Pyrazinamide Resistance Is Caused by Two ... - ACS Publications

Subscriber access provided by University of Glasgow Library

Article

Pyrazinamide resistance is caused by two distinct mechanisms: prevention of Coenzyme A depletion and loss of virulence factor synthesis Pooja Gopal, Michelle Yee, Jickky Sarathy, Jian Liang Low, Jansy Passiflora Sarathy, Firat Kaya, Veronique Dartois, Martin Gengenbacher, and Thomas Dick ACS Infect. Dis., Just Accepted Manuscript • DOI: 10.1021/acsinfecdis.6b00070 • Publication Date (Web): 11 Jul 2016 Downloaded from http://pubs.acs.org on July 12, 2016

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

ACS Infectious Diseases is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Infectious Diseases

Pyrazinamide resistance is caused by two distinct mechanisms: prevention of Coenzyme A depletion and loss of virulence factor synthesis

Pooja Gopal†, Michelle Yee†, Jickky Sarathy†, Jian Liang Low†, Jansy P. Sarathy‡, Firat Kaya‡, Véronique Dartois‡, Martin Gengenbacher†, Thomas Dick†*

†

Department of Microbiology and Immunology, Yong Loo Lin School of Medicine, National

University of Singapore, Singapore, Republic of Singapore ‡

Public Health Research Institute and New Jersey Medical School, Rutgers, The State

University of New Jersey, Newark, USA

1 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ABSTRACT Pyrazinamide (PZA) is a critical component of first and second line treatment of tuberculosis (TB), yet its mechanism of action largely remains an enigma. We carried out a genetic screen to isolate Mycobacterium bovis BCG mutants resistant to pyrazinoic acid (POA), the bioactive derivative of PZA, followed by whole genome sequencing of 26 POA resistant strains. Rather than finding mutations in the proposed candidate targets fatty acid synthase I and ribosomal protein S1, we found resistance conferring mutations in two pathways: missense mutations in aspartate decarboxylase panD, involved in synthesis of the essential acyl carrier coenzyme A (CoA), and frameshift mutations in the vitro non-essential polyketide synthase genes mas and ppsA-E, involved in the synthesis of the virulence factor phthiocerol dimycocerosate (PDIM). Probing for cross resistance to two structural analogs of POA, nicotinic acid and benzoic acid, showed that the analogs share the PDIM but not the CoA related mechanism of action with POA. We demonstrated that POA depletes CoA in wild type bacteria, which is prevented by mutations in panD. Sequencing ten POA resistant Mycobacterium tuberculosis H37Rv isolates confirmed the presence of at least two distinct mechanisms of resistance to the drug. Emergence of resistance through the loss of a virulence factor in vitro may explain the lack of clear molecular patterns in PZA resistant clinical isolates, other than mutations in the prodrug converting enzyme. The apparent interference of POA with virulence pathways may contribute to the drug’s excellent in vivo efficacy compared to its modest in vitro potency.

KEYWORDS: Tuberculosis, pyrazinamide, pyrazinoic acid, resistance, mechanism of action


Page 2 of 35

Page 3 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


PZA is a critical component of the current first line regimen to treat TB. Its inclusion in the regimen in the 1980s resulted in dramatically shortening therapy duration from 12 to 6 months, i.e. PZA is a key sterilizing drug (1). The current 6-month regimen is still too lengthy to ensure compliance, affecting not only cure rates but also facilitating development of drug resistance. Treatment shortening to 2 months or less is therefore a major goal in TB drug development (2). Most new drug combinations currently in preclinical and clinical development include PZA (3), although its mechanism of action remains ill defined. Considering the clinically proven sterilizing activity of PZA, identification of its target(s) may provide clues and effective approaches for the discovery of shortened chemotherapeutic regimens. PZA is a prodrug that requires hydrolysis to the bioactive form pyrazinoic acid (POA). Prodrug conversion is carried out by the bacterial amidase PncA, the inactivation of which causes resistance in vitro (4), and also by host enzymes (5). Until recently it was believed that PZA/POA is active in vitro under acidic conditions only. Extracellular low pH was part of the suggested mechanism of action of the drug: POA, a low molecular weight carboxylic acid, was thought to act as an ionophore affecting membrane energetics and causing intracellular acidification (6, 7). Based on these in vitro findings it was assumed that TB lesions must be acidic to allow PZA to be active in vivo (1, 8). In addition, two discrete molecular targets were suggested to be inhibited by the drug. POA was shown to block fatty acid synthesis and fatty acid synthase I (FAS I) was suggested as the target of the drug (9). FAS I as a direct target of POA was however put into question by subsequent works (10). Protein binding studies found a large number of POA-binding partners, one of which was identified to be the 30S ribosomal S1 / RpsA protein. Thus, by targeting RpsA, POA may impair trans-translation, a rescue mechanism that frees ribosomes stuck in translation (11). However, gene sequencing of PZA resistant clinical isolates did not support these biochemical findings (12-14). Multiple investigators failed to isolate POA resistant mutants in vitro on acidic agar, with mutations either in fatty acid



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

synthase I, ribosomal protein RpsA or any other target (9, 15). During the course of this work, Zhang and colleagues identified mutations in the aspartate decarboxylase PanD associated with PZA resistance (16, 17) and proposed this enzyme as a direct target of POA. However, PanD as a target was put into question by Dillon et al. (18). One of the major PZA conundrums is its very modest in vitro potency, contrasting with its excellent in vivo sterilizing activity (3, 8). A second major puzzle is that genetic analyses of PZA resistant clinical isolates do not yield any prominent clustering of PZA associated resistance mutation patterns (other than those in the prodrug activating pyrazinamidase) (19-21). The lack of an obvious resistance epidemiology is in stark contrast to other tuberculosis drugs such as rifampicin which inhibits RNA polymerase or the fluoroquinolones that target DNA gyrase. For those drugs, clinical resistance can be readily associated with mutations in the target enzymes and the same mutations can be isolated in vitro (22). New genotype-based antibiotic resistance predicting software for TB such as Mykrobe Predictor exclude PZA specifically due to poor predictive value (23). The lack of a clear cut molecular resistance epidemiology or transmission pattern in clinical PZA resistant isolates could indicate that emerging resistant mutants may suffer from significant fitness or virulence loss in vivo and therefore cannot be found in sputum isolates (22). Recently, the ‘acid pH’ model for the mechanism of action of PZA was put into question. First it was shown (or ‘re-discovered’ (24)) that PZA and POA also inhibit growth under non-acidic conditions in vitro (5, 25). This was followed by the critical finding that POA does not act as a robust ionophore, i.e. intracellular acidification as a major mechanism of action appears unlikely (25). Finally, old reports from the 1930s (26, 27) were confirmed showing that the necrotic core of TB lesions is not acidic (28-30). Based on these developments, we revisited a genetic approach and successfully selected and isolated POA resistant mutants on near-neutral pH media rather than acidified agar, to dissect 4 ACS Paragon Plus Environment

Page 4 of 35

Page 5 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


the mechanism of action of PZA. Phenotypic and molecular characterization of these mutants suggests that POA resistance can be caused by two different mechanisms: prevention of depletion of an essential cofactor and interference with the synthesis of a cell wall associated virulence factor.

RESULTS Missense mutations in a CoA synthesis gene and loss of function mutations in PDIM synthesis genes cause POA resistance. We previously showed that, in contrast to common belief, PZA and POA exert growth inhibitory activity against M. tuberculosis at near-neutral pH 6.5 (5). Here we tested the hypothesis that employing near-neutral instead of acidic agar – as it has been attempted unsuccessfully in the past – would enable isolation of POA resistant mutants. (Note: recently, during the course of this work Zhang et al. (17) and Lanoix et al. (31) showed the feasibility of this approach, see Discussion). To facilitate this work, we used Mycobacterium bovis BCG as a biosafety level 2 compatible surrogate for M. tuberculosis. M. bovis BCG is naturally pyrazinamidase-negative (PncA-) due to a point mutation (C169G/His57Asp) in the amidase gene pncA and hence, not susceptible to PZA (4). M. bovis BCG exhibits similar susceptibility to POA in vitro under both near-neutral (pH 6.5) and acidic (pH 5.8) conditions with MIC50 values of 0.5-1 mM and 0.25 mM respectively (1 mM POA corresponds to 124 µg/ml).

Pilot experiments to determine broth MICs using standard (pH 6.5) growth media with and without glycerol surprisingly showed that glycerol hyper-sensitizes wild type M. bovis BCG to POA (Supporting Information, Figure S1A). Increasing the glycerol concentration from 0.01 to 0.8% resulted in a reduction of MIC90 of POA from 4 mM to 1 mM (Supporting Information, Figure S1B). This shows that POA susceptibility is influenced by the presence of glycerol, a



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

phenomenon that we and others observed previously with other compound classes during antimycobacterial drug screening (32, 33). Based on the observed glycerol effect, we used agar containing 0.5% glycerol or agar without glycerol, i.e. with glucose as the main carbon source, for resistant mutant selection. Four independent BCG cultures were plated on the two agar types supplemented with 1, 2 or 4 mM POA. POA resistant colonies were observed at spontaneous resistance mutation frequencies of 10-4 to 10-5 /CFU in the presence of glycerol while in the absence of glycerol the frequencies were 10-3 to 10-4/CFU. To confirm resistance, a total of 26 colonies from both screens were re-streaked on agar containing corresponding concentrations of POA. Resistance of the 26 strains was further confirmed by determination of broth MICs via serial dilutions in broth with and without glycerol. The POA resistant strains could be grouped into 4 phenotypic classes, POA1 to POA4, according to their POA resistance levels and the effect of glycerol on resistance (Table 1 for representative strains and Supporting Information, Table S1 for other strains).

To determine the molecular mechanisms of resistance, the 26 strains were subjected to whole genome sequencing. Rather than finding polymorphisms in the proposed POA targets fas1 and rpsA, respectively encoding the fatty acid synthase FAS I and the ribosomal protein S1, we found mutations in the aspartate decarboxylase panD involved in CoA biosynthesis (16, 17), and in the mycocerosic acid synthase mas as well as the phenolpthiocerol synthesis type-I polyketide synthases ppsA-E (Table 1 and Table S1). Both Mas and PpsA-E are involved in synthesis of the cell wall lipid phthiocerol dimycocerosate (PDIM), a virulence factor required for in vivo but not in vitro growth (34, 35). We also found frameshift mutations in the glycerol kinase glpK which catalyzes the first step of glycerol catabolism (36). In contrast to mutations in panD and mas or ppsA-E, mutations in glpK were specific to POA resistant strains isolated on agar containing glycerol and were only observed in combination with mutations in mas or ppsA-E, suggesting that glpK mutations alone may not confer POA resistance. 6 ACS Paragon Plus Environment

Page 6 of 35

Page 7 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Analysis of the whole genome sequencing results revealed that amino acid sequence altering mutations mapped mostly to the C-terminal mycobacterium-specific putative regulatory domain of PanD (16, 17, 37). The PDIM biosynthesis genes mas and ppsA-E showed mostly frameshift and therefore likely loss of function mutations distributed across different domains. glpK mutations were all frameshift loss of function mutations (36). The biochemical reactions catalyzed by the various enzymes and details of the mutations and their localization within the PanD, Mas / PpsA-E and GlpK proteins are summarized in Figure 1.

The 26 POA resistant strains fell into 4 genotypic classes, and the genotypic classes correlated with the 4 observed phenotypic classes (Table 1 and Supporting Information, Table S1): Class POA1 carries panD plus mas or ppsA-E double mutations, conferring high level POA resistance (POAR++) both in the presence and absence of glycerol. Class POA2 harbors panD mutations alone, conferring medium level POA resistance (POAR+) in the presence and absence of glycerol. Class POA3 carries mas or ppsA-E mutations alone, conferring low level resistance (POAR) in media without glycerol. In media with glycerol, class POA3 is hypersensitive to POA (POAS+), similar to the wild type. Class POA4 combines glpK and mas or ppsA-E double mutations conferring low level resistance (POAR) in the absence of glycerol (similar to class POA3) and medium level of resistance (POAR+) in the presence of glycerol (Table 1 and Supporting Information, Table S1).

To simplify subsequent analyses, we selected one representative strain for each mutant class as shown in Table 1: M. bovis BCG POA1 [panD1 mas-1], POA2 [panD2], POA3A [mas-1] and POA3B [ppsA1], and POA4 [glpK1 mas-1] respectively. The POA resistance phenotypes for the 5 representative strains in media without and with glycerol can be seen in Figures 2A and 2B respectively. Glycerol sensitizes all strains to POA irrespective of genotype, but to different 7 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

degrees (Figure 2B). This results in a complete loss of resistance for low resistance class POA3 (mas or ppsA-E) mutants while the low resistance class POA4 mutants, containing an additional glpK mutation, retain their resistance in the presence of glycerol.

Mutant selection and all phenotypic characterizations so far were carried out at neutral pH. As previous POA mutant selection experiments on acidic pH agar had failed to deliver resistant strains (9, 15), we predicted that the representative POA resistant strains would exhibit their resistance at neutral pH but not at acidic pH. The results from broth dilution MICs carried out at pH 5.8 (Figure 2C) show that indeed POA resistance mutations do not confer POA resistance under acidic pH, which is consistent with the inability to isolate POA resistant mutants on acidic pH agar. POA resistant mutations also confer PZA resistance. In our studies, we directly used the bioactive POA for selection of resistant mutants to avoid isolating pncA mutants which constitute the vast majority of PZA resistance in vitro and in vivo (15). To determine whether POA resistance mutations confer resistance to the prodrug PZA, we introduced a functional copy of the pncA gene from M. tuberculosis H37Rv into the 5 representative mutants and wild type M. bovis BCG using an integrative plasmid construct. As expected, introduction of M. tuberculosis pncA into wild type BCG rendered the previously PZA resistant strain PZA susceptible (4) (Figure 2D). In contrast, the 5 representative POA resistant strains remained resistant to PZA after complementation with functional pncA (Figure 2D). Thus, the POA resistance conferring mutations also confer resistance to PZA. As observed previously with POA at acidic pH, the 5 representative strains complemented with functional pncA were susceptible to PZA at acidic pH 5.8 (Figure 2E). To exclude the possibility that the identified POA/PZA resistant genotypes caused unspecific drug resistance, we measured the susceptibility of the 5 representative strains to isoniazid, 8 ACS Paragon Plus Environment

Page 8 of 35

Page 9 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


rifampicin, streptomycin and ciprofloxacin. The 5 POA/PZA resistant strains were fully susceptible to the drugs, showing the same MICs as the wild type strain (data not shown). These results indicate that POA/PZA resistance conferring mutations are drug specific and do not cause general antibiotic resistance.

Mutations affecting PDIM synthesis but not mutations affecting CoA synthesis confer cross resistance to POA analogs. Nicotinic acid and benzoic acid are two structural analogs of POA and both show antimycobacterial activity (7), albeit with a lower potency than POA (Figure 3B). Previous attempts to isolate mutants against these analogs on acidic pH agar were also unsuccessful (7). The genetic data above suggest that resistance to POA may be due to two distinct mechanisms involving either panD or mas / ppsA-E mutations, the latter causing a lower level of resistance. To determine whether the analogs shared any of the two mechanisms of action with POA, cross resistance studies were carried out. Growth of wild type BCG was inhibited by nicotinic and benzoic acid as expected (Figure 3A). POA resistant strains containing mas or ppsA-E mutations were also resistant to the analogs, whereas panD mutations alone (POA2 mutant class) did not confer cross-resistance (Figure 3A). The results indicate that the three carboxylic acids share a PDIM synthesis-related mechanism of action while the CoArelated mechanism of action is unique to POA. It is interesting to note that glycerol in the medium hyper-sensitized M. bovis BCG to inhibition by benzoic acid and more weakly to nicotinic acid (Figure 3B), as was observed for POA.

To confirm the role of mutations in PDIM synthesis genes in POA and nicotinic/benzoic acid resistance, a functional copy of the mas gene, encoding the 2111 amino acid mycocerosic acid synthase, was introduced into the POA resistant strain M. bovis BCG POA3A [mas-1]. Upon complementation with functional mas, BCG POA3A [mas-1] lost its resistance to POA and 9 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 35

reverted to wild type susceptibility (Supplementary Information, Figure S2A). Figure S2B shows that mas complementation in BCG POA3A also restored susceptibility to nicotinic and benzoic acid. POA but not POA analogs deplete CoA, and panD mutations prevent such depletion. What is the metabolic mechanism of the resistance mediated by panD mutations? Based on the nature and the location of missense mutations clustered in the C-terminal domain of PanD, we hypothesized that POA could bind to and inhibit PanD (as suggested by Zhang and colleagues (16, 17)), causing depletion of CoA, the final product of the biosynthetic pathway and essential acyl carrier cofactor. To test our hypothesis, we first measured the effect of POA on the cellular levels of CoA in wild type M. bovis BCG using a fluorometric assay. Growth and CoA concentrations were measured over time in BCG cultures exposed to POA. Growth remained unaffected for one day after addition of POA, indicating that POA is a slow acting drug (Figure 4A). CoA levels dropped significantly between 12-24 hours after POA treatment, suggesting that POA causes growth arrest via depletion of CoA. Figure 4C shows that in contrast to the response of wild type bacteria to POA, treatment of strains containing panD mutations (M. bovis BCG POA1 [panD1 mas-1] and POA2 [panD2]) did not result in depletion of CoA. These results are consistent with inhibition of PanD by POA, causing depletion of CoA and thus growth termination of the bacilli. Mutations in the C-terminal domain of PanD may block POA binding and cause resistance by preventing CoA depletion (17). To demonstrate that POA inhibits the CoA biosynthesis pathway, as opposed to modulating CoA levels through a different mechanism, we measured the levels of the CoA precursor pantothenate located downstream of PanD in the pathway using LC-MS. Pantothenate displayed a CoA-like pattern: POA treatment caused depletion of pantothenate in wild type bacteria, whereas panD mutations prevented the POA-induced collapse of pantothenate levels (Figure 4D).


Page 11 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Our genetic and chemical probing studies suggest that the PDIM related mechanism of action of POA is distinct from its CoA related mechanism of action. Therefore we hypothesized that mas or ppsA-E mutations would not prevent POA-induced CoA depletion. As predicted, strains harboring mas or ppsA-E mutations without panD co-mutations exhibited POA-induced CoA and pantothenate depletion similar to wild type bacteria (Figures 4C and 4D). In addition, the POA analogs did not cause depletion of CoA, consistent with their PDIM-specific mechanism and with the cross-resistance results (Figure 4B). Furthermore, the lack of CoA depletion at growth inhibitory concentrations of nicotinic and benzoic acid implies that the observed CoA depletion is POA specific and not a general phenomenon associated with drug induced growth inhibition.

Exogenous pantothenate causes resistance to POA but not to POA analogs. Under our proposed model, POA inhibits PanD which causes depletion of CoA and therefore growth termination. Hence, we predicted that exogenous addition of the CoA precursor pantothenate would pheno-copy the panD mutations. Figure 5A shows that addition of pantothenate to M. bovis BCG wild type indeed mimicked the BCG POA2 [panD2] resistance phenotype while addition of exogenous pantothenate to BCG POA3A [mas-1] and BCG POA3B [ppsA1] mimicked the resistance phenotype of BCG POA1 [panD1 mas-1] (Figure 5B). Pantothenate prevents POA-mediated CoA depletion in M. bovis BCG wild type as expected (17, 18) (Figure 5C). Finally, consistent with our hypothesis that POA shares a CoA-unrelated, PDIMassociated, mechanism of action and resistance with nicotinic acid and benzoic acid, we observed that addition of pantothenate did not confer resistance to these POA analogs (Figure 5D).

The CoA and PDIM resistance pathways are recapitulated in M. tuberculosis. To confirm that POA resistance conferring mutations in panD and mas or ppsA-E can also be observed in virulent M. tuberculosis upon selection in neutral pH media, we plated M. tuberculosis H37Rv on 11 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 35

POA-containing neutral agar. Whole genome sequencing of 10 confirmed POA resistant strains revealed missense mutations in the C-terminal domain of PanD or frameshift mutations in PDIM synthesis genes, as observed in M. bovis BCG (Table 2). This suggests that the results obtained with M. bovis BCG apply to its virulent cousin. Interestingly, one POA resistant M. tuberculosis strain carried wild type panD and mas / ppsA-E but contained polymorphisms in dlaT, Rna60, Rv0907 and hemZ. In addition, some of the strains containing panD or ppsA-E mutations also contained mutations in genes including Rv3626c, PPE47, mmpL2, Rv1178 and mqo (Table 2). Due to the fact that only single mutants were obtained for these genes, it is not possible to conclude whether they are involved in POA resistance. However, these findings together with the isolation of one POA resistant M. tuberculosis strain with wild type panD and mas/ppsA-E alleles (Table 2) suggests that there might be additional mechanisms of resistance to be uncovered.

DISCUSSION Until recently, it was believed that the tuberculosis prodrug PZA and its bioactive form POA require acidic pH to exert their anti-mycobacterial activity (3, 24) and that the small molecular weight carboxylic acid POA acts as an ionophore (6, 7). In addition, the fatty acid synthase FAS I (9) and the ribosomal protein S1 (11), were proposed as two discrete molecular targets of POA. Attempts to isolate POA resistant mutants of M. tuberculosis on acidified agar to determine its mechanism of action were however unsuccessful (9, 15) until recently (17, 31). Furthermore, it was recently shown or rediscovered that the caseum of tuberculosis lesions is not acidic (26-29), that the drug also works at neutral pH (5, 25), and that POA appears not to act as an ionophore as its major mechanism of action (25). Based on these new findings, we revisited the genetic approach using neutral instead of acidic agar for the selection of resistant


Page 13 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


mutants and successfully isolated POA resistant mutants in both M. bovis BCG and M. tuberculosis H37Rv.

The observed spontaneous resistance mutations frequencies ranged, dependent on the specific selection medium from 10-5 to 10-3 / CFU. This is in the range of – of even higher – than the resistance frequencies for isoniazid (10-6, (38)) and much higher than the frequency reported for rifampicin (10-8, (39)). The similarity between POA and isoniazid may be due to the fact that in both cases mutations in multiple genes can cause resistance and that, in some of the genes, loss of function mutations are allowed (see below). In contrast, rifampicin has only one major target which is essential, i.e. only very few resistance causing polymorphisms are tolerated (27, 39).

Unexpectedly, both FAS I and ribosomal protein S1 were found to be intact from the 26 sequenced genomes of POA resistant M. bovis BCG and the 10 sequenced genomes of POA resistant M. tuberculosis H37Rv. Rather, resistance to POA appears to be caused by (i) missense mutations in the aspartate decarboxylase panD involved in synthesis of the acyl carrier CoA and (ii) loss of function mutations in the polyketide synthases mas and ppsA-E involved in the synthesis of the cell envelope associated virulence factor PDIM. The two mechanisms appear to be additive as strains carrying double mutations in panD and mas or ppsA-E displayed a higher level of resistance. Probing for cross resistance to two structural analogs of POA, nicotinic acid and benzoic acid, showed that the analogs share the PDIM but not the CoA related mechanism of action with POA.

To determine the molecular basis underlying the CoA related mechanism of resistance, we showed that POA - but not nicotinic or benzoic acid - depletes CoA in wild type bacteria. This CoA depletion is prevented by mutations in panD, but not mas or ppsA-E. Exogenous addition 13 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 35

of pantothenate copied the panD phenotypes, conferring resistance to POA but not to nicotinic and benzoic acid, and prevented POA-induced depletion of intracellular CoA. Our finding that POA depletes cellular CoA may explain the reported effect of PZA on fatty acid synthesis. Jacobs and colleagues showed that PZA inhibits synthesis of palmitic acid (40), supporting the hypothesis that the drug inhibits FAS I (9). However, Barry and colleagues provided evidence that this enzyme is not the direct target of the drug (10). This apparent contradiction may be explained by our finding that POA depletes the acyl carrier cofactor essential for fatty acid synthesis: cessation of fatty acid synthesis upon drug exposure may thus be an indirect effect of POA on CoA synthesis.

Our findings that panD missense mutations confer POA resistance, that POA depletes cellular CoA and that POA resistance mutations in panD prevent CoA depletion are consistent with and extends recent reports by Zhang and colleagues made during the course of the current study (16, 17). The authors attributed POA resistance to similar missense mutations in panD. Furthermore they showed that POA inhibits aspartate decarboxylase in vitro (17). Our collective data indicate that PZA/POA act via inhibition of the aspartate decarboxylase PanD in the CoA biosynthetic pathway. This results in depleting the pool of cellular cofactor essential in numerous pathways which use activated acyls, such as fatty acid biosynthesis, and bringing growth to a halt.

In this work, we identified a second mechanism of resistance to PZA/POA involving PDIMs. PDIMs are cell envelope associated polyketides, non-essential in vitro (41, 42). However, PDIM knock-out mutants are attenuated in mouse models of infection (34, 35), indicating that these in vitro dispensable surface molecules are virulence factors required for growth and survival in the host. If not required for in vitro growth, how are they involved in POA-mediated growth inhibition? The finding that all mas and ppsA-E POA resistance conferring mutations were 14 ACS Paragon Plus Environment

Page 15 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


frameshift events, causing loss of function, may provide a clue. It is conceivable that these polyketide synthases produce one or several toxic intermediates in the presence of POA (and nicotinic and benzoic acid). Loss-of-function mutations would then eliminate the generation of these toxic POA products and cause resistance. One may speculate that activated forms of these small carboxylic acids are incorporated into nascent PDIM polyketides in place of the correct acyl groups and thus ‘corrupt’ intracellular PDIM synthesis or transport processes to the outer cell envelope (43). Loss of function mutations in PDIM synthesis genes would then prevent this toxic effect and allow growth in vitro in the presence of the drug and structural analogs.

Interestingly, the newly identified PDIM related mechanism of resistance to PZA may shed light on two major puzzles associated with this old drug: the lack of clear resistance epidemiology patterns in clinical isolates (22) and the disconnect between PZA’s modest in vitro potency compared to its excellent in vivo activity (1, 44-46)

For most TB drugs, a reasonable correlation exists between in vitro and clinical resistance patterns, with the majority of resistance mutations in targets or activating enzymes. For PZA resistant clinical isolates, however, no such pattern has been observed other than a high frequency and diversity of pncA mutations, disabling activation of the PZA prodrug (19-21). Our finding that loss of the PDIM virulence factor causes resistance may partially explain this lack of clinically observed resistance epidemiology. The in vitro isolated loss of function mutations in mas and ppsA-E might occur in patients but the associated virulence cost is too high to sustain growth or survival in lesions and sputum; hence these PZA resistant strains are not detected in clinical samples. Indeed, when we analyzed 1849 genome sequenced M. tuberculosis clinical isolates from the Genome-wide Mycobacterium tuberculosis variation (GMTV) database, we found none containing frameshift mutations in mas or ppsA-E genes (47). We also observed the 15 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 35

same when we looked into sequences of XDR strains from Pakistan that were pncA wildtype and resistant to PZA (48).

Most TB drugs are potent antibacterials in vitro and display similar activity in vivo. In contrast, PZA’s antibacterial activity in vitro is modest at best but the drug accelerates lesion sterilization in vivo. Recently it was suggested that the drug may act on host factors as an explanation for this disconnect (49). However, mouse infection experiments by Grosset and colleagues suggest that host factor interference does not play a significant role in the in vivo action of the drug (50). The authors hypothesized that if PZA has a host-directed activity in addition to its antibacterial activity, this should be detectable in mice infected with PncA-, PZA resistant, organisms. However, no such activity could be detected, pointing to a lack of host-directed activity. To demonstrate that PZA does indeed act as an antibacterial in vivo, the authors tested the efficacy of PZA in immune-deficient mice under the hypothesis that only antibacterial activity should and would be detected. Surprisingly, PZA was inactive in immune-deficient athymic nude mice infected with PncA+ M. tuberculosis, where PZA cannot modulate the (absent) host’s immune system. This very puzzling finding suggests that PZA works neither via its antibacterial activity nor by modulating host factors in vivo. Our finding that PZA may act as an anti-virulence agent by corrupting PDIM synthesis may reconcile these observations. In standard M. tuberculosis infection models in which bacteria are PncA+ and the mouse immune system is intact, PZA exposure reduces virulence of the bacteria and efficacy is observed. Prevention of prodrug activation in PncA- bacilli growing in immune-competent mice prevents interference with PDIM synthesis, resulting in no activity despite an intact immune system. Unmasking prodrug activation by infecting immune-deficient mice with PncA+ bacteria does not restore efficacy despite corruption of PDIM synthesis because there is no immune system to take advantage of it.


Page 17 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Interestingly, we observed that addition of glycerol to standard glucose-based growth media hyper-sensitizes mycobacteria to POA. Consistent with this observation, the low level POA resistance of mas and ppsA-E mutants is only exhibited in glycerol free media; in media containing glycerol these strains are POA susceptible. Also consistent with glycerol-induced POA hypersensitization, strains containing mas or ppsA-E mutations were resistant in the presence of glycerol when they co-harbored loss of function mutations in glycerol kinase glpK, thereby blocking glycerol catabolism. These double mutants were only isolated on medium containing glycerol. Loss-of-function mutations in glpK seem to be insufficient to cause POA resistance on their own since these were not observed in our genetic screen. How glycerol hyper-sensitizes mycobacteria to POA remains an open question. Additionally, previous drug discovery programs and screens have identified compound classes that exerted glyceroldependent activity against M. tuberculosis (32, 33), with ~10% of the hits showing greater potency in glycerol-containing media (33). The observation that the presence of glycerol increases sensitivity of wild type and all mutant strains (albeit to different degrees), and not only to POA but also to the POA analogs nicotinic and benzoic acid (which only interfere with POA’s PDIM but not CoA related mechanism) may indicate that glycerol catabolism creates a ‘vulnerable’ metabolic state of the bacterium in which bacilli show an increased sensitivity to additional metabolic disturbances. Our previous observation that glycerol utilization induces methylglyoxal toxicity supports this notion (32). Whether glycerol’s methylglyoxal effect plays a role in the observed POA hypersensitization remains to be established. Whatever the mechanistic basis for the observed glycerol effect on POA sensitivity may be, our data suggest that the results of clinical drug susceptibility testing are likely influenced by the presence or absence of glycerol, which in addition to other assay variables (51), may contribute to the often unreliable PZA susceptibility data (52).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 35

In conclusion, our genetic and phenotypic analyses, chemical probing with POA analogs, CoA measurements and chemical complementation studies with pantothenate, suggest that PZA/POA has at least two distinct mechanisms of action and resistance. One involves the depletion of CoA and resistance is caused by mutations in panD preventing CoA depletion. These results confirm and extend recent findings suggesting PanD as target for POA/PZA (16, 17). A novel second mechanism involves PDIM synthesis, where resistance is caused by loss of function mutations in the PDIM synthesizing genes mas and ppsA-E. The finding that the drug may interfere with the synthesis of a virulence factor could explain pyrazinamide’s excellent in vivo efficacy when compared to its modest in vitro potency, as well as the lack of clear molecular resistance epidemiology of PZA.

MATERIALS AND METHODS Bacterial strains, culture medium, and chemicals. M. bovis BCG (ATCC 35734) and M. tuberculosis H37Rv (ATCC 27294) strains were maintained in complete Middlebrook 7H9 medium (BD Difco) supplemented with 0.05% (vol / vol) Tween 80 (Sigma), 0.5% (vol / vol) glycerol (Fisher Scientific) and 10% (vol / vol) Middlebrook albumin-dextrose-catalase (BD Difco) at 37⁰C with agitation at 80 rpm. Pyrazinamide, Pyrazinoic acid, Benzoic acid, and Nicotinic acid were purchased from Sigma-Aldrich and were freshly dissolved in 90% DMSO at a concentration of 0.5M and sterilized using 0.2 µm PTFE membrane filters (Acrodisc PALL). Kanamycin and sodium pantothenate were obtained from Sigma-Aldrich, dissolved in deionized water and sterilized using 0.2 µm Minisart High flow syringe filters (Sartorius) prior to adding to specific growth media under aseptic conditions. pH of broth and liquid media after addition of POA/NA/BA was checked using pH paper strips (Merck) and verified to be around 6.5.


Page 19 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Selection of spontaneous resistant mutants, growth and resistance determination. 104 to 106 CFU from mid log phase cultures of M. bovis BCG (M. tuberculosis) were plated on complete 7H10 agar plates or 7H10 without glycerol containing 1, 2 or 4 mM POA respectively, and grown for 4 weeks. Colonies were picked from selection plates and re-streaked on agar containing the same concentration of POA for colony purification and to verify drug resistance. Isolated colonies were picked from the re-streak plates and expanded in 7H9 to an OD600 of 0.70.8 and stored in 25% glycerol in 1ml aliquots at -80⁰c. These frozen stocks were then used for subsequent phenotypic and genetic characterization of mutants. Growth inhibitory activities of compounds against M. bovis BCG were determined as described for M. tuberculosis in (5). The MIC90 and MIC50 reported here are those concentrations of drug that inhibit 90% and 50% of growth respectively as compared to drug-free control after 5 days of incubation. All MICs were performed in technical and biological replicates.

Whole genome sequencing. Genomic DNA was isolated from M. bovis BCG and M. tuberculosis H37Rv, wild type and mutants as described (53). The library construction using NEBNext Ultra DNA library preparation kit (New England Biolabs), whole genome sequencing on the Illumina MiSeq platform and bioinformatics analyses were performed by AIT Biotech, Singapore (Details are described in Supporting information, Supplemental methods).

pncA and mas complementation constructs. To restore pyrazinamidase PncA activity in M. bovis BCG, which has a non-functional endogenous pncA locus, the integrative vector pMV306 was used (54). The M. tuberculosis pncA coding sequence including the putative promoter was PCR amplified using the primers pncA_F 5’ATGACACCTCTGTCACCGGACGGA3’ and pncA_R 5’AAGCTTCAGGAGCTGCAAACCAACTCGA3’ and inserted into pCR2.1TOPO by 19 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 35

TOPO TA cloning (Life Technologies). The insert was subsequently excised using EcoRI and integrated into pMV306. The mas gene of M. bovis BCG including its putative promoter was amplified using PCR with specific primers mas_F 5’TGGTACCGGTCGGATGTGATGTG3’ and mas_R 5’TATCTAGAATTCGACCGCTATGATGCC3’ and inserted into the KpnI / XbaI restriction sites of pMV306.

The integrity of the constructs were confirmed by capillary

sequencing (AIT Biotech, Singapore). The constructs were electroporated into M. bovis BCG strains and selected on Kanamycin (25 µg/ml) containing 7H10 agar plates at 37⁰C. Kanamycin resistant colonies were picked after 3 weeks, expanded with Kanamycin selection and frozen at -80⁰c as glycerol stocks, which were subsequently characterized.

CoA quantification. M. bovis BCG cultures were grown to mid log phase in 1L roller bottles (Corning) at 37⁰C and pelleted in 50ml tubes at 3200 rpm for 10 minutes. Pellets were resuspended in the specific growth medium after adjusting to an OD600 of 0.2 and incubated with or without POA, nicotinic acid or benzoic acid. At each time point for each treatment, the samples were plated on 7H10 to determine CFU, and an equivalent of 2 x 109 CFU was pelleted by centrifugation. The pellet was resuspended in 500 µl Phosphate buffer saline (PBS) and homogenized by bead beating (Precellys 24 homogenizer) at 6500 rpm 3 times 30s each. The lysate was pelleted by centrifugation and the supernatant was subsequently used for analysis by a CoA assay kit (Sigma-Aldrich MAK034) as per manufacturer’s instructions. Fluorescence intensity was read on a Tecan Infinite M200 plate reader (λex=535nm/ λem=587nm) and CoA concentration was determined in nmol from a standard curve which was obtained for each experiment. These experiments were performed in technical replicates of independent biological replicates and normalized per CFU. The lysate supernatant was also used for mass spectrometric quantification of CoA and pantothenate which was achieved by using liquid chromatography coupled to mass 20 ACS Paragon Plus Environment

Page 21 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


spectrometry (LC-MS) methods (Details are described in Supporting Information, Supplemental methods). SUPPORTING INFORMATION Supplemental methods, phenotypic and genotypic classes of POA resistant M. bovis BCG with details for additional 21 whole genome sequenced strains, glycerol effect on POA susceptibility, Mas complementation. This information is available free of charge via Internet at http://pubs.acs.org/. ABBREVIATIONS TB: Tuberculosis, PZA: pyrazinamide, POA: pyrazinoic acid, NA: nicotinic acid, BA: benzoic acid, CoA: Coenzyme A, PDIM: phthiocerol dimycocerosate AUTHOR INFORMATION Address correspondence to Thomas Dick, [email protected] National University of Singapore, 5 Science Drive 2, Singapore 117545, Republic of Singapore Phone / Fax: (65) 6516 6741 / (65) 6776 6872

Author contribution PG and TD conceived the project, designed the strategy and wrote the manuscript. PG, MY, JS, JLL and MG carried out experiments and analyses. JPS, FK and VD carried out the mass spectrometric analyses.

Conflict of interest The authors declare having no competing interests or other interests that might be perceived to influence the results and discussion reported in this paper.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 35

ACKNOWLEDGEMENTS This work was supported by the Singapore Ministry of Health’s National Medical Research Council under its Translational Clinical Research Flagship Grant (NMRC/TCR/011-NUHS/2014) and its Centre grant MINE / Research core no. 4 (NMRC/CG/013/2013) to TD, and is part of the Singapore Programme of Research Investigating New Approaches to Treatment of Tuberculosis (SPRINT-TB; www.sprinttb.org), managed by Kristina Rutkute and led by Nick Paton. PG receives a research scholarship from Yong Loo Lin School of Medicine. We would like to thank Sabai Phyu, the School of Medicine BSL3 core facility for support; David Klinzing, AITBiotech for whole genome sequencing and genomics discussions, Claudia Setzer for help with the initial BCG mutant screen, Joe Liu for help with plasmid construction, and Hayden Yeo for lab management and BSL-3 support.

REFERENCES

1. 2.

3. 4.

5.

Mitchison, D. A. (1985) The action of antituberculosis drugs in short-course chemotherapy. Tubercle 66, 219-225. DOI: 10.1016/0041-3879(85)90040-6. Zumla, A. I., Gillespie, S. H., Hoelscher, M., Philips, P. P. J., Cole, S. T., Abubakar, I., McHugh, T. D., Schito, M., Maeurer, M., and Nunn, A. J. (2014) New antituberculosis drugs, regimens, and adjunct therapies: needs, advances, and future prospects. Lancet Infect Dis 14, 327-340. DOI: 10.1016/S1473-3099(13)70328-1. Zhang, Y., Shi, W., Zhang, W., and Mitchison, D. (2014) Mechanisms of Pyrazinamide Action and Resistance. Microbiol Spectr 2, 1-12. DOI:10.1128/microbiolspec.MGM2-0023-2013. Scorpio, A., and Zhang, Y. (1996) Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus. Nat Med 2, 662-667. DOI:10.1038/nm0696-662. Via, L. E., Savic, R., Weiner, D. M., Zimmerman, M. D., Prideaux, B., Irwin, S. M., Lyon, E., O’Brien, P., Gopal, P., Eum, S., Lee, M., Lanoix, J.-P., Dutta, N. K., Shim, T., Cho, J. S., Kim, W., Karakousis, P. C., Lenaerts, A., Nuermberger, E., Barry, C. E., and Dartois, V. (2015) Host-Mediated Bioactivation of Pyrazinamide: Implications for Efficacy, Resistance, and Therapeutic Alternatives. ACS Infect Dis 1, 203-214. DOI: 10.1021/id500028m.


Page 23 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


6.

7. 8. 9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

Zhang, Y., Scorpio, A., Nikaido, H., and Sun, Z. (1999) Role of Acid pH and Deficient Efflux of Pyrazinoic Acid in Unique Susceptibility of Mycobacterium tuberculosis to Pyrazinamide. J Bacteriol 181, 2044-2049. Zhang, Y., Zhang, H., and Sun, Z. (2003) Susceptibility of Mycobacterium tuberculosis to weak acids. J Antimicrob Chemother 52, 56-60. DOI: 10.1093/jac/dkg287. Zhang, Y., and Mitchison, D. (2003) The curious characteristics of pyrazinamide: a review. Int J Tuberc Lung Dis 7, 6-21. Zimhony, O., Cox, J. S., Welch, J. T., Vilcheze, C., and Jacobs, W. R. (2000) Pyrazinamide inhibits the eukaryotic-like fatty acid synthetase I (FASI) of Mycobacterium tuberculosis. Nat Med 6, 1043-1047. DOI: 10.1038/79558. Boshoff, H. I., Mizrahi, V., and Barry, C. E. (2002) Effects of Pyrazinamide on Fatty Acid Synthesis by Whole Mycobacterial Cells and Purified Fatty Acid Synthase I. J Bacteriol 184, 2167-2172. DOI: 10.1128/jb.184.8.2167-2172.2002. Shi, W., Zhang, X., Jiang, X., Yuan, H., Lee, J. S., Barry, C. E., Wang, H., Zhang, W., and Zhang, Y. (2011) Pyrazinamide Inhibits Trans-Translation in Mycobacterium tuberculosis. Science 333, 1630-1632. DOI: 10.1126/science.1208813. Alexander, D. C., Ma, J. H., Guthrie, J. L., Blair, J., Chedore, P., and Jamieson, F. B. (2012) Gene Sequencing for Routine Verification of Pyrazinamide Resistance in Mycobacterium tuberculosis: a Role for pncA but Not rpsA. J Clin Microbiol 50, 3726-3728. DOI: 10.1128/JCM.00620-12. Xia, Q., Zhao, L.-l., Li, F., Fan, Y.-m., Chen, Y.-y., Wu, B.-b., Liu, Z.-w., Pan, A.-z., and Zhu, M. (2015) Phenotypic and Genotypic Characterization of Pyrazinamide Resistance among Multidrug-resistant Tuberculosis isolates in Zhejiang, China. Antimicrob Agents Chemother 59, 1690-1695. DOI: 10.1128/aac.04541-14. Akhmetova, A., Kozhamkulov, U., Bismilda, V., Chingissova, L., Abildaev, T., Dymova, M., Filipenko, M., and Ramanculov, E. (2015) Mutations in the pncA and rpsA genes among 77 Mycobacterium tuberculosis isolates in Kazakhstan. Int J Tuberc Lung Dis 19, 179-184. DOI: 10.5588/ijtld.14.0305. Scorpio, A., Lindholm-Levy, P., Heifets, L., Gilman, R., Siddiqi, S., Cynamon, M., and Zhang, Y. (1997) Characterization of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis. Antimicrob Agents Chemother 41, 540-543. Zhang, S., Chen, J., Shi, W., Liu, W., Zhang, W., and Zhang, Y. (2013) Mutations in panD encoding aspartate decarboxylase are associated with pyrazinamide resistance in Mycobacterium tuberculosis. Emerg Microbes Infect 2, e34. DOI: 10.1038/emi.2013.38. Shi, W., Chen, J., Feng, J., Cui, P., Zhang, S., Weng, X., Zhang, W., and Zhang, Y. (2014) Aspartate decarboxylase (PanD) as a new target of pyrazinamide in Mycobacterium tuberculosis. Emerg Microbes Infect 3, e58. DOI: 10.1038/emi.2014.61. Dillon, N. A., Peterson, N. D., Rosen, B. C., and Baughn, A. D. (2014) Pantothenate and Pantetheine Antagonize the Antitubercular Activity of Pyrazinamide. Antimicrob Agents Chemother 58, 7258-7263. DOI: 10.1128/aac.04028-14. Stoffels, K., Mathys, V., Fauville-Dufaux, M., Wintjens, R., and Bifani, P. (2012) Systematic Analysis of Pyrazinamide-Resistant Spontaneous Mutants and Clinical Isolates of Mycobacterium tuberculosis. Antimicrob Agents Chemother 56, 5186-5193. DOI: 10.1128/AAC.05385-11. Casali, N., Nikolayevskyy, V., Balabanova, Y., Harris, S. R., Ignatyeva, O., Kontsevaya, I., Corander, J., Bryant, J., Parkhill, J., Nejentsev, S., Horstmann, R. D., Brown, T., and Drobniewski, F. (2014) Evolution and transmission of drug-resistant tuberculosis in a Russian population. Nat Genet 46, 279-286. DOI: 10.1038/ng.2878. Miotto, P., Cabibbe, A. M., Feuerriegel, S., Casali, N., Drobniewski, F., Rodionova, Y., Bakonyte, D., Stakenas, P., Pimkina, E., Augustynowicz-Kopeć, E., Degano, M., Ambrosi, A., Hoffner, S., 23 ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

22. 23.

24. 25.

26. 27. 28.

29.

30.

31.

32.

33.

Mansjö, M., Werngren, J., Rüsch-Gerdes, S., Niemann, S., and Cirillo, D. M. (2014) Mycobacterium tuberculosis Pyrazinamide Resistance Determinants: a Multicenter Study. mBio 5, e01819-01814. DOI: 10.1128/mBio.01819-14. den Hertog, A. L., Sengstake, S., and Anthony, R. M. (2015) Pyrazinamide resistance in Mycobacterium tuberculosis fails to bite? Pathog Dis 73. DOI: 10.1093/femspd/ftv037. Bradley, P., Gordon, N. C., Walker, T. M., Dunn, L., Heys, S., Huang, B., Earle, S., Pankhurst, L. J., Anson, L., de Cesare, M., Piazza, P., Votintseva, A. A., Golubchik, T., Wilson, D. J., Wyllie, D. H., Diel, R., Niemann, S., Feuerriegel, S., Kohl, T. A., Ismail, N., Omar, S. V., Smith, E. G., Buck, D., McVean, G., Walker, A. S., Peto, T. E. A., Crook, D. W., and Iqbal, Z. (2015) Rapid antibioticresistance predictions from genome sequence data for Staphylococcus aureus and Mycobacterium tuberculosis. Nat Commun 6, 10063. DOI: 10.1038/ncomms10063. McDermott, W., and Tomsett, R. (1954) Activation of pyrazinamide and nicotinamide in acidic environments in vitro. Am Rev Tuberc 70, 748-754. Peterson, N. D., Rosen, B. C., Dillon, N. A., and Baughn, A. D. (2015) Uncoupling Environmental pH and Intrabacterial Acidification from Pyrazinamide Susceptibility in Mycobacterium tuberculosis. Antimicrob Agents Chemother 59, 7320-7326. DOI: 10.1128/aac.00967-15. Koller, F., and Leuthardt, F. (1934) NEKROSE UND AUTOLYSE.BEITRAG ZUR KENNTNIS DER DYSTROPHISCHEN VERKALKUNG. Klinische Wochenschrift 13, 1527-1529. Gopal, P., and Dick, T. (2014) Reactive dirty fragments: implications for tuberculosis drug discovery. Curr Opin Microbiol 21, 7-12. DOI: 10.1016/j.mib.2014.06.015. Lanoix, J.-P., Ioerger, T., Ormond, A., Kaya, F., Sacchettini, J., Dartois, V., and Nuermberger, E. (2016) Selective Inactivity of Pyrazinamide against Tuberculosis in C3HeB/FeJ Mice Is Best Explained by Neutral pH of Caseum. Antimicrob Agents Chemother 60, 735-743. DOI: 10.1128/aac.01370-15. Lenaerts, A., Barry, C. E., and Dartois, V. (2015) Heterogeneity in tuberculosis pathology, microenvironments and therapeutic responses. Immunol Rev 264, 288-307. DOI: 10.1111/imr.12252. Irwin, S. M., Prideaux, B., Lyon, E. R., Zimmerman, M. D., Brooks, E. J., Schrupp, C. A., Chen, C., Reichlen, M. J., Asay, B. C., Voskuil, M. I., Nuermberger, E. L., Andries, K., Lyons, M. A., Dartois, V., and Lenaerts, A. J. (2016) Bedaquiline and Pyrazinamide Treatment Responses Are Affected by Pulmonary Lesion Heterogeneity in Mycobacterium tuberculosis Infected C3HeB/FeJ Mice. ACS Infect Dis 2, 251-267. DOI: 10.1021/acsinfecdis.5b00127. Lanoix, J.-P., Tasneen, R., O'Brien, P., Sarathy, J., Safi, H., Pinn, M., Alland, D., Dartois, V., and Nuermberger, E. (2016) High systemic exposure of pyrazinoic acid has limited anti-tuberculosis activity in murine and rabbit models of tuberculosis. Antimicrob Agents Chemother. DOI: 10.1128/aac.03085-15. Pethe, K., Sequeira, P. C., Agarwalla, S., Rhee, K., Kuhen, K., Phong, W. Y., Patel, V., Beer, D., Walker, J. R., Duraiswamy, J., Jiricek, J., Keller, T. H., Chatterjee, A., Tan, M. P., Ujjini, M., Rao, S. P. S., Camacho, L., Bifani, P., Mak, P. A., Ma, I., Barnes, S. W., Chen, Z., Plouffe, D., Thayalan, P., Ng, S. H., Au, M., Lee, B. H., Tan, B. H., Ravindran, S., Nanjundappa, M., Lin, X., Goh, A., Lakshminarayana, S. B., Shoen, C., Cynamon, M., Kreiswirth, B., Dartois, V., Peters, E. C., Glynne, R., Brenner, S., and Dick, T. (2010) A chemical genetic screen in Mycobacterium tuberculosis identifies carbon-source-dependent growth inhibitors devoid of in vivo efficacy. Nat Commun 1, 1-8. DOI: 10.1038/ncomms1060. Stanley, S. A., Grant, S. S., Kawate, T., Iwase, N., Shimizu, M., Wivagg, C., Silvis, M., Kazyanskaya, E., Aquadro, J., Golas, A., Fitzgerald, M., Dai, H., Zhang, L., and Hung, D. T. (2012) Identification of Novel Inhibitors of M. tuberculosis Growth Using Whole Cell Based High-Throughput Screening. ACS Chem Biol 7, 1377-1384. DOI: 10.1021/cb300151m. 24 ACS Paragon Plus Environment

Page 24 of 35

Page 25 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


34. 35.

36.

37.

38. 39.

40.

41.

42.

43.

44. 45. 46. 47.

48.

Cox, J. S., Chen, B., McNeil, M., and Jacobs, W. R. (1999) Complex lipid determines tissue-specific replication of Mycobacterium tuberculosis in mice. Nature 402, 79-83. DOI: 10.1038/47042. Camacho, L. R., Ensergueix, D., Perez, E., Gicquel, B., and Guilhot, C. (1999) Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis. Mol Microbiol 34, 257-267. DOI: 10.1046/j.1365-2958.1999.01593.x. Keating, L. A., Wheeler, P. R., Mansoor, H., Inwald, J. K., Dale, J., Hewinson, R. G., and Gordon, S. V. (2005) The pyruvate requirement of some members of the Mycobacterium tuberculosis complex is due to an inactive pyruvate kinase: implications for in vivo growth. Mol Microbiol 56, 163-174. DOI: 10.1111/j.1365-2958.2005.04524.x. Gopalan, G., Chopra, S., Ranganathan, A., and Swaminathan, K. (2006) Crystal structure of uncleaved L-aspartate-α-decarboxylase from Mycobacterium tuberculosis. Proteins 65, 796-802. DOI: 10.1002/prot.21126. Pansy, F., Stander, H., and Donovick, R. (1952) In vitro studies on isonicotinic acid hydrazide. Am Rev Tuberc 65, 761-764. Mariam, D. H., Mengistu, Y., Hoffner, S. E., and Andersson, D. I. (2004) Effect of rpoB Mutations Conferring Rifampin Resistance on Fitness of Mycobacterium tuberculosis. Antimicrob Agents Chemother 48, 1289-1294. DOI: 10.1128/AAC.48.4.1289-1294.2004. Zimhony, O., Vilchèze, C., Arai, M., Welch, J. T., and Jacobs, W. R. (2007) Pyrazinoic Acid and Its n-Propyl Ester Inhibit Fatty Acid Synthase Type I in Replicating Tubercle Bacilli. Antimicrob Agents Chemother 51, 752-754. DOI: 10.1128/AAC.01369-06. Azad, A. K., Sirakova, T. D., Rogers, L. M., and Kolattukudy, P. E. (1996) Targeted replacement of the mycocerosic acid synthase gene in Mycobacterium bovis BCG produces a mutant that lacks mycosides. Proc Natl Acad Sci U S A 93, 4787-4792. DOI: 10.1073/pnas.93.10.4787. Azad, A. K., Sirakova, T. D., Fernandes, N. D., and Kolattukudy, P. E. (1997) Gene Knockout Reveals a Novel Gene Cluster for the Synthesis of a Class of Cell Wall Lipids Unique to Pathogenic Mycobacteria. J Biol Chem 272, 16741-16745. DOI: 10.1074/jbc.272.27.16741. Camacho, L. R., Constant, P., Raynaud, C., Lanéelle, M.-A., Triccas, J. A., Gicquel, B., Daffé, M., and Guilhot, C. (2001) Analysis of the Phthiocerol Dimycocerosate Locus ofMycobacterium tuberculosis : EVIDENCE THAT THIS LIPID IS INVOLVED IN THE CELL WALL PERMEABILITY BARRIER. J Biol Chem 276, 19845-19854. DOI: 10.1074/jbc.M100662200. Tarshis, M. S., and Weed, W. A. J. (1953) Lack of significant in vitro sensitivity of Mycobacterium tuberculosis to pyrazinamide on three different solid media. Am Rev Tuberc 67, 391-395. Yeager, R. L., Munroe, W. G., and Dessau, F. I. (1952) Pyrazinamide (aldinamide) in the treatment of pulmonary tuberculosis. Am Rev Tuberc 65, 523-546. Malone, L., Schurr, A., Lindh, H., McKenzie, D., Kiser, J. S., and Williams, J. H. (1952) The effect of pyrazinamide (aldinamide) on experimental tuberculosis in mice. Am Rev Tuberc 65, 511-518. Chernyaeva, E. N., Shulgina, M. V., Rotkevich, M. S., Dobrynin, P. V., Simonov, S. A., Shitikov, E. A., Ischenko, D. S., Karpova, I. Y., Kostryukova, E. S., Ilina, E. N., Govorun, V. M., Zhuravlev, V. Y., Manicheva, O. A., Yablonsky, P. K., Isaeva, Y. D., Nosova, E. Y., Mokrousov, I. V., Vyazovaya, A. A., Narvskaya, O. V., Lapidus, A. L., and O’Brien, S. J. (2014) Genome-wide Mycobacterium tuberculosis variation (GMTV) database: a new tool for integrating sequence variations and epidemiology. BMC Genomics 15, 1-8. DOI: 10.1186/1471-2164-15-308. Ali, A., Hasan, Z., McNerney, R., Mallard, K., Hill-Cawthorne, G., Coll, F., Nair, M., Pain, A., Clark, T. G., and Hasan, R. (2015) Whole Genome Sequencing Based Characterization of Extensively Drug-Resistant Mycobacterium tuberculosis Isolates from Pakistan. PLoS ONE 10, e0117771. DOI: 10.1371/journal.pone.0117771.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

49.

50.

51.

52.

53.

54.

Manca, C., Koo, M.-S., Peixoto, B., Fallows, D., Kaplan, G., and Subbian, S. (2013) Host Targeted Activity of Pyrazinamide in Mycobacterium tuberculosis Infection. PLoS ONE 8, e74082. DOI: 10.1371/journal.pone.0074082. Almeida, D. V., Tyagi, S., Li, S., Wallengren, K., Pym, A. S., Ammerman, N. C., Bishai, W. R., and Grosset, J. H. (2014) Revisiting Anti-tuberculosis Activity of Pyrazinamide in Mice. Mycobac Dis 4, 145. DOI: 10.4172/2161-1068.1000145. Zhang, Y., Permar, S., and Sun, Z. (2002) Conditions that may affect the results of susceptibility testing of Mycobacterium tuberculosis to pyrazinamide. J Med Microbiol 51, 42-49. DOI:10.1099/0022-1317-51-1-42. Cui, Z., Wang, J., Lu, J., Huang, X., Zheng, R., and Hu, Z. (2013) Evaluation of Methods for Testing the Susceptibility of Clinical Mycobacterium tuberculosis Isolates to Pyrazinamide. J Clin Microbiol 51, 1374-1380. DOI: 10.1128/jcm.03197-12. Käser, M., Ruf, M.-T., Hauser, J., Marsollier, L., and Pluschke, G. (2009) Optimized Method for Preparation of DNA from Pathogenic and Environmental Mycobacteria. Appl Environ Microbiol 75, 414-418. DOI: 10.1128/aem.01358-08. Stover, C. K., de la Cruz, V. F., Fuerst, T. R., Burlein, J. E., Benson, L. A., Bennett, L. T., Bansal, G. P., Young, J. F., Lee, M. H., Hatfull, G. F., Snapper, S. B., Barletta, R. G., Jacobs, W. R., and Bloom, B. R. (1991) New use of BCG for recombinant vaccines. Nature 351, 456-460. DOI: 10.1038/351456a0.


Page 26 of 35

Page 27 of 35

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48


Table 1. Phenotypic and genotypic classes of POA resistant M. bovis BCG with details for 5 representative strains.

Phenotypic class

POA resistance in 7H9 broth without glycerol pH 6.5a

POA resistance in 7H9 broth with glycerol pH 6.5a

Genotypic class

Mutation types

Representative M. bovis BCG strain

Mutations in representative strain

POAS

POAS+

MIC50= 1

MIC50= 4

MIC50= >4

mas or ppsA-E

POAR+

POAR+

MIC50= 4

MIC50= 2-4

POAR

POAS+

wt

POA1

POA2

POA3c

POA4c

MIC50= 2

MIC50=

Pyrazinamide Resistance Is Caused by Two ... - ACS Publications

Recommend Documents