Article pubs.acs.org/molecularpharmaceutics
Putative Transmembrane Domain 6 of the Human Organic Anion Transporting Polypeptide 1A2 (OATP1A2) Influences Transporter Substrate Binding, Protein Trafficking, and Quality Control Ting Chan,† Jian Zheng,†,‡ Ling Zhu,§ Thomas Grewal,† Michael Murray,∥ and Fanfan Zhou*,† †
Faculty of Pharmacy, The University of Sydney, Sydney, NSW 2006, Australia Alkali Soil Natural Environmental Science Center, Northeast Forestry University/Key Laboratory of Saline-alkali Vegetation Ecology Restoration in Oil Field, Ministry of Education, Harbin 150040, China § Retinal Therapeutics Research Group, Save Sight Institute, The University of Sydney, Sydney, NSW 2000, Australia ∥ Discipline of Pharmacology, School of Medical Sciences, The University of Sydney, Sydney, NSW 2006, Australia ‡
ABSTRACT: The human organic anion transporting polypeptides (OATPs) are a family of important membrane proteins that mediate the cellular influx of various anionic substances including clinically important drugs. Transmembrane domain 6 (TM6) is a distinctive consensus “signature” common to all OATPs. Two naturally occurring variants were previously identified in TM6 of the important transporter OATP1A2; these variants may be associated with suboptimal drug influx into cells. Because of the potential importance of TM6 in drug efficacy, this study investigated its role in substrate uptake by OATP1A2. Single amino acid replacements were introduced into TM6 of OATP1A2 (residues 245−266) by alaninescanning mutagenesis. Uptake assays, biotinylation and immunoblotting were used to assess the function and expression of OATP1A2 and its mutants after overexpression in HEK293 cells. Uptake of the model substrates estrone-3-sulfate and methotrexate by OATP1A2 mutants carrying amino acid replacements within the TM6 subregions of 245−248 and 261−266 was impaired, while transport function was largely retained by other mutants. From kinetic, biotinylation, and immunoblot analysis the diminished function of the 245−248 and 261−266 mutants was due primarily to decreased plasma membrane and total cell expression and also to a less extent, impacted by altered substrate binding. Further experiments with proteasomal or lysosomal inhibitors were consistent with impaired maturation and impaired plasma membrane insertion of several mutants of OATP1A2 within the subregions of 245− 248 and 261−266. In addition, the finding that total cellular expression, but not plasma membrane expression, was less impaired for the W245A and W246A mutants suggests that these two TM6 residues might be involved in membrane targeting of OATP1A2. These findings implicate the TM6 subregions of 245−248 and 261−266 in substrate binding, protein trafficking, and quality control of OATP1A2. KEYWORDS: organic anion transporting polypeptide 1A2, membrane trafficking, transporter substrate binding, protein quality control
■
INTRODUCTION Organic anion transporting polypeptides (OATPs), encoded by the SLCO gene family, are multispecific transporters that mediate the cellular influx of organic anions and a range of clinically important drugs.1 OATPs are expressed in the epithelial cells of various organs, including the liver and kidney, which underscores their clinical importance in drug absorption, distribution, and elimination.2 To the present, 11 human OATPs have been identified; four of which, including OATP1A2, significantly influence drug action.3,4 OATP1A2 (encoded by the SLCO1A2 gene) is expressed in hepatic cholangiocytes where it regulates drug excretion into bile,5 in the distal nephron of the kidney where it regulates urinary secretion,5 and in endothelial cells of cerebral capillaries at the blood−brain barrier.6 Although it has been suggested that OATP1A2 facilitates drug absorption in the © 2014 American Chemical Society
intestine, its expression in this tissue is currently inconclusive.7−9 OATP1A2 transports a broad range of endogenous substrates, including bile acids, steroid and thyroid hormones, and clinically important drugs such as imatinib, fexofenadine, methotrexate, HIV protease inhibitors, and HMG-CoA reductase inhibitors.10−14 It has been well established that OATPs share common topological features including 12 transmembrane domains (TMs) and a highly conserved sequence known as an OATP family signature between extracellular loop 3 and TM6.1,15 Interestingly, this signature is conserved among human, rat, and Received: Revised: Accepted: Published: 111
July 2, 2014 November 9, 2014 November 11, 2014 November 11, 2014 dx.doi.org/10.1021/mp500459b | Mol. Pharmaceutics 2015, 12, 111−119
Molecular Pharmaceutics
Article
Figure 1. Putative topological structure of OATP1A2 using the TransMembrane prediction using Hidden Markov Models program: http://www. cbs.dtu.dk/services/TMHMM-2.0/. Previously identified residues in TM6 that are encoded by pharmacogenetic variants are circled.
Table 1. Primer Sequences Used to Engineer OATP1A2 TM6 Mutants TM6 mutants
forward primer (5′ to 3′)
reverse primer (5′ to 3′)
W245A W246A F247A G248A F249A L250A I251A C252A G254A V255A N256A V257A L258A T259A I261A P262A F263A F264A F265A L266A
GTTGGGTCGGTGCAGCGTGGTTTGGCTTTCTG GTTGGGTCGGTGCATGGGCGTTTGGCTTTCTGATTTG GTCGGTGCATGGTGGGCTGGCTTTCTGATTTGTG GGTGCATGGTGGTTTGCCTTTCTGATTTGTGC GTGCATGGTGGTTTGGCGCTCTGATTTGTGCAGGAG CATGGTGGTTTGGCTTTGCGATTTGTGCAGGAGTTAAC GTGGTTTGGCTTTCTGGCTTGTGCAGGAGTTAACGTG GCATGGTGGTTTGGCTTTCTGATTGCTGCAGGAGTTAA CTTTCTGATTTGTGCAGCAGTTAACGTGCTCACTG GCTTTCTGATTTGTGCAGGAGCTAACGTGCTCACTG CTGATTTGTGCAGGAGTTGCCGTGCTCACTGCCATTC GTGCAGGAGTTAACGCGCTCACTGCCATTC TTGTGCAGGAGTTAACGTGGCCACTGCCATTCC GTTAACGTGCTCGCTGCCATTCC GAGTTAACGTGCTCACTGCCGCTCCTTTTTTCTTTTTGC ACGTGCTCACTGCCATTGCTTTTTTCTTTTTGCCC GTGCTCACTGCCATTCCTGCTTTCTTTTTGCCCAACAC CTCACTGCCATTCCTTTTGCCTTTTTGCCCAACACACTT GTGCTCACTGCCATTCCTTTTTTCGCTTTGCCCAACAC CTCACTGCCATTCCTTTTTTCTTTGCGCCCAACACACT
CAGAAAGCCAAACCACGCTGCACCGACCCAAC CAAATCAGAAAGCCAAACGCCCATGCACCGACCCAAC CACAAATCAGAAAGCCAGCCCACCATGCACCGAC GCACAAATCAGAAAGGCAAACCACCATGCACC CTCCTGCACAAATCAGAGCGCCAAACCACCATGCAC GTTAACTCCTGCACAAATCGCAAAGCCAAACCACCATG CACGTTAACTCCTGCACAAGCCAGAAAGCCAAACCAC TTAACTCCTGCAGCAATCAGAAAGCCAAACCACCATGC CAGTGAGCACGTTAACTGCTGCACAAATCAGAAAG CAGTGAGCACGTTAGCTCCTGCACAAATCAGAAAGC GAATGGCAGTGAGCACGGCAACTCCTGCACAAATCAG GAATGGCAGTGAGCGCGTTAACTCCTGCAC GGAATGGCAGTGGCCACGTTAACTCCTGCACAA GGAATGGCAGCGAGCACGTTAAC GCAAAAAGAAAAAAGGAGCGGCAGTGAGCACGTTAACTC GGGCAAAAAGAAAAAAGCAATGGCAGTGAGCACGT GTGTTGGGCAAAAAGAAAGCAGGAATGGCAGTGAGCAC AAGTGTGTTGGGCAAAAAGGCAAAAGGAATGGCAGTGAG GTGTTGGGCAAAGCGAAAAAAGGAATGGCAGTGAGCAC AGTGTGTTGGGCGCAAAGAAAAAAGGAATGGCAGTGAG
mouse OATPs/oatps.16 However, the absence of a crystal structure precludes a detailed understanding of the relationship between the function and stability of OATP1A2 and its topology. We previously identified two pharmacogenetic variants of OATP1A2 in which the amino acid replacements, V255I and T259P, were located in TM6 (Figure 1); the T259P variant was associated with impaired clearance of the tyrosine kinase inhibitor drug imatinib in patients.17 It has also been reported recently that two conserved tryptophan residues within TM6 are critical for substrate binding and surface expression of the liver specific OATP1B1.18,19 To evaluate in greater detail the importance of TM6 residues in OATP1A2 function we utilized alanine-scanning mutagenesis to replace individual amino acids.
These OATP1A2 mutants were then characterized functionally after overexpression in HEK293 (human embryonic kidney) cells. The principal finding to emerge was that two subregions of TM6, which span the residues 245−248 and 261−266, have critical roles in substrate binding, protein trafficking, and quality control in OATP1A2.
■
MATERIALS AND METHODS Materials. [3H] estrone-3-sulfate (E3S; specific activity 57.3 Ci/mmol) was purchased from PerkinElmer (Melbourne, VIC, Australia) and [3H] methotrexate (MTX; specific activity 15.7 Ci/mmol) was purchased from BioScientific (Kirrawee, NSW, Australia). Culture media was obtained from Thermo Scientific 112
dx.doi.org/10.1021/mp500459b | Mol. Pharmaceutics 2015, 12, 111−119
Molecular Pharmaceutics
Article
Figure 2. Transporter function of OATP1A2 and its TM6 mutants. Transport of (A) 300 nM [3H] E3S and (B) 5 μM [3H] MTX was measured in HEK293 cells that overexpressed OATP1A2 and its TM6 mutants. Transporter-mediated uptake was calculated by subtracting uptake by vector transfected cells from that in cells that expressed wild-type or mutant OATP1A2s. Values are mean ± SE (n = 3). Different from control: *p < 0.05; **p < 0.01; ***p < 0.001.
conducted for 8 min as uptake in HEK293 cells was linear over this period. The cells were then solubilized in 0.2 M NaOH, neutralized with 0.2 M HCl, and aliquoted for liquid scintillation counting. Uptake was standardized to the amount of protein in each well. Kinetic studies were performed with varying concentrations of E3S (0.05−80 μM) and MTX (3− 100 μM) over 4 min; where possible apparent Km and Vmax values for transport activity were then calculated (GraphPad Prism 5.0; GraphPad Inc., LaJolla, CA). Cell Treatments, Electrophoresis, and Immunoblotting. Twenty-four hours after transfection, HEK293 cells were treated with the lysosomal inhibitors chloroquine (100 μM) or leupeptin/pepstatin A (100 and 25 μg/mL respectively) or the proteasomal inhibitor MG132 (10 μM) for 16 h.23 Cells were then collected and treated with lysis buffer (10 mM Tris, 150 mM NaCl, 1 mM EDTA, 0.1% SDS, and 1% Triton X-100 that contained phenylmethylsulfonyl fluoride (200 mg/mL) and leupeptin (3 mg/mL, pH 7.4). Protein was quantified by the method of Bradford.24 Denatured samples (50 μg) were loaded onto 7.5% polyacrylamide minigels and electrophoresed using a minicell (Bio-Rad, Gladesville, NSW, Australia). Proteins were transferred to polyvinylidene fluoride membranes in an electroelution cell (Bio-Rad) and blocked for 1 h with 5% skim dry milk in PBS-Tween (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, and 0.05% Tween 20; pH 7.5), washed, and then incubated overnight at 4 °C with antiOATP1A2 antibody (1 μg/mL; VWR International, Murarrie, QLD, Australia; Cat. No: sc-48744). The membranes were washed and incubated with goat antirabbit IgG conjugated to horseradish peroxidase (1:5000; VWR International), and
(Lidcombe, NSW, Australia). Chloroquine, leupeptin, pepstatin A and MG132 were purchased from Sapphire Biosciences (Redfern, NSW, Australia). Unless otherwise stated, all other chemicals and biochemicals were purchased from SigmaAldrich (Castle Hill, NSW, Australia). Site-Directed Mutagenesis and Overexpression of OATP1A2 Variants in HEK293 Cells. The OATP1A2 cDNA was purchased from GeneCopoeia (Cat. No: GCQ0577) and was subcloned into the PCI vector (Promega, Alexandria, NSW, Australia) as described previously. 17 OATP1A2 TM6 mutants were generated using Pfu DNA polymerase (Promega, Alexandria, NSW, Australia) with the primers listed in Table 1. All sequences were confirmed by the dideoxy chain-termination method (Ramaciotti Centre for Gene Function Analysis). HEK293 (ATCC, Manassas, VA) cells were maintained at 37 °C and 5% CO2 in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum. Cells were transfected with plasmid DNA using Lipofectamine 2000 Reagent (Invitrogen, Mount Waverley, VIC, Australia). Substrate uptake was measured 24 h after transfection. Transport Studies. Cellular uptake of [3H] E3S (final concentration 0.3 μM, 67 nCi/well) in HEK293 cells was conducted at 37 °C as described previously.17,20−22 Uptake was initiated in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4, pH 7.4) containing 1 mM CaCl2 and 1 mM MgCl2, and was terminated by rapidly washing the cells in PBS at 4 °C. Similarly, the uptake of [3H] MTX (final concentration 5 μM, 94 nCi/well) was performed in PBS (pH 5.5; 37 °C). Studies were 113
dx.doi.org/10.1021/mp500459b | Mol. Pharmaceutics 2015, 12, 111−119
Molecular Pharmaceutics
Article
signals were detected using the Immobilon Western Chemiluminescent HRP substrate (Merck Millipore, Kilsyth, VIC, Australia). Biotinylation of Plasma Membrane Transporter Protein. The membrane-impermeable biotinylation reagent NHS-SS-biotin (Campbell Science, Rockford, IL) was used to determine the cell surface expression of OATP1A2 and its mutants. Twenty-four hours after transfection, the medium was removed and the cells were washed with ice-cold PBS (pH 8.0; 3 mL). Cells were incubated on ice with 1 mL of freshly prepared NHS-SS-biotin (0.5 mg/mL in PBS, pH 8.0) for 30 min with gentle shaking. After biotinylation, unreacted NHSSS-biotin was quenched by washing the cells with 3 mL of PBS containing 100 mM glycine three times. Cells were then incubated for 30 min with lysis buffer and cell debris was removed by centrifugation at 14,000g at 4 °C. Equivalent quantities of protein lysates from each sample (Bradford assay) were loaded onto streptavidin-agarose beads (50 μL; GenScript, Piscataway, NJ), eluted and subjected to immunoblotting analysis, as described above. After probing with antiOATP1A2 (1 μg/mL; VWR International), the blots were stripped and reprobed with an antibody directed against the Na+−K+ ATPase antibody β1 subunit (1 μg/mL; VWR International; Cat. No: sc-21713). In addition, the membranes of biotinylated samples were routinely reprobed with anti-αactin antibody (1 μg/mL; VWR International) to confirm the absence of the cytosolic protein α-actin. Statistics. The Student’s t test was used to test for the difference between two sets of normally distributed data. Differences in transport function of OATP1A2 and the generated mutants were detected by one-way analysis of variance and Dunnett’s testing. Data are expressed as mean ± SEM with a p value of 20% of wild-type; Figure 2) so that kinetic studies were feasible. The activities of the remaining 245−248 and 261−266 TM6
subregion mutants in E3S and MTX transport were low, which prevented the reliable determination of kinetic parameters. We also derived the kinetic parameters of four randomly selected mutants (F249A, C250A, G254A, and N256A) from the 249−260 subregion, in which transporter function was less impaired (Tables 2 and 3). The affinity of the OATP1A2 F264A mutant for the substrate E3S was moderately enhanced relative to wild-type (Km value 12.19 ± 3.42 μM versus 21.73 ± 3.75 μM for wildtype), while those of the other mutants were unchanged (Table 2). Similar findings were noted for MTX uptake by the W245A mutant (Km value 7.34 ± 1.23 μM versus 17.90 ± 1.28 μM for wild-type), while those of the other mutants remained unchanged (Table 3). These data suggest that the residues W245 and F264 potentially impact the binding of OATP1A2 to MTX and E3S, respectively. Additionally, the Vmax values for E3S and/or MTX uptake by the W245A, F247A, and F264A mutants were significantly lower than those for the wild-type transporter (Tables 2 and 3), while those for the other mutants were only slightly decreased relative to wild-type. These findings suggested that residues in the two TM6 subregions (245−248 and 261−266) may modulate transporter expression at the plasma membrane and/or regulate transporter turnover.25−27 These possibilities were tested in subsequent experiments. Cellular Expression of OATP1A2 and Its TM6 Variants. Biotinylation was used to assess the expression of OATP1A2 and its TM6 mutants at the plasma membrane. As reported previously, the mature form of the transporter present at the 114
dx.doi.org/10.1021/mp500459b | Mol. Pharmaceutics 2015, 12, 111−119
Molecular Pharmaceutics
Article
Figure 3. Cell surface expression of OATP1A2 and its TM6 mutants in HEK293 cells. (A) Cell were biotinylated with NHS-SS-biotin, and the labeled cell surface proteins were isolated on streptavidin−agarose beads and separated by gel electrophoresis. Immunoblots were probed with antiOATP1A2 antibody (upper panel) and then reprobed with anti-Na+−K+ ATPase β subunit antibody. (B) Densitometric analysis of transporter plasma expression after normalization to Na+−K+ ATPase β subunit. Values are mean ± SE (n = 3). Different from control: *p < 0.05; **p < 0.01; ***p < 0.001. WT, wild-type; NC, negative control (vector transfected cells).
plasma membrane was detected on immunoblots at ∼95 kDa, while another signal at ∼65 kDa, which represents a less abundant immature intracellular isoform, was minimally detected in total cell lysates (not shown); the immature isoform was not available for biotinylation.17,20,22 As shown in Figure 3A,B, plasma membrane expression of the ∼95 kDa isoform was greatly diminished in the OATP1A2 mutants that carried alanine residues at 261−266 (
