355. For charge state 4, 3.34 and charge state 5, 3.345. For the relative quantification by TMT-labeling the peptides were searched against a decoy database with a FDR of 5%. All peptides with a charge state of 2 have a minimal Xcorr score of 2.105. Peptides with a charge state of 3 have a minimal Xcorr score of 2.7. For charge state 4, 2.999 and charge state 5, 3.0049. All peptides not complying with these criteria were excluded. The protein score displayed in Table 1 and Supplemental Table 2 (Supporting Information) has been calculated using Proteome

were selected for CID using an isolation width of 2 Da, a 35% normalized collision energy, and an activation time of 30 ms. The same precursor ions were subjected to HCD with a normalized collision energy of 60%, which allows for the identification of the TMT label. Collision-induced dissociation (CID) spectra and higher energy collision-induced dissociation (HCD) spectra were acquired as described by Dayon et al.29 Peptide Identification

The peptides, including TMT labeled lysine residues, were identified using a SEQUEST search algorithm and UniprotKB protein database 25.H_sapiens.fasta using Proteome Discoverer release version 1.1 software (Thermo Fisher Scientific). In the SEQUEST search a precursor mass tolerance of 10 ppm was allowed. Fragment mass tolerance was 0.8 Da. Furthermore, the static modification carbamidomethylated cysteines was used 2927



Article

Figure 1. (A) Analysis of subcellular fractions containing Weibel-Palade bodies. Subcellular fractionation was performed on HUVECs. VWF content of fractions of Percoll and Nycodenz density gradients were measured by ELISA. The first peak, fractions 5−8, of the Percoll gradient corresponds to the dense WPB fraction. The second peak contains ER, Golgi and constitutively released vesicles. Fractions 5−8 were loaded on a Nycodenz gradient and subsequently processed for mass spectrometry. (B) Schematic overview of the data analysis. Proteins (18 out of 237) also identified in a control sample derived from a part of the gel on which no sample was loaded were excluded from our data set. A total of 219 proteins was used for further analysis.

GACTTGTGC 3′. The VWFΔA3 variant lacking amino acid sequence 1672−1876 was constructed using primer 5′ CTGCAGAGGTGCTGCTCC//AGGATTTGCATGGATGAG 3′ and 5′ CTCATCCATGCAAATCCT//GGAGCAGCACCTCTGCAG 3′. All variants were constructed using the QuikChange XL Site-directed Mutagenesis kit acoording to the manufacturer’s protocol (Stratagene, La Jolla, CA). All constructs were verified by sequence analysis.

Discoverer release version 1.1 software (Thermo Fisher Scientific). Fluorimetric Hexosaminidase Assay

Levels of the lysosomal marker, β-hexosaminidase, in the collected subcellular fractions were assayed as follows: 10 μL of each sample was added to 100 μL 0.79 mM 4MU-GlcNac (M2133, Sigma Aldrich) in McIIvaine buffer (0.1 M citric acid, 0.2 M Na2HPO4, pH 4.0) and were incubated for 15 min at 37 °C. The reaction was terminated by addition of 2.5 mL stop buffer (0.3 M glycine/NaOH, pH 10.6). Subsequently the fluorescence intensity was measured using a Synergy HT microplate reader (Biotek, Instruments, VT).

Fluorescence Microscopy

Cells were grown on glass coverslips and were fixed with icecold methanol or 3.7% PFA under static conditions. Flow experiments were performed as described previously.24 Shortly, HUVECs were grown under static conditions, stimulated with SF medium containing 100 μM histamine at 2.5 dyn/cm2 and fixed under flow. Fixed cells were blocked with 1% bovine serum albumin (BSA) (Albumin Fraktion V, Merck, Darmstad, Germany). VWF was visualized using rabbit polyclonal antihuman VWF antibody (Dako, Glostrup, Denmark) or mouse monoclonal anti-VWF CLB-RAg20 antibody (Sanquin, Amsterdam, The Netherlands). IGFBP7 was stained with a mouse monoclonal antibody (R&D systems, Abingdon, U.K.). For the P-selectin staining, rabbit polyclonal anti-human CD62P antibody was used (BD Biosciences, Breda, The Netherlands). Secondary antibodies used were Alexa Fluor 568-conjugated goat anti-rabbit and Alexa Fluor 488-conjugated goat antimouse (Molecular Probes, Breda, The Netherlands). Nuclei were stained with DAPI (Molecular Probes). The cells were embedded in Mowiol 4.88 mounting medium (Calbiochem,

Construction of VWF Variants

The expression vector pcDNA3.1-VWF has been described previously.26 The VWF-CA1 variant was constructed by introducing a stop codon beyond Pro1458 using primers 5′ ACTGTGGGCCCGTGAGGCTGCTGCAGC 3′ and 5′ GCTGCAGCAGCCTCACGGGCCCACAGT 3′ (stop codon underlined) resulting in a VWF variant truncated beyond the A1 domain. The VWFΔA1 variant lacking amino acid sequence 1241−1479 was constructed using primer 5′ GAAGCCTGCCAGGAGCCG//CCGGGGCTCTTGGGGGTTTCG 3′ and 5′ CGAAACCCCCAAGAGCCCCGG// CGGCTCCTGGCAGGCTTC 3′ (domain borders indicated by //). The VWFΔA2 variant lacking amino acid sequence 1480−1671 was constructed using primer 5′ GCACAAGTCACTGTGGGC//GGAGAGGGGCTGCAGATC 3′ and 5′ GATCTGCAGCCCCTCTCC//GCCCACAGT2928



Article

Figure 2. Identification of IGFBP7 by MS. Spectrum corresponding to the TELLPGDRDNLAIQTR peptide of IGFBP7 is shown. Corresponding y and b series are marked above the spectrum. Peptide charge: +2; MH+: 1811.96050 Da; XCorr: 2.55.

Figure 3. IGFBP7 is localized to Weibel-Palade bodies in endothelial cells. Endogenous IGFBP7 in HUVECs was visualized using a mouse antiIGFBP7 antibody followed by an Alexa Fluor-488 labeled goat anti-mouse antibody (middle panel). VWF was visualized with rabbit anti-VWF antibody and Alexa Fluor-568 labeled goat anti-rabbit antibody (left panel). Nuclei were stained using DAPI. Scale bar corresponds to 10 μm. Inset in merge shows punctuate staining of IGFBP7 in WPBs.

Nottingham, U.K.). The immunostained cells were examined by confocal microscopy using a Zeiss LSM510 microscope (Carl Zeiss, Sliedrecht, The Netherlands) equipped with the appropriate filters.

separated by SDS-PAGE and transferred to a nitrocellulose membrane. After transfer, membrane was blocked for 1 h with 5% skim milk powder and 0.05% Tween-20 in PBS and incubated with mouse monoclonal antibody to IGFBP7 diluted in PBS containing 1% skim milk powder and 0.05% Tween-20 in PBS overnight at 4 °C. The primary antibody was subsequently detected with sheep anti-mouse-HRP antibody (GE Healthcare) and visualized using chemiluminescence blotting (Roche).

Immunoprecipitation

HUVECs were kept at 100% confluency for 2 days and stimulated with either 100 μM histamine or 10 μM forskolin plus 100 μM IBMX. After stimulation the medium was harvested and VWF antigen in harvested media was quantified by ELISA. Data were analyzed using a two-tailed unpaired t test (Graphpad Prism version 5). Media were precleared by incubation with Protein A Sepharose beads (GE healthcare, Uppsala, Sweden) for 2 h at 4 °C. Subsequently, medium was incubated with washed Protein A Sepharose beads with bound polyclonal anti-IGFBP7 antibody (R&D systems). The beads were washed 5 times with buffer containing 150 mM NaCl, 50 mM Tris-HCl (pH 8.5), 5 mM EDTA, 10% sucrose, 1% NP-40 supplemented with 1 tablet of Complete Protease Inhibitor Cocktail (Roche Diagnostics, Mannheim, Germany) per 50 mL. Proteins were eluted from the beads by adding DTTcontaining sample buffer for 10 min at RT followed by 10 min incubation at 95 °C. Subsequently, eluted proteins were

■

RESULTS

IGFBP7 Localizes to WPBs in Endothelial Cells

We used a proteomic approach to identify novel candidate residents of WPBs. Subcellular fractionation of cell lysates of HUVECs was performed in order to isolate WPBs. The fractions containing WPBs were identified by VWF ELISA. Postnuclear supernatant was loaded on a Percoll gradient (Figure 1A, left panel). The dense fractions (5−8) containing WPBs were further purified by Nycodenz gradient centrifugation (Figure 1A, right panel). WPB containing fractions were concentrated and analyzed by mass spectrometry as described in material and methods. Screening against a decoy database 2929



Article

Figure 4. Carboxy-terminal domains of VWF are crucial for targeting of IGFBP7 to pseudo-WPBs. (A) Schematic overview of VWF variants used in this study. (B) Cotransfections of P-selectin with full length (FL) VWF, ΔA1, ΔA2, ΔA3 and CA1, in HEK293 cells. Nuclei were stained with DAPI (blue). Scale bars: 5 μm. (C) Transfection of FL VWF ΔA1, ΔA2, ΔA3 and CA1 in HEK293 cells. Cells were stained for VWF and endogenous IGFBP7. Nuclei were stained using DAPI (blue). Scale bars: 5 μm.

mass spectrometry (Figure 2). To verify the mass-spectrometry data analysis we studied the subcellular localization of IGFBP7. Paired immunostaining and confocal analysis revealed colocalization of IGFBP7 and VWF (Figure 3). Single stainings for IGFBP7 confirmed localization of endogenous IGFBP7 within WPBs (Figure S1, Supporting Information). In a subset of WPBs, IGFBP7 staining was not homogeneous but concentrated in discrete spots along WPBs. This suggests that IGFBP7 may localize to subdomains of WPBs (Figure 3; inset).

revealed that 219 out of the 237 originally identified proteins were present within WPB-enriched fractions (Figure 1B). Our primary goal was to define the contents of WPBs. Therefore, a set of 44 proteins linked to cytoskeleton, ribosomes, mitochondria or nucleus were excluded using the online functional annotation tool Panther (www.pantherdb.org). Interestingly, the Rab27A effector MyRIP which has been implicated in WPB release previously, was present within this subset of proteins.30 Of the remaining 175 proteins, those that did not contain a signal peptide were excluded since these proteins are unlikely to enter the secretory pathway (Figure 1B). This subset included small GTP binding proteins RalA and Rab3D which have been previously localized to WPBs.25,31,32 CD63 was also present within this subset of proteins since online tool SignalP (http://www.cbs.dtu.dk/ services/SignalP/) was not able to correctly predict the signal peptide of this established WPB component.33 Of the remaining 66 proteins 28 were assigned to lysosomes using the annotation tool DAVID (see Supplementary Table S1, Supporting Information). The obtained data set of 38 identified proteins included three known WPB components: VWF, Pselectin and Ang-2. A total of 35 potentially novel WPB components were identified (Table 1). One of the identified proteins was insulin-like growth factor binding protein 7 (IGFBP7). A single peptide TELLPGDRDNLAIQTR, corresponding to residues 206−220 of IGFBP7, was detected by

IGFBP7 is Targeted to Pseudo-WPBs in Transfected HEK293 Cells

Expression of VWF in HEK293 cells results in the formation of pseudo-WPBs.34,35 Staining for endogenous IGFBP7 in HEK293 cells revealed a punctuate staining that suggested that IGFBP7 is localized in small subcellular organelles (Supplemental Figure S2, Supporting Information). However, ectopic expression of VWF in HEK293 cells caused the targeting of endogenous IGFBP7 to pseudo-WPBs. This finding is consistent with the observed colocalization of endogenous VWF and IGFBP7 in HUVECs. To address whether specific domains of VWF are required for the targeting of IGFBP7 to pseudo-WPBs, a set of VWF deletion mutants lacking the A-domains and carboxyterminal D4, C1-C2-C3, CK domains were expressed in HEK293 cells (Figure 4). Formation of pseudo-WPBs in HEK293 is dependent on the 2930



Article

presence of the amino-terminal D1-D3-domains of VWF, which have been shown to bind P-selectin.36 Expression of the different VWF variants resulted in the formation of pseudoWPBs (Figure 4B). Overexpressed P-selectin was localized in pseudo-WPBs induced by VWFΔA1, VWFΔA2 and VWFΔA3 indicating that the A domains of VWF are not required for cotargeting of P-selectin. P-selectin was also cotargeted to pseudo-WPBs induced by a VWF variant truncated beyond the A1 domain (CA1) (Figure 4B). These data are consistent with a role for the D1-D3 domains in targeting of P-selectin to pseudo-WPBs.36 We subsequently investigated the targeting of endogenous IGFBP7 to pseudo-WPBs induced by VWFΔA1, VWFΔA2 and VWFΔA3 and VWFCA1. Results from these analyses indicate that the A-domains of VWF are not involved in targeting of IGFBP7 to pseudo-WPBs (Figure 4C). Interestingly, no colocalization between IGFBP7 and VWFCA1 was observed; IGFBP7 was localized to small vesicles in HEK293 cells expressing VWFCA1 which did not colocalize with pseudo-WPBs (Figure 4C). These results suggest that one or more VWF carboxy-terminal domains (D4, C1, C2, C3 and/or CK) are required for the targeting of IGFBP7 to pseudo-WPBs.

Figure 5. Regulated release of IGFBP7 and VWF from WPBs. (A) HUVECs were stimulated with either histamine (His), forskolin (FSK) or incubated with serum free medium (SF) for 1 h. IGFBP7 was immunoprecipitated from the collected medium using antiIGFBP7 antibody immobilized on Sepharose beads. Immunoprecipitates were subsequently analyzed for the presence of IGFBP7 by immunoblot. (B) Concentration of VWF secreted in the medium used for IGFBP7 immunoprecipitation was measured by ELISA (**P < 0.05 and ***P < 0.005 2-tailed unpaired t test) (C). HUVECs were stimulated with SF medium without (−) or with PMA (+). Subsequently, cells were fixed and immunostained for endogenous VWF (left panels) and IGFBP7 (middle panels). Nuclei were stained using DAPI. Scale bar is 10 μm.

Regulated Release of IGFBP7 from WPBs

WPBs can rapidly release their content into the bloodstream in response to physiological stimuli.7 Here, we analyzed the agonist induced release of IGFBP7 from HUVECs. Conditioned medium of unstimulated HUVECs and histamine or forskolin stimulated HUVECs was collected and IGFBP7 was immunoprecipitated from culture supernatants and analyzed by Western blotting (Figure 5A). In parallel, VWF levels in culture supernatants were measured by ELISA (Figure 5B). Increased levels of both IGFBP7 and VWF were observed in conditioned medium from histamine and forskolin stimulated endothelial cells as compared to medium of unstimulated cells. To further explore the regulated release of IGFBP7 we stained stimulated and unstimulated HUVECs for IGFBP7 and VWF. VWF as well as IGFBP7 staining was markedly reduced in HUVECs stimulated with the phorbol ester PMA when compared to unstimulated HUVECs (Figure 5C). Forskolin-induced IGFBP7 secretion from HUVECs was further quantified using chemical peptide labeling with amine-reactive isobaric tags TMT (tandem mass tags). Releasates of forskolinstimulated HUVECs were chemically labeled with TMT127 labels and unstimulated HUVECs were labeled by TMT126 labels. The TMT126 and TMT127-labeled samples were mixed, processed and analyzed by MS as described in materials and methods. VWF was used as positive control. Spectra of individual peptides found for IGFBP7 and VWF are shown in Figure 6. For IGFBP7 a TMT127 modified peptide corresponding to amino acid sequence VLVSPLSKEDAGEY is displayed (Figure 6A). The intensity of the TMT127-labeled VLVSPLSKEDAGEY-peptide representing IGFBP7 in the releasate obtained following forskolin-stimulation was higher when compared to the TMT126 labeled peptide recovered from the releasate from nonstimulated cells. In Figure 6B, a TMT127 labeled peptide derived of VWF (AGSQVASTSEVLKY) is displayed. Part of the HCD spectrum displaying relative quantification of the TMT126 and TMT127 labels derived of peptide VLVSPLKEDAGEY of IGFBP7 is displayed in Figure 6C. Part of the HCD spectrum displaying the relative intensity of the TMT126 and TMT127 labels derived of peptide AGSQVASTSEVLKY is displayed in Figure 6D.

Twelve and 22 unique peptides of VWF were identified in the releasate of two independent experiments. The ratio of 127/126 labeled peptides was 2.7 and 4.1 for VWF for these two experiments. One and two unique labeled peptides were observed for IGFBP7 in two independent experiments. The ratio of 127/126 for the IGFBP7-derived peptides was 1.4 and 1.8 for these experiments. The differences in 127/126 ratios obtained for VWF and IGFBP7 most likely reflect the relative amount of these proteins that is stored in WPBs. Nevertheless, these data further confirm that IGFBP7 is released with VWF in response to secretagogues that induce WPB release. IGFBP7 Binds to Ultra Large VWF Strings Released by Endothelial Cells

Upon exocytosis of WPBs multimeric VWF assembles into ultralarge (UL) VWF strings that remain attached to the cell surface.9 Previously we demonstrated that factor VIII remained attached to ULVWF strings following its release from lentivirus-transduced endothelial cells.24 To explore whether IGFBP7 also localizes to ULVWF strings we cultured HUVECs under static condition and stimulated the cells by perfusion of medium containing 100 μM histamine at 2.5 dyn/cm2 to induce the formation of ULVWF strings. Co-staining of endogenous VWF and IGFBP7 revealed that IGFBP7 was bound to VWF strings following agonist induced WPB exocytosis (Figure 7). Interestingly, staining of ULVWF strings for IGFBP7 revealed a punctuated pattern which suggests that IGFBP7 is not homogeneously distributed along ULVWF strings. 2931



Article

Figure 6. Quantification of released IGFBP7 and VWF using chemical peptide labeling with amine-reactive isobaric tandem mass tags (TMT). Releasates of forskolin treated and untreated HUVEC were labeled with TMT127 and TMT126, respectively. Samples were pooled and analyzed by MS. (A) Spectrum of TMT127-labeled peptide VLVSPLKEDAGEY of IGFBP7 and the corresponding fragment ions y and b series of the peptide. 2932



Article

Figure 6. continued Charge: +2; MH+: 1731.91911 Da; RT: 42.78 min; XCorr: 2.88. (B) Spectrum of TMT127-labeled peptide AGSQVASTSEVLKY derived of VWF and the corresponding fragment ions y and b series of the peptide. Charge: +2; MH+: 1664.89165 Da; RT: 39.81; XCorr: 2.55. (C) Part of the HCD spectrum of peptide VLVSPLKEDAGEY of IGFBP7 displaying the intensity of the TMT126 and TMT127 labels. (D) Part of the HCD spectrum of peptide AGSQVASTSEVLKY displaying the intensity of the TMT126 and TMT127 labels.

Figure 8. IGFBP7 is down-regulated by the transcription factor KLF2. (A) Mock- or KLF2-transduced BOECs were stained for VWF (left panel) and IGFBP7 (middle panel). Nuclei were stained with DAPI (blue). Scale bars: 5 μm. (B) Western blot analysis of cell lysates of mock- and KLF2-transduced BOECs. KLF2 expression in mock- and KLF2-transduced cell lysates, upper panel. IGFBP7 expression is displayed in middle panel. In the lower panel, α-tubulin is displayed as a protein loading control.

Figure 7. IGFBP7 localizes to ultralarge VWF strings. HUVECs were cultured in flow chambers and stimulated under flow with 100 μM histamine at 2.5 dyn/cm2. The cells were fixed and stained for IGFBP7 and VWF. Nuclei were stained with DAPI. The direction of the flow is from right to left. ULVWF strings are visualized by staining for VWF. Scale bar: 50 μm (A) and 20 μm (B).

subcellular fractions obtained after two rounds of density gradient fractionation of postnuclear supernatant revealed the presence of 237 proteins. Eight proteins present within or associated with WPBs which included VWF,2 MyRIP,38 CD63,39 RalA,25 P-selectin,40,41 Ang-2,42 clathrin43 and Rab3D44 were identified in this proteomic screen (see Figure 1). We were unable to detect the established WPB-components OPG, endothelin, endothelin converting enzyme and α1,3fucosyltransferase VI. This may be due to the low amount of these proteins in WPBs. A number of chemokines localize to WPBs only after up-regulation of their synthesis by cytokines such as IL-4 and IL-1β.11,12,19,20 Since we did not stimulate ECs with IL-4 or IL-1β, this may explain the absence of IL-6, IL-8, GROα, eotaxin-3 and MCP-1 in the WPB-enriched fractions. As reported previously, subcellular fractions containing WPBs also contain lysosomal proteins.31 Levels of the lysosomal marker β-hexosaminidase were measured in subcellular fractions of a Percoll gradient followed by a Nycodenz gradient (Figure S3, Supporting Information). Only peak fractions of the Nycodenz gradient were used for analysis by mass spectrometry. The amount of β-hexosaminidase present in this fraction was 0.25% of that present in the post nuclear supernatant whereas this fraction contained 3.3% of the total VWF present in the postnuclear supernatant (see Legend of Figure S3 for details, Supporting Information). These data show that despite the relative enrichment of WPBs these subcellular fractions also contain lysosomes. MS analysis indeed revealed a large number of lysosomal proteins, such as βhexosaminidase (see Supplemental Table, Supporting Informa-

Expression of IGFBP7 is Reduced by KLF2

In the vasculature endothelial cells are subject to blood-flow generated laminar shear stress, which has a considerable impact on their phenotype. Upon exposure to hemodynamic forces the expression of the transcription factor Krüppel-like factor 2 (KLF2) is up-regulated.37 Previously we have shown that KLF2 reduces the Ang-2 content of WPBs (van Agtmaal et al., submitted for publication). Here we investigated whether KLF2 modulates the expression of IGFBP7. We also compared the subcellular localization of IGFBP7 in KLF2- and mocktransduced BOECs by confocal microscopy. This analysis revealed that IGFBP7 was still localized to WPBs in KLF2 expressing cells (Figure 8A). However, the expression of IGFBP7 appeared to be down-regulated in KLF2-transduced cells compared to the mock-transduced cells (Figure 8B). These data show that KLF2 regulates IGFBP7 levels in endothelial cells.

■

DISCUSSION Following the identification of VWF as a resident of WPBs almost thirty years ago, storage of several other proteins in these endothelial secretory vesicles has been reported.2,7 To date, however, the list of WPB components is still relatively short. Here we used an unbiased proteomic screen to identify additional components of WPBs. Mass spectrometry analysis of 2933



Article

lack of WPBs) has recently been shown to promote neovascularisation.57 We speculate that the observed effects are caused by deregulated secretion of angiogenic factors (such as Ang-2 and IGFBP7) that are stored in WPBs. We have shown that the Ang-2 content of WPBs is strongly reduced in endothelial cells expressing KLF2 (Van Agtmaal et al., submitted for publication). KLF2 endows endothelial cells with an anti-inflammatory, antiproliferative quiescent phenotype.37 Under these conditions also IGFBP7 expression is down-regulated suggesting that WPB-contained IGFBP7 and Ang-2 comprise an angiogenic reservoir that is regulated by (patho)physiological changes in blood flow. Apart from IGFBP7, we also addressed the subcellular localization of pentraxin related protein PTX3 in HUVEC. Lack of a suitable antibody precluded assignment of PTX3 to WPBs (data not shown). Further studies using validated antibodies directed against candidate WPB components listed in Table 1 (and Supplementary Table 1, Supporting Information) are needed to establish whether these protein are “bona fide” WPB residents. In summary, using an unbiased proteomic screen we identified IGFBP7 as a novel WPB component. While the physiological role of IGFBP7 storage in the WPBs needs to be determined, we hypothesize that a rapid release of angiogenic factors from these endothelial cell specific organelles is crucial for maintaining vascular homeostasis.

tion). We processed our initial data by excluding lysosomal proteins and selected proteins that contain a signal peptide. This yielded a list of 35 potential novel WPB-residents. In view of the large number of proteins found in the WPB-containing fractions verification whether the identified proteins are indeed bona fide WPB-residents is needed. This study defines IGFBP7 as a novel component of WPBs. IGFBP7 also called Mac25, IGFBP-related protein-1, angiomodulin or tumor-derived adhesion factor (TAF), belongs to the IGFBP superfamily, and can bind to insulin growth factor (IGF) and insulin.45 IGFBP7 is expressed in different human tissues.46 Furthermore, it has been shown that IGFBP7 accumulates in blood vessels of human tumor tissues.47−49 Although it is established that endothelial cells express IGFBP7, the subcellular localization of this protein has not yet been reported. Here, we provide evidence that this member of the IGFBP superfamily is targeted to WPBs. Interestingly, in HUVECs endogenous IGFBP7 is only localized to WPBs and not in other vesicular structures, as described for several cytokines like IL-8 and GROα.20,21 This observation suggests that IGFBP7 is specifically sorted to WPBs. In agreement with these findings, IGFBP7 is localized to pseudo-WPBs that are generated following expression of VWF in HEK293 cells. Using a series of VWF variants we showed that the carboxy-terminal D4-C1-C2-C3-CK domains are needed for cotargeting of IGFBP7 to pseudo-WPBs. These results suggest that binding of IGFBP7 to VWF is required for its targeting to WPBs. Release of the content of WPBs can be induced by different stimuli.8 Here, we demonstrated using three different approaches that IGFBP7 is secreted in parallel with VWF upon stimulation with different secretagogues. Furthermore, we showed that IGFBP7 is localized to ULVWF strings after WPB release, probably due to a direct binding of IGFBP7 to VWF. Recently, we have shown that factor VIII can also associate with ULVWF strings on the surface of endothelial cells.24 In addition, physical association of OPG to VWF in plasma has been reported.15 Noncovalent association with VWF may provide a general mechanism for specific targeting of secretory proteins to WPBs to allow for their regulated release into the bloodstream. An elegant study revealed that WPBs can transiently fuse with the plasma membrane in a lingering kiss thereby releasing only small components like IL-8.50 We speculate that a subset of WPB constituents which includes IGFBP7 bind to VWF and therefore are not released during a lingering kiss. Instead, these WPB components remain attached to ULVWF strings following their release which allows for a slow dispersal of the associated protein into the vascular lumen. Although the expression of IGFBP7 has been evaluated in several studies, the biological function of this secretory protein is not yet fully established. A role of IGFBP7 in angiogenesis has been suggested.47,51,52 However, the exact role of IGFBP7 in angiogenesis remains unclear; several studies have shown that it has a pro-angiogenic effect, while others show an antiangiogenic effect.52−54 This raises the possibility that the angiogenic effect of IGFBP7 is context or dose dependent. IGFBP7 can bind to VEGF and different extracellular matrix (ECM) proteins, including collagen IV and heparin sulfate.55 The composition of the ECM is important for angiogenesis in different ways. For example, ECM modulates cell adhesion and migration by wound healing.56 We postulate that IGFBP7 can be released from WPBs causing a rapid increase in local levels of IGFBP7 allowing for a spatially and temporally restricted regulation of angiogenesis. A deficiency of VWF (resulting in a

■

ASSOCIATED CONTENT

S Supporting Information *

Supporting Information includes a table and two figures. Table S1 contains the list of lysosomal proteins that were found in the subcellular fractions enriched for WPBs. Table S2 shows all proteins identified in the subcellular fraction enriched for WPBs. Figure S1 shows the localization of endogenous IGFBP7 in endothelial cells. Figure S2 shows the distribution of IGFBP7 in nontransfected and VWF transfected HEK293 cells. This material is available free of charge via the Internet at http:// pubs.acs.org.

■

AUTHOR INFORMATION

Corresponding Author

*Tel +31-20-5123120; e-mail: [email protected]. Author Contributions ‡

These authors contributed equally to this work.

Notes

The authors declare no competing financial interest.

■

ACKNOWLEDGMENTS This study was supported by grants from The Netherlands Organization for Scientific Research (NWO-TOP 91209006) and The Netherlands Thrombosis Foundation (TSN2007.01).

■

ABBREVIATIONS Ang2, angiopoietin-2; HUVEC, human umbical vein endothelial cells; IGFBP7, insulin-like growth factor binding protein 7; KLF2, Krű ppel-like factor 2; ULVWF, ultra large von Willebrand factor; VWF, von Willebrand factor; WPBs, Weibel-Palade bodies.

■

REFERENCES

(1) Weibel, E. R.; Palade, G. E. New cytoplasmic components in arterial endothelia. J. Cell Biol. 1964, 23 (1), 101−112.

2934



Article

(2) Wagner, D. D.; Olmsted, J. B.; Marder, V. J. Immunolocalization of von Willebrand protein in Weibel-Palade bodies of human endothelial cells. J. Cell Biol. 1982, 95 (1), 355−360. (3) Michaux, G.; Cutler, D. F. How to roll an endothelial cigar: the biogenesis of Weibel-Palade bodies. Traffic 2004, 5 (2), 69−78. (4) Valentijn, K. M.; Valentijn, J. A.; Jansen, K. A.; Koster, A. J. A new look at Weibel-Palade body structure in endothelial cells using electron tomography. J. Struct. Biol. 2008, 161 (3), 447−458. (5) Michaux, G.; Abbitt, K. B.; Collinson, L. M.; Haberichter, S. L.; Norman, K. E.; Cutler, D. F. The physiological function of von Willebrand’s factor depends on its tubular storage in endothelial Weibel-Palade bodies. Dev. Cell 2006, 10 (2), 223−232. (6) Berriman, J. A.; Li, S.; Hewlett, L. J.; Wasilewski, S.; Kiskin, F. N.; Carter, T.; Hannah, M. J.; Rosenthal, P. B. Structural organization of Weibel-Palade bodies revealed by cryo-EM of vitrified endothelial cells. Proc. Natl. Acad. Sci. U.S.A. 2009, 106 (41), 17407−17412. (7) Rondaij, M. G.; Bierings, R.; Kragt, A.; van Mourik, J. A.; Voorberg, J. Dynamics and plasticity of Weibel-Palade bodies in endothelial cells. Arterioscler. Thromb. Vasc. Biol. 2006, 26 (5), 1002− 1007. (8) Valentijn, K. M.; Sadler, J. E.; Valentijn, J. A.; Voorberg, J.; Eikenboom, J. Functional architecture of Weibel-Palade bodies. Blood 2011, 117 (19), 5033−5043. (9) Dong, J.-f.; Moake, J. L.; Nolasco, L.; Bernardo, A.; Arceneaux, W.; Shrimpton, C. N.; Schade, A. J.; McIntire, L. V.; Fujikawa, K.; López, J. A. ADAMTS-13 rapidly cleaves newly secreted ultralarge von Willebrand factor multimers on the endothelial surface under flowing conditions. Blood 2002, 100 (12), 4033−4039. (10) Metcalf, D. J.; Nightingale, T. D.; Zenner, H. L.; Lui-Roberts, W. W.; Cutler, D. F. Formation and function of Weibel-Palade bodies. J. Cell Sci. 2008, 121 (1), 19−27. (11) Utgaard, J. O.; Jahnsen, F. L.; Bakka, A.; Brandtzaeg, P.; Haraldsen, G. Rapid secretion of prestored interleukin 8 from WeibelPalade bodies of microvascular endothelial cells. J. Exp. Med. 1998, 188 (9), 1751−1756. (12) Wolff, B.; Burns, A. R.; Middleton, J.; Rot, A. Endothelial cell “memory” of inflammatory stimulation: human venular endothelial cells store interleukin 8 in Weibel-Palade bodies. J. Exp. Med. 1998, 188 (9), 1757−1762. (13) Collin-Osdoby, P. Regulation of vascular calcification by osteoclast regulatory factors RANKL and osteoprotegerin. Circ. Res. 2004, 95 (11), 1046−1057. (14) Morony, S.; Tintut, Y.; Zhang, Z.; Cattley, R. C.; Van, G.; Dwyer, D.; Stolina, M.; Kostenuik, P. J.; Demer, L. L. Osteoprotegerin inhibits vascular calcification without affecting atherosclerosis in ldlr(−/−) mice. Circulation 2008, 117 (3), 411−420. (15) Zannettino, A. C. W.; Holding, C. A.; Diamond, P.; Atkins, G. J.; Kostakis, P.; Farrugia, A.; Gamble, J.; To, L. B.; Findlay, D. M.; Haynes, D. R. Osteoprotegerin (OPG) is localized to the WeibelPalade bodies of human vascular endothelial cells and is physically associated with von Willebrand factor. J. Cell. Physiol. 2005, 204 (2), 714−723. (16) Fiedler, U.; Augustin, H. G. Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 2006, 27 (12), 552− 558. (17) Kawanabe, Y.; Nauli, S. Endothelin. Cell. Mol. Life Sci. 2011, 68 (2), 195−203. (18) Russell, F. D.; Skepper, J. N.; Davenport, A. P. Human endothelial cell storage granules: a novel intracellular site for isoforms of the endothelin-converting enzyme. Circ. Res. 1998, 83 (3), 314− 321. (19) Oynebråten, I.; Bakke, O.; Brandtzaeg, P.; Johansen, F.-E.; Haraldsen, G. Rapid chemokine secretion from endothelial cells originates from 2 distinct compartments. Blood 2004, 104 (2), 314− 320. (20) Knipe, L.; Meli, A.; Hewlett, L.; Bierings, R.; Dempster, J.; Skehel, P.; Hannah, M. J.; Carter, T. A revised model for the secretion of tPA and cytokines from cultured endothelial cells. Blood 2010, 116 (12), 2183−2191.

(21) Bierings, R.; Van Den Biggelaar, M.; Kragt, A.; Mertens, K.; Voorberg, J.; Van Mourik, J. A. Efficiency of von Willebrand factormediated targeting of interleukin-8 into Weibel−Palade bodies. J. Thromb. Haemostasis 2007, 5 (12), 2512−2519. (22) van den Biggelaar, M.; Bouwens, E. A.; Kootstra, N. A.; Hebbel, R. P.; Voorberg, J.; Mertens, K. Storage and regulated secretion of factor VIII in blood outgrowth endothelial cells. Haematologica 2009, 94 (5), 670−678. (23) Dekker, R. J.; van Thienen, J. V.; Rohlena, J.; de Jager, S. C.; Elderkamp, Y. W.; Seppen, J.; de Vries, C. J.; Biessen, E. A.; van Berkel, T. J.; Pannekoek, H.; Horrevoets, A. J. Endothelial KLF2 links local arterial shear stress levels to the expression of vascular tone-regulating genes. Am. J. Pathol. 2005, 167 (2), 609−618. (24) Bouwens, E. A. M.; Mourik, M. J.; van den Biggelaar, M.; Eikenboom, J. C. J.; Voorberg, J.; Valentijn, K. M.; Mertens, K. Factor VIII alters tubular organization and functional properties of Von Willebrand factor stored in Weibel-Palade bodies. Blood 2011. (25) de Leeuw, H. P.; Wijers-Koster, P. M.; van Mourik, J. A.; Voorberg, J. Small GTP-binding protein RalA associates with WeibelPalade bodies in endothelial cells. Thromb. Haemostasis 1999, 82 (3), 1177−1181. (26) van den Biggelaar, M.; Meijer, A. B.; Voorberg, J.; Mertens, K. Intracellular cotrafficking of factor VIII and von Willebrand factor type 2N variants to storage organelles. Blood 2009a, 113 (13), 3102−3109. (27) Shevchenko, A.; Wilm, M.; Vorm, O.; Mann, M. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem. 1996, 68 (5), 850−858. (28) Piersma, S. R.; Broxterman, H. J.; Kapci, M.; de Haas, R. R.; Hoekman, K.; Verheul, H. M. W.; Jiménez, C. R. Proteomics of the TRAP-induced platelet releasate. J. Proteomics 2009, 72 (1), 91−109. (29) Dayon, L.; Pasquarello, C.; Hoogland, C.; Sanchez, J.-C.; Scherl, A. Combining low- and high-energy tandem mass spectra for optimized peptide quantification with isobaric tags. J. Proteomics 2010, 73 (4), 769−777. (30) Nightingale, T. D.; Pattni, K.; Hume, A. N.; Seabra, M. C.; Cutler, D. F. Rab27a and MyRIP regulate the amount and multimeric state of VWF released from endothelial cells. Blood 2009, 113 (20), 5010−5018. (31) de Leeuw, H. P. J. C.; Fernandez-Borja, M.; Reits, E. A. J.; Romani de Wit, T.; Wijers-Koster, P. M.; Hordijk, P. L.; Neefjes, J.; van Mourik, J. A.; Voorberg, J. Small GTP-binding protein Ral modulates regulated exocytosis of von Willebrand factor by endothelial cells. Arterioscler. Thromb. Vasc. Biol. 2001, 21 (6), 899−904. (32) Knop, M.; Aareskjold, E.; Bode, G.; Gerke, V. Rab3D and annexin A2 play a role in regulated secretion of vWF, but not tPA, from endothelial cells. EMBO J. 2004, 23 (15), 2982−2992. (33) Vischer, U.; Wagner, D. CD63 is a component of Weibel-Palade bodies of human endothelial cells. Blood 1993, 82 (4), 1184−1191. (34) Michaux, G.; Hewlett, L. J.; Messenger, S. L.; Goodeve, A. C.; Peake, I. R.; Daly, M. E.; Cutler, D. F. Analysis of intracellular storage and regulated secretion of 3 von Willebrand disease-causing variants of von Willebrand factor. Blood 2003, 102 (7), 2452−2458. (35) Wang, J.-W.; Valentijn, K. M.; de Boer, H. C.; Dirven, R. J.; van Zonneveld, A. J.; Koster, A. J.; Voorberg, J.; Reitsma, P. H.; Eikenboom, J. Intracellular storage and regulated secretion of von Willebrand factor in quantitative von Willebrand disease. J. Biol. Chem. 2011. (36) Michaux, G.; Pullen, T. J.; Haberichter, S. L.; Cutler, D. F. Pselectin binds to the D′-D3 domains of von Willebrand factor in Weibel-Palade bodies. Blood 2006, 107 (10), 3922−3924. (37) Dekker, R. J.; Boon, R. A.; Rondaij, M. G.; Kragt, A.; Volger, O. L.; Elderkamp, Y. W.; Meijers, J. C. M.; Voorberg, J.; Pannekoek, H.; Horrevoets, A. J. G. KLF2 provokes a gene expression pattern that establishes functional quiescent differentiation of the endothelium. Blood 2006, 107 (11), 4354−4363. (38) Nightingale, T. D.; Pattni, K.; Hume, A. N.; Seabra, M. C.; Cutler, D. F. Rab27a and MyRIP regulate the amount and multimeric state of VWF released from endothelial cells. Blood 2009, 113 (20), 5010−5018. 2935



Article

(39) Vischer, U. M.; Wagner, D. D. CD63 is a component of WeibelPalade bodies of human endothelial cells. Blood 1993, 82 (4), 1184− 1191. (40) Bonfanti, R.; Furie, B. C.; Furie, B.; Wagner, D. D. PADGEM (GMP140) is a component of Weibel-Palade bodies of human endothelial cells. Blood 1989, 73 (5), 1109−1112. (41) McEver, R. P.; Beckstead, J. H.; Moore, K. L.; Marshall-Carlson, L.; Bainton, D. F. GMP-140, a platelet alpha-granule membrane protein, is also synthesized by vascular endothelial cells and is localized in Weibel-Palade bodies. J. Clin. Invest. 1989, 84 (1), 92−99. (42) Fiedler, U.; Scharpfenecker, M.; Koidl, S.; Hegen, A.; Grunow, V.; Schmidt, J. M.; Kriz, W.; Thurston, G.; Augustin, H. G. The Tie-2 ligand angiopoietin-2 is stored in and rapidly released upon stimulation from endothelial cell Weibel-Palade bodies. Blood 2004, 103 (11), 4150−4156. (43) Zenner, H. L.; Collinson, L. M.; Michaux, G.; Cutler, D. F. High-pressure freezing provides insights into Weibel-Palade body biogenesis. J. Cell Sci. 2007, 120 (Pt 12), 2117−2125. (44) Knop, M.; Aareskjold, E.; Bode, G.; Gerke, V. Rab3D and annexin A2 play a role in regulated secretion of vWF, but not tPA, from endothelial cells. EMBO J. 2004, 23 (15), 2982−2992. (45) Collet, C.; Candy, J. How many insulin-like growth factor binding proteins? Mol. Cell. Endocrinol. 1998, 139 (1−2), 1−6. (46) Degeorges, A.; Wang, F.; Frierson, H. F.; Seth, A.; Sikes, R. A. Distribution of IGFBP-rP1 in normal human tissues. J. Histochem. Cytochem. 2000, 48 (6), 747−754. (47) Akaogi, K.; Okabe, Y.; Sato, J.; Nagashima, Y.; Yasumitsu, H.; Sugahara, K.; Miyazaki, K. Specific accumulation of tumor-derived adhesion factor in tumor blood vessels and in capillary tube-like structures of cultured vascular endothelial cells. Proc. Natl. Acad. Sci. U.S.A. 1996, 93 (16), 8384−8389. (48) Pen, A.; Moreno, M. J.; Martin, J.; Stanimirovic, D. B. Molecular markers of extracellular matrix remodeling in glioblastoma vessels: Microarray study of laser-captured glioblastoma vessels. Glia 2007, 55 (6), 559−572. (49) van Beijnum, J. R.; Dings, R. P.; van der Linden, E.; Zwaans, B. M. M.; Ramaekers, F. C. S.; Mayo, K. H.; Griffioen, A. W. Gene expression of tumor angiogenesis dissected: specific targeting of colon cancer angiogenic vasculature. Blood 2006, 108 (7), 2339−2348. (50) Babich, V.; Meli, A.; Knipe, L.; Dempster, J. E.; Skehel, P.; Hannah, M. J.; Carter, T. Selective release of molecules from WeibelPalade bodies during a lingering kiss. Blood 2008, 111 (11), 5282− 5290. (51) Tamura, K.; Hashimoto, K.; Suzuki, K.; Yoshie, M.; Kutsukake, M.; Sakurai, T. Insulin-like growth factor binding protein-7 (IGFBP7) blocks vascular endothelial cell growth factor (VEGF)-induced angiogenesis in human vascular endothelial cells. Eur. J. Pharmacol. 2009, 610 (1−3), 61−67. (52) Pen, A.; Moreno, M. J.; Durocher, Y.; Deb-Rinker, P.; Stanimirovic, D. B. Glioblastoma-secreted factors induce IGFBP7 and angiogenesis by modulating Smad-2-dependent TGF-[beta] signaling. Oncogene 2008, 27 (54), 6834−6844. (53) Hooper, A. T.; Shmelkov, S. V.; Gupta, S.; Milde, T.; Bambino, K.; Gillen, K.; Goetz, M.; Chavala, S.; Baljevic, M.; Murphy, A. J.; Valenzuela, D. M.; Gale, N. W.; Thurston, G.; Yancopoulos, G. D.; Vahdat, L.; Evans, T.; Rafii, S. Angiomodulin is a specific marker of vasculature and regulates vascular endothelial growth factor-Adependent neoangiogenesis. Circ. Res. 2009, 105 (2), 201−208. (54) Sun, T.; Cao, H.; Xu, L.; Zhu, B.; Gu, Q.; Xu, X. Insulin-like growth factor binding protein-related protein 1 mediates VEGFinduced proliferation, migration and tube formation of retinal endothelial cells. Curr. Eye Res. 2011, 36 (4), 341−349. (55) Kishibe, J.; Yamada, S.; Okada, Y.; Sato, J.; Ito, A.; Miyazaki, K.; Sugahara, K. Structural requirements of heparan sulfate for the binding to the tumor-derived adhesion factor/angiomodulin that induces cordlike structures to ECV-304 human carcinoma cells. J. Biol. Chem. 2000, 275 (20), 15321−15329.

(56) Arroyo, A. G.; Iruela-Arispe, M. L. Extracellular matrix, inflammation, and the angiogenic response. Cardiovasc. Res. 2010, 86 (2), 226−235. (57) Starke, R. D.; Ferraro, F.; Paschalaki, K. E.; Dryden, N. H.; McKinnon, T. A. J.; Sutton, R. E.; Payne, E. M.; Haskard, D. O.; Hughes, A. D.; Cutler, D. F.; Laffan, M. A.; Randi, A. M. Endothelial von Willebrand factor regulates angiogenesis. Blood 2011, 117 (3), 1071−1080.

2936


Proteomic Screen Identifies IGFBP7 as a Novel ... - ACS Publications

Recommend Documents