Quadruple-Analyte Chemiluminometric Hybridization Assay

Nov 13, 2007 - Ioannis A. Trantakis , Theodore K. Christopoulos , Stelios Spaniolas , Panagiotis Kalaitzis , Penelope C. Ioannou , and Gregory A. Tuck...
3 downloads 0 Views 258KB Size
Download PDF
Anal. Chem. 2007, 79, 9433-9440

Quadruple-Analyte Chemiluminometric Hybridization Assay. Application to Double Quantitative Competitive Polymerase Chain Reaction Dimitrios S. Elenis,† Penelope C. Ioannou,*,† and Theodore K. Christopoulos‡,§

Laboratory of Analytical Chemistry, Department of Chemistry, University of Athens, Athens, Greece 15771, Department of Chemistry, University of Patras, Patras, Greece 26500, and Foundation for Research and Technology Hellas, Institute of Chemical Engineering and High Temperature Chemical Processes (FORTH/ICEHT), P.O. Box 1414, Patras, Greece 26504

We developed a highly sensitive quadruple-analyte chemiluminometric hybridization assay for simultaneous quantification of four nucleic acid sequences. The targets are amplified by the polymerase chain reaction (PCR) and captured to microtiter wells coated with streptavidin. The immobilized fragments are hybridized with specific probes containing a sequence complementary to the target and a sequence or a hapten that allows linkage with a chemiluminescent reporter. We prepared a mixture of four reporters conjugated to complementary oligonucleotides or antihapten antibodies. The reporters were aequorin(dT)30, galactosidase-oligonucleotide, horseradish peroxidase-antifluorescein, and alkaline phosphataseantidigoxigenin conjugates. The four chemiluminescent reactions were triggered sequentially. The signals were linearly related to the concentration of target sequences. The entire quadruple-analyte bioluminometric hybridization assay is complete in 75 min. We have demonstrated the applicability of the proposed assay to high-throughput quantitative competitive PCR of two target sequences in the presence of the corresponding competitors. The assay is universal since the same reporter conjugates can be used for multianalyte quantification of any sequences with properly designed probes. The high affinity and specificity of the interaction between complementary nucleic acid sequences is the basis of hybridization assay, a fundamental technique used widely for detection/ quantification of specific DNA and RNA sequences. Major areas of application of hybridization assay include the analysis of mutations associated with genetic disease, analysis of genetically modified organisms (GMO), and the detection/determination of various pathogens in clinical, environmental, and food samples.1 In recent years, hybridization assays have undergone a transition from radioactive labels to nonradioactive alternatives in order to * Corresponding author. Phone: (+30) 210 7274574. Fax: (+30) 210 7274750. E-mail: [email protected]. † University of Athens. ‡ University of Patras. § Institute of Chemical Engineering and High Temperature Chemical Processes. 10.1021/ac7018848 CCC: $37.00 Published on Web 11/13/2007

© 2007 American Chemical Society

improve sensitivity and facilitate automation while avoiding the health hazards and inconvenience associated with the use and disposal of radioisotopes.2 Chemi(bio)luminometric methods have found many applications in DNA/RNA analysis because of their higher detectability, wider dynamic range, and simpler instrumentation than spectrophotometric and fluorometric ones.3 These distinct advantages arise from the fact that, contrary to methods requiring excitation light, in chemiluminescence the emission is generated by a chemical reaction in the dark, thereby giving a much lower background. However, despite all these unique advantages and the plethora of applications, most current chemiluminometric hybridization assays are able to detect a single target DNA or RNA sequence only.4 The challenge, currently, lies on the development of multianalyte hybridization assays for simultaneous quantification of several target sequences in the same sample. Advantages of multianalyte assays include higher sample through(1) (a) Ratcliff, R. M.; Chang, G.; Kok, T.; Sloots, T. P. Curr. Issues Mol. Biol. 2007, 9, 87-102. (b) Rose, M. G.; Degar, B. A.; Berliner, N. Clin. Adv. Hematol. Oncol. 2004, 2, 650-660. (c) Ahmed, F. E. Trends Biotechnol. 2002, 20, 215-223. (d) Sanvik, A. K.; Alsberg, B. K.; Norsett, K. G.; Yadetie, F.; Waldum, H. L.; Laegreid, A. Clin. Chim. Acta 2005, 363, 157-164. (e) Jung, R.; Soondrum, K.; Neumaier, M. Clin. Chem. Lab. Med. 2000, 38, 833-836. (2) (a) Christopoulos, T. K. Anal. Chem. 1999, 71, 425R-438R. (b) Kricka, L. J. Nonisotopic Probing, Blotting and Sequencing, 2nd ed.; Academic Press, San Diego, CA, 1995. (3) (a) Christopoulos, T. K.; Ioannou, P. C.; Verhaegen, M. Photoproteins in Nucleic Acids Analysis. In Photoproteins in Bioanalysis; Daunert, S., Deo, S. K., Eds.; Wiley: Weinheim, Germany, 2006. (b) Roda, A.; Guardigli, M.; Mirasoli, M.; Pasini, P. Luminescent Proteins in Binding Assays. In Photoproteins in Bioanalysis; Daunert, S., Deo, S. K., Eds.; Wiley: Weinheim, Germany, 2006. (4) (a) Verhaegen, M.; Christopoulos, T. K. Anal. Chem. 2002, 74, 4378-4385. (b) Laios, E.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2001, 73, 689-692. (c) Galvan, B.; Christopoulos, T. K. Anal. Chem. 1996, 68, 35453550. (d) Glynou, K.; Kastanis, P.; Boukouvala, S.; Tsaoussis, V.; Ioannou, P.; Christopoulos, T. K.; Traeger, J.; Kanavakis, E. Clin. Chem. 2007, 53, 384-391. (e) Zerefos, P. G.; Ioannou, P. C.; Traeger-Synodinos, J.; Dimissianos, G.; Kanavakis, E.; Christopoulos, T. K. Hum. Mutat. 2006, 27, 279285. (f) Emmanouilidou, E.; Ioannou, P. C.; Christopoulos, T. K. Anal. Bioanal. Chem. 2004, 380, 90-97. (g) Glynou, K.; Ioannou, P. C.; Christopoulos, T. K. Anal. Bioanal. Chem. 2004, 378, 1748-1753. (h) Zhu, D.; Xing, D.; Shen, X.; Liu, J.; Chen, Q. Biosens. Bioelectron. 2004, 20, 448453. (i) Verhaegen, M.; Christopoulos, T. K. Anal. Biochem. 2002, 306, 314-322. (j) Emmanouilidou, E.; Ioannou, P. C.; Christopoulos, T. K.; Polizois, K. Anal. Biochem. 2003, 313, 97-105.

Analytical Chemistry, Vol. 79, No. 24, December 15, 2007 9433

put, reduced consumption of reagents, smaller sample volume, and lower cost of analysis compared to single-analyte assays. In principle, multianalyte configurations require either the successful combination of several labels in a single assay or the use of a single reporter along with spatial separation of the assays. A few reports describe dual-analyte hybridization assays with applications to quantification of polymerase chain reaction (PCR) products5 and genotyping of single-nucleotide polymorphisms.6 These assays are based on the combination of two chemiluminescent labels. Spatial separation along with a single label was employed in a multianalyte hybridization assay for detection of various pathogens by constructing microtiter plates containing main wells with built-in subwells, each subwell corresponding to a single assay.7 In the present work, we report a highly sensitive quadrupleanalyte chemiluminometric assay for simultaneous quantification of four target sequences in a single microtiter well. As a model, the assay was applied to double quantitative competitive PCR.8 In quantitative PCR (QPCR), the goal is to relate the signal obtained from the amplified DNA to the initial number of copies of the target nucleic acid sequence in the sample. The challenge is to compensate for sample-to-sample variation of the amplification efficiency due to the presence of inhibitors and the variability in reaction conditions. This is achieved by coamplification of the target sequence with a synthetic DNA or RNA competitor that has equal size and shares the same primers.9 It should be noted that in most cases quantification must involve two sequences, i.e., the sequence of interest as well as a reference sequence to compensate for differences in the total amount and integrity of DNA or RNA between samples. This, in turn, requires the determination of four amplification products obtained from two targets and two competitors.10 Moreover, the assays of amplified products should be highly sensitive because during PCR the competitor causes suppression of the target to undetectable levels.11 The proposed method allows simultaneous determination of the four amplification products in a single well with high sensitivity. EXPERIMENTAL SECTION Instrumentation. PCR reactions were carried out in an MJ Research PTC-0150 thermal cycler (Watertown, MA). The digital camera Kodak DC 120 and the gel analyzer software for DNA documentation were purchased from Kodak (New York, NY). Hybridization assays were performed in microtiter wells using the (5) (a) Verhaegen, M.; Christopoulos, T. K. Anal. Chem. 1998, 70, 4120-4125. (b) Laios, E.; Obeid, P.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2000, 72, 4022-4028. (6) (a) Konstantou, J.; Ioannou, P. C.; Christopoulos, T. K. Anal. Bioanal. Chem. 2007, 388, 1747-1754. (b) Tannous, B. A.; Verhaegen, M.; Christopoulos, T. K.; Kourakli, A. Anal. Biochem. 2003, 320, 266-272. (7) Roda, A.; Mirasoli, M.; Venturoli, S.; Cricca, M.; Bonvicini, F.; Baraldini, F.; Pasini, P.; Zerbini, M.; Musiani, M. Clin. Chem. 2002, 48, 1654-1660. (8) Mullis, K. B.; Faloona, F. A. Methods Enzymol. 1987, 155, 335-350. (9) (a) Gilliland, G.; Perrin, S.; Blanchard, K.; Bunn, H. F. Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 2725-2729. (b) Christopoulos, T. K. Polymerase Chain Reaction and Other Amplification Systems. In Encyclopedia of Analytical Chemistry; Meyers, R. A., Ed.; Wiley: Chichester, U.K., 2000; pp 51595173. (10) Mavropoulou, A. K.; Koraki, T.; Ioannou, P. C.; Christopoulos, T. K. Anal. Chem. 2005, 77, 4785-4791. (11) (a) Nurmi, J.; Wikman, T.; Karp, M.; Lovgren, T. Anal. Chem. 2002, 74, 3525-3532. (b) Nurmi, J.; Lilja, H.; Ylikoski, A. Luminescence 2000, 15, 381-388.

9434

Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

Titramax 1000 shaker/incubator from Heidolph (Kehlheim, Germany). The microtiter plate washer model WellWash 4 was from Labsystems (Milford, MA). The microcentrifuge Mikro-20 was from Hettich (Tuttlingen, Germany). Chemiluminescence was measured using the PhL microplate luminometer from Mediators (Vienna, Austria). Materials. GoTaq DNA polymerase was from Promega (Lyon, France). DNA molecular weight markers and terminal deoxynucleotidyl transferase were from MBI Fermentas (Vilnius, Lithuania). Bis(sulfosuccinimidyl)suberate (BS3) and succinimidyl 4-(N-maleimidomethyl)cyclohexane-1 carboxylate (sulfo-SMCC) were purchased from Pierce (Rockford, IL). Escherichia coli β-galactosidase, streptavidin, antidigoxigenin (Fab fragments)alkaline phosphatase conjugate (anti-Dig-ALP), digoxigenin-11dUTP (D-dUTP), and fluorescein-12-dUTP (F-dUTP) were from Roche (Mannheim, Germany). Galacton-Star chemiluminogenic 1,2-dioxetane substrate was purchased from Applied Biosystems (Bedford, MA). Lumiphos was purchased from Aureon Biosystems (Vienna, Austria). Antifluorescein-horseradish peroxidase conjugate (anti-FL-HRP) was from Biodesign International, and the chemiluminogenic HRP substrate was obtained from BioFX Laboratories (Owings Mills, MD). Bovine serum albumin (BSA) was purchased from Serva (Heidelberg, Germany). Ultrapure 2-deoxyribonucleotide 5-triphosphates (dNTPs) were from HT Biotechnology (Cambridge, U.K.). Sephadex G-25 spin pure columns were from CPG (Lincoln Park, NJ), and opaque Microlite 2 polystyrene microtiter wells were from Thermo Labsystems (Franklin, MA). The Vivaspin 500 centrifugal filter device was purchased from Vivascience (Hannover, Germany). GMO genomic DNA standard for NK603 maize containing 1% genetically modified DNA (69407 GMO genomic DNA standard set for maize NK603, GA21, and CBH-351) was from Fluka Chemie (Buchs, Switzerland). All other chemicals were from Sigma (St. Louis, MO). All oligonucleotides used in this work (Table 1) were synthesized by Thermo Electron (Ulm, Germany). The oligonucleotides uIVR and dIVR were used as upstream (u) and downstream (d) primers for amplification of the maize-specific invertase gene (reference gene, Gene Bank accession number U16123). The oligonucleotides u-outerNK, u-innerNK, and dNK were used as upstream (u) and downstream (d) primers for seminested PCR of the NK603 event-specific sequence, flanking both sides of the transgenic insertion, namely, the maize genomic DNA sequence and the rice actin 1 promoter (Gene Bank accession number AX342368). The upstream primers, uIVR and u-innerNK, were biotinylated at the 5′end. Oligonucleotide pairs uIVR(IS)-dIVR(IS) and uNK(IS)-dNK(IS) were used for the creation of IVRlike and NK-like internal standards, respectively. The sequences presented in boldface type at the 5′end of uIVR(IS), dIVR(IS), uNK(IS), and dNK(IS) (Table 1) represent the new sequences to be introduced into invertase and NK603 internal standards, respectively. Oligonucleotides pIVR1 and pNK3 were used as target-specific probes in assays for IVR and NK, respectively, and oligonucleotides pIVR2 and pNK4 were used as DNA internal standard-specific probes in the assays for Invertase IS and NK IS. Oligonucleotide pIVR5 was used for the preparation of β-galactosidase-oligonucleotide conjugate and was synthesized with an -NH2 group at the 3′ end. The oligonucleotide pIVR2

Table 1. Oligonucleotide Sequences Used as Primers and Probes oligonucleotide

name

sequence (5′ f 3′)

size (mer)

label 5′-biotin

5′ primer 3′ primer 5′ primer for IVR-IS synthesis 3′ primer for IVR-IS synthesis

uIVR dIVR uIVR(IS) dIVR(IS)

Primers for IVR and IVR(IS) CCGCTGTATCACAAGGGCTGGTACC GGAGCCCGTGTAGAGCATGACGATC CTATGTATTGTGCCGTACAGAACCACCGCTGGCCATGGT GGTTCTGTACGGCACAATACATAGCGCGAGACGGCGTGG

25 25 39 39

outer 5′ primer inner 5′ primer 3′ primer 5′ primer for IS synthesis 3′ primer for IS synthesis

u-outerNK u-innerNK dNK uNK(IS) dNK(IS)

Primers for NK and NK(IS) ACTGAAATGGTGGAAGAAAG CGTCAAAGGATGCGGAACTG AACTGATGTTTTCACTTTTG TTGAAGGCCTACCTGAAGTCTGCTGAGACGTGCGTCCCT AGCAGACTTCAGGTAGGCCTTCAAGATCGGCTCATGCCG

20 20 20 39 39

invertase probe invertase IS probe

pIVR1 pIVR2

NK probe NK IS probe oligo(dT) for conjugation to aequorin oligo-NH2 for conjugation to β-galactosidase

pNK3 pNK4 dT30 pIVR5

Hybridization Assay AGGTGCAGCCAGTGGAGGAGGTCG ACGTCACCATCCGAACTTAAAACGCCGTAAAATATAGAGGTTCTGTACGGCACAATACATAG TAGGGTTGGAAATGCCAGAGAAAA AGCAGACTTCAGGTAGGCCTTCAA TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT CGTTTTAAGTTCGGATGGTGACGT

5′-biotin

25 62 24 24 30 24

5′-NH2 3′-NH2

consisted of three segments. One segment at the 3′ end (boldface) is complementary to the newly inserted sequence (24 bp) of IVR IS, the second (14 bp, in the middle) is used as a spacer, and the third segment (24 bp) at the 5′ end (boldface italics) is complementary to pIVR5 oligonucleotide. The (dT)30 oligonucleotide was used for conjugation to aequorin and was synthesized with an -NH2 group at the 5′end. Amplification of the Reference Gene (Invertase) and GMO-Specific Sequence (NK). PCR amplification of the invertase reference gene (IVR) was carried out with NK603 genomic DNA in a final volume of 50 µL containing 1× colorless GoTaq Flexi buffer, 2 mM MgCl2, 0.2 mM each of the dNTPs, 0.5 µM concentration of each primer (uIVR and dIVR), and 1.25 U of Taq DNA polymerase. The NK603 event-specific sequence (NK) was amplified by a seminested PCR. The primer pair of u-outerNK and dNK was used in the first PCR to amplify a 430 bp product, using 50 ng NK603 genomic DNA as template. A 5 µL aliquot from the first PCR mixture was used for amplification of a shorter segment (293 bp) using primers u-innerNK and dNK. The composition of PCR mixtures was the same as for IVR. The cycling parameters for all amplification reactions were as follows: initial denaturation at 95 °C for 4 min, 35 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 10 min. Construction of DNA Internal Standards (DNA Competitors). Recombinant DNA competitors for IVR and NK were constructed by replacing a 24 bp segment of each target DNA (spanning the region 911-934 within exon 3 of IVR gene and the region 232-255 in the sequence of a 498 bp segment around the 5′ insertion junction of transgenic NK603 maize) with a different sequence of the same size (see Table 1) using PCR as a synthetic tool.12 Briefly, each DNA template was subjected to two PCR amplifications, PCR-A and PCR-B. PCR-A was carried out by using primer pair uIVR-dIVR(IS) for IVR and the pair u-innerNK-dNK(IS) for NK. PCRs were carried out in a total volume of 50 µL, containing 1× GoTaq buffer, 2 mM MgCl2, 0.2 mM of each dNTP,

0.5 µM of the appropriate primer, and 1.25 U of Taq DNA polymerase. Cycling parameters were as follows: initial denaturation at 95 °C for 4 min, 35 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 10 min. PCR-B was performed using primer pairs dIVR-uIVR(IS) and dNK-uNK(IS) for IVR and NK templates, respectively. PCR conditions were the same as PCR-A. The products of PCR-A and PCR-B (fragments A and B, respectively) for each target DNA were purified from a 1.5% agarose gel using the NucleoSpin extraction kit from Macherey-Nagel, (Duren, Germany). An equimolar mixture of the purified and quantitated fragments (∼200 fmol of each fragment) were joined to give fragment AB by means of a PCR-like reaction without primers. The cycling parameters were as follows: initial denaturation at 95 °C for 4 min, 40 cycles at 95 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 10 min. Subsequently, a 3 µL aliquot of fragment AB was amplified by PCR using primers pair uIVR-dIVR or u-innerNK-dNK for IVR IS or NK IS, respectively. Tailing of Oligonucleotide Probes. Oligonucleotide probes pIVR1, pNK3, and pNK4 were tailed at the 3′ end by using terminal deoxynucleotidyl transferase (TdT). The tailing reactions were carried out in a total volume of 20 µL containing 0.2 M potassium cacodylate, 0.125 M Tris-HCl, pH 7.2, 0.1 mL/L Triton-100, 1 mM CoCl2, 0.5 mM dATP (IVR1 probe) or 0.5 mM of each dNTP and 25 µM of F-dUTP (NK3 probe) or 0.5 mM of each dNTP and 25 µM D-dUTP (NK4 probe), 25 units of TdT, and 100 pmol of oligonucleotide. After incubation for 1 h at 37 °C, the reaction was terminated by the addition of 2 µL 0.5 M EDTA. The tailed oligonucleotide probes were stored at -20 °C and used without purification. Preparation of Aequorin-(dT)30 Conjugate. Recombinant hexahistidine-tagged aequorin was expressed in E. coli using the vector pHISAEQ and purified as described previously.13 Conjugation of aequorin to 5′-amino-modified (dT)30 probe was performed according to ref 14.

(12) Bortolin, S.; Christopoulos, T. K.; Verhaegen, M. Anal. Chem. 1996, 68, 834-840.

(13) Glynou, K.; Ioannou, P. C.; Christopoulos, T. K. Protein Expression Purif. 2003, 27, 384-390.

Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

9435

Conjugation of β-Galactosidase to 3′ Amino-Modified Oligonucleotide Probe. pIVR5 probe was first activated with maleimide groups by reacting with the heterobifunctional crosslinking reagent sulfo-SMCC. A 2.5 µL aliquot of a 400 µM probe solution (1 nmol) in water was mixed with 5 µL (∼110 nmol) of 10 g/L sulfo-SMCC solution in DMSO and 20 µL of 0.5 M NaHCO3, pH 8.0. The reaction was allowed to proceed for 30 min at ambient temperature in the dark. Excess sulfo-SMCC was removed by gel filtration using G-25 Sephadex spin columns equilibrated with conjugation buffer (100 mM Na2HPO4, 10 mM MgCl2, pH 6.3). The derivatized oligonucleotide (∼25 µL) was mixed with 5 µL of 10 g/L (0.1 nmol) β-galactosidase and 45 µL of the conjugation buffer. The reaction was allowed to proceed for 2 h at ambient temperature in the dark. The excess of oligonucleotide-sulfo-SMCC conjugate was then removed by ultrafiltration using the Vivaspin 500 centrifugal filter device equilibrated three times with 400 µL of storage buffer (100 mM Tris-HCl, 10 mM MgCl2, 10 mM NaN3, pH 7.5). For this purpose, the reaction mixture was diluted six times with storage buffer and centrifuged at 12 000g for 10 min (retendate volume ∼50 µL). The retendate was diluted to 300 µL with storage buffer, and this step was repeated two more times. The conjugate was stored at -20 °C in small aliquots to avoid degradation caused by repeated freezing and thawing. Double Quantitative Competitive Polymerase Chain Reaction of Invertase and NK Sequences. Double quantitative competitive PCR for IVR and NK was carried out (in the same PCR tube) in a 50 µL solution containing (final concentrations) 1× GoTaq Flexi buffer, 2 mM MgCl2, 0.2 mM of each dNTP, 0.05 µM of each uIVR and dIVR primer, 0.5 µM of each u-innerNK and dNK primer, a constant amount (5000 copies) of each IS for IVR and NK, and 1.25 units of GoTaq DNA polymerase. Cycling parameters were as follows: initial denaturation at 95 °C for 4 min, 35 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 10 min. Quadruple-Analyte Chemiluminometric Assay of PCR Products. Opaque polystyrene microtiter wells were coated for 2 h at 42 °C with 50 µL of 1.4 mg/L streptavidin diluted in phosphate-buffered saline, (PBS, 0.14 M sodium chloride, 10 mM sodium phosphate, and 1.7 mM potassium phosphate, pH 7.4). Prior to use, the wells were washed three times with wash solution (50 mM Tris-HCl, 0.15 M NaCl, 2 mM EDTA, 0.2 mL/L Tween20, pH 7.5). Biotinylated PCR products were diluted 10 times in hybridization solution (10 g/L BSA in 0.1 M maleic acid buffer, pH 7.5, 0.15 M NaCl, 2 mmol/L EDTA), and 50 µL was added to the wells in duplicate. The products were allowed to bind to streptavidin for 15 min at ambient temperature under gentle shaking, and then the wells were washed three times with wash solution. Next, the nonbiotinylated strands were denatured by incubating the wells with 50 µL of 0.1 M NaOH for 5 min under shaking and removed by washing the wells. An amount of 50 µL of a mixture containing 10 nM each of the four oligonucleotide probes diluted in hybridization solution was added into the wells, and the hybridization reaction was allowed to proceed for 10 min at 42 °C. The excess of probes was removed by washing the wells three times, and 50 µL of a mixture containing 22 nM aequorin(dT)30, 15 µg/L anti-FL-HRP antibody, 75 U/L anti-Dig-ALP, and 1 nM pIVR5-β-galactosidase conjugate, in 10 mM Tris-HCl, pH 9436

Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

7.5, 5 mM EGTA, 10 mM MgCl2, 0.5 mL/L Tween-20 and 2 g/L BSA, was added into the wells. The wells were incubated for 20 min at 37 °C under shaking, and the excess of conjugates was removed by washing. The bound reporter proteins were measured at ambient temperature by adding the appropriate triggering solution as described below. Between additions, the wells were washed three times. The activity of bound aequorin was measured by injecting 50 µL of triggering solution (20 mM Tris-HCl, 25 mM CaCl2, pH 7.5) into each well and integrating the luminescence signal for 3 s. Then 50 µL/well of the chemiluminogenic substrate for HRP (chemiluminescent ultrasensitive luminol reagent 3-fold diluted in reaction buffer reagent (1:2)) was added. The wells were incubated for 4 min, and the chemiluminescence was integrated for 1 s. Subsequently, the β-galactosidase chemiluminogenic substrate, Galacton-Star (100-fold diluted in reaction buffer diluent) was added (50 µL/well), the wells were incubated for 10 min, and the chemiluminescence was integrated for 1 s. Finally, 50 µL of the chemiluminogenic substrate for ALP (Lumiphos) was added to each well. Following incubation for 10 min, the chemiluminescence was integrated for 1 s. RESULTS AND DISCUSSION A schematic presentation of the principle of the quadrupleanalyte hybridization assay is shown in Figure 1. The four biotinylated PCR products are captured in the same well by immobilized streptavidin. The nonbiotinylated strands are removed by NaOH treatment, and the immobilized single-stranded DNA fragments are hybridized with a mixture of four specific probes for IVR, IVR-IS, NK, and NK-IS. Subsequently, a solution containing four chemiluminescent reporters, i.e., aequorin-(dT)30,13,14 galactosidase-oligo IVR5, anti-FL-HRP, and anti-Dig-ALP, is added. The probes are linked to the reporters as follows. The IVR probe carries a poly(dA) tail at the 3′end which is recognized by aequorin-(dT)30. The IVR-IS probe comprises a segment at the 3′end complementary to IVR-IS and a sequence at the 5′ end complementary to the oligonucleotide that is conjugated to β-galactosidase. In the middle of the IVR-IS probe, we have introduced a 14 nt random spacer to avoid interference with hybridization. NK and NK-IS probes are labeled at the 3′ end with the haptens fluorescein and digoxigenin, respectively, to allow recognition by anti-FL-HRP and anti-Dig-ALP antibodies. The flash-type bioluminescent reaction of aequorin is triggered first by adding Ca2+. The glow-type chemiluminescent reactions catalyzed by HRP, GAL, and ALP are then triggered sequentially by adding appropriate substrates. The strategy followed for rapid conjugation of GAL with the NH2-modified oligonucleotide (pIVR5) comprises (i) conversion of the primary amino group of oligonucleotide to maleimide group using the heterobifunctional cross-linker sulfo-SMCC, (ii) reaction of free -SH groups on the surface of the protein with maleimide activated oligonucleotide, and (iii) removal of free oligonucleotide by ultrafiltration. The NH2-modified oligonucleotide was derivatized with a 100-fold molar excess of sulfo-SMCC and purified by ultrafiltration. The SMCC-modified oligonucleotide reacted with GAL at various molar ratios. The unreacted oligonucleotide probe was removed by ultrafiltration with molecular weight cutoff of 50 (14) Glynou, K.; Ioannou, P. C.; Christopoulos, T. K. Bioconjugate Chem. 2003, 14, 1024-1029.

Figure 1. Principle of the quadruple-analyte chemiluminometric hybridization assay. SA ) streptavidin; B ) biotin; A, T ) adenine, thymine; F ) fluorescein-dUTP; D ) digoxigenin-dUTP; AEQ ) aequorin; HRP ) horseradish peroxidase; ALP ) alkaline phosphatase; GAL ) β-galactosidase. The four biotinylated PCR products are bound to a SA-coated microtiter well. The nonbiotinylated strands are removed, and the immobilized strands are hybridized with specific probes that are linked to the four reporters. The chemiluminescent reactions are then triggered sequentially: 1, Ca2+; 2, 3 and 4, HRP, GAL, and ALP substrates.

kDa. The study of the effect of the oligonucleotide/GAL molar ratio showed that the performance of the conjugate deteriorates at ratios higher than 30. This was attributed either to GAL inactivation or to the fact that the presence of too many oligos on the surface of the enzyme may lead to multiple hybridization events per conjugate molecule, thus reducing the number of GAL molecules bound to the solid phase. Amplification of the IVR gene produces a 225 bp fragment. Amplification by seminested PCR of the NK603 event-specific segment flanking the 5′ integration junction between the maize genome and DNA construct yields a 293 bp product. The DNA competitor (DNA internal standard, IS), for each target DNA, was constructed by replacing a 24 bp sequence of the cognate target with a new segment of equal size. Briefly, the method is based on the creation of two fragments A (119 and 100 bp for IVR and NK, respectively) and B (130 and 217 bp for IVR and NK, respectively) for each target DNA by means of PCR.12 Fragments A contain a segment identical to the left part of the corresponding target plus the newly introduced 24 bp sequence. Fragments B (130 and 217 bp for IVR and NK, respectively) contain a segment homologous to the right part of the cognate target and a 24 bp extension complementary to fragments A. Products A and B were joined together by means of a PCR-like reaction without primers. Larger amounts of DNA competitors are produced by PCR using the same primer set as for the respective target sequences. This approach to the synthesis of DNA competitors is rapid because it does not require cloning. The four amplified DNA fragments (IVR, IVR-IS, NK, and NKIS) were quantified simultaneously by the quadruple-analyte chemiluminometric hybridization assay performed in a single microtiter well. We studied the glow-type enzymic reaction kinetics for ALP and GAL in order to select the shortest incubation time with the

appropriate substrates necessary to obtain reliable signal-tobackground ratios (S/B). It was found that the S/B ratio either with the ALP or GAL system increases with incubation time up to 10 min and then reaches plateau, whereas absolute signals for ALP and GAL at 10 min incubation time were about 35% and 60% of the maximum, respectively. Therefore, a 10 min incubation time for both ALP and GAL was selected for the measurements. The entire quadruple-analyte bioluminometric hybridization assay is complete in 75 min. In regards to the order in which AEQ, HRP, GAL, and ALP activities are measured, we observed that the signal of GAL decreased considerably when measured after ALP. This was attributed to GAL inactivation due to exposure to the alkaline solution of the ALP substrate. The measurement order of HRP activity did not affect GAL. According to these findings, the measurement order followed in the quadruple-hybridization assay was AEQ, HRP, GAL, and ALP. Hybridization assays were optimized by using PCR-amplified products that were quantitated by densitometry of images of ethidium bromide-stained gels using the ΦΧ174 DNA marker as calibrator. For a successful quadruple-analyte hybridization assay it is critical that there is no cross-talk of signal between the reporters. A washing step was introduced after each measurement to remove the substrate before we proceed to the next step. Aequorin emits flash-type luminescence that decays in a few seconds. We investigated whether any of the glow-type emissions from HRP (second reporter) and GAL (third reporter) are transferred to the next step. A 500 pM solution of NK-WT measured by HRP gives a signal of 137 290 RLU (relative light unit). After washing, addition of GAL substrate, and measurement of GAL activity, we obtained a signal of 2.2 RLU, which is the typical blank of GAL in a single-analyte hybridization assay configuration. Similarly, a 500 pM solution of IVR IS determined Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

9437

Figure 2. Study of the specificity of the probes used for the quadruple-analyte chemiluminometric hybridization assay of amplified NK (HRP), NK-IS (ALP), IVR (AEQ), and IVR-IS (GAL). PCR product concentration 500 pM.

Figure 3. Luminescence signal (corrected for the background) as a function of the target DNA concentration. (A) single-analyte and (B) quadruple-analyte chemiluminometric hybridization assays of the four amplification products from NK (9), NK-IS (2), IVR (1), and IVR-IS (b).

by the GAL reporter gives 89 RLU. Following washing, pipetting the ALP substrate, and measuring ALP, the signal is 6.6, whereas the average background of ALP in a single-analyte hybridization assay is 6.9. These data prove that there is no signal carryover in the quadruple-analyte hybridization assay. We performed cross-hybridization studies in order to evaluate the specificity of the probes, i.e., whether each probe hybridized (besides the corresponding target) with the other three DNA fragments. A 500 pM solution of each target DNA was analyzed by the quadruple-analyte hybridization assay in the absence and in the presence of the other three target DNA. The results of the cross-hybridization study are presented in Figure 2. It is observed that each amplified DNA fragment gives a high signal only when hybridized with the respective probe and no hybridization occurs with the other three probes. Moreover, the signals obtained for 9438

Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

each DNA fragment either alone or as a mixture with the other three DNA fragments are practically the same, thereby confirming that the capacity of the streptavidin-coated surface is sufficient to capture the mixture of all four targets. The performance of hybridization assays was initially studied separately for each target DNA using serial dilutions of amplification products from IVR, IVR-IS, NK, and NK-IS. The analytical signals (background subtracted) plotted versus the concentration of amplified products are presented in Figure 3A. The background is defined as the luminescence obtained in the absence of target DNA. The analytical range of all assays extends up to 1000 pM. The limits of quantification (LOQ) are 9 pM of amplified IVR fragment (0.45 fmol/well), 13 pM of amplified IVR-IS (0.65 fmol/ well), 8 pM of amplified NK (0.4 fmol/well), and 7 pM amplified NK-IS (0.35 fmol/well).

The reproducibility of the single-analyte hybridization assays for each of the four DNA fragments was assessed by analyzing samples containing low (4 pM), medium (37 pM), and high (1000 pM) concentrations of amplified products. The coefficients of variation (CVs) were 7.7%, 3.0%, and 3.7% for IVR; 8.1%, 8.9%, and 5.0% for IVR-IS; 5.5%, 7.7%, and 8.8% for NK; 8.5%, 6.6%, and 6.3% for NK-IS, respectively (n ) 4). The detectability and analytical range of the quadruple-analyte hybridization assay were established by analyzing solutions containing all DNA fragments. The results are presented in Figure 3B. The LOQs obtained from the quadruple-analyte assay are 9 pM amplified IVR DNA (0.45 fmol/well), 3 pM of IVR-IS DNA (0.15 fmol/well), 6 pM of NK DNA (0.3 fmol/well), and 5 pM amplified NK-IS DNA (0.25 fmol/well). The analytical range of the quadruple-analyte hybridization assay extends up to 1000 pM of DNA. The reproducibility of the quadruple-analyte hybridization assay was assessed by analyzing samples containing low (4 pM), medium (37 pM), and high (1000 pM) concentrations of the four amplified DNA fragments. The CVs were 8.5%, 8.2%, and 5.5% for IVR DNA; 12%, 5.7%, and 5.1% for IVR-IS DNA; 9.9%, 3.5%, and 8.8% for NK DNA; 5.5%, 6.2%, and 4.5% for NK-IS DNA, respectively (n ) 4). Therefore, the analytical performances of the single-analyte and quadruple-analyte assays are similar confirming that there is practically neither cross-hybridization nor interference between the four enzymic reactions in the order they are measured. For quantitative competitive PCR of NK or IVR, PCR mixtures containing from 50 to 5 × 106 copies of NK or IVR DNA were coamplified along with a constant amount of 5 × 103 copies NKIS or IVR-IS, respectively. The calibrators were prepared by serial dilutions of stock solutions of target DNA in a solution containing 103 copies/µL of the respective internal standard, 10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-HCl, and 1 mL/L Triton X-100, pH 8.8. PCR products (5 µL) were analyzed in duplicates by the hybridization assay. Calibration graphs for NK and IVR presented as a plot of the ratio of the luminescence signals L/LIS obtained from the target and internal standard versus the number of copies of each target introduced in the PCR mixture are shown in Figure 4. The signals are background subtracted considering as background the signal of the PCR negatives (no target DNA present). The S/B ratio at 50 copies of NK and IVR target DNA was found to be 1.6 and 2.8, respectively. For determination of the relative content (percentage) of transgenic NK603 maize by double quantitative competitive PCR, mixtures containing 20 to 2 × 104 copies of NK, 5 × 103 copies each of NK-IS and IVR-IS, and 4 × 104 copies of IVR reference gene were subjected to PCR under the conditions used for the single competitive PCR. Given that 100 ng of maize genomic DNA contains ∼4 × 104 copies of IVR reference gene,15 the mixtures correspond to maize samples with GMO content from 0.05% to (15) (a) Trapmann, S.; Catalani, P.; Conneely, P.; Corbisier, P.; Gancberg, D.; Hannes, E.; Le Guern, L.; Kramer, G. N.; Prokisch, J.; Robouch, P.; Schimmel, H.; Zeleny, R.; Pauwels, J.; van den Eede, G.; Weighardt, F.; Mazzara, M.; Anklam, E. Certified Reference Materials IRMM-410S; B-2440; European Commission Joint Research Center, Institute for Reference Materials and Measurements: Geel, Belgium, 2002; pp 1-20. (b) Bonfini, L.; Heinz, P.; Kay, S.; van den Eede, G. Food Products and Consumer Goods; Unit I-21020; European Commission Joint Research Center, Institute for Health and Consumer Protection: Ispra (VA), Italy, 2002, 1-67.

Figure 4. Quantification of NK (2) and IVR (b) by double quantitative competitive PCR. The ratio L/LIS of the luminescence values obtained from target and internal standard (NK/NK-IS and IVR/IVRIS) is linearly related to the number of NK and IVR copies in the sample prior to PCR amplification.

Figure 5. Quantification of % GMO content by double quantitative competitive PCR combined with quadruple-analyte hybridization assay. The L/LIS NK to IVR ratio is linearly related to the GMO content of the sample.

50%. PCR products (5 µL) were analyzed in duplicate by the quadruple-analyte hybridization assay. The ratio of the luminescence signals obtained for NK, LNK/LNK(IS), to the ratio of the signals obtained for IVR, LIVR/LIVR(IS), is linearly related to % GMO content of the synthetic mixture (see Figure 5). The reproducibility of the quantitative assay of NK using double quantitative competitive PCR, i.e., coamplification of NK and IVR gene in the presence of their internal standards, followed by a quadruple-analyte chemiluminometric hybridization assay in a single well, was assessed with solutions containing 20, 200, 2000, and 20 000 NK copies in the presence of 5000 copies of NK-IS, 40 000 copies of IVR, and 5000 copies of IVR-IS. The CVs of the (LNK/LNK(IS))/(LIVR/LIVR(IS)) ratios were 25%, 6.8%, 6.6%, and 2.5%, respectively (n ) 3). The corresponding CVs of the GMO content, estimated from the calibration graph and the (LNK/ LNK(IS))/(LIVR/LIVR(IS)) ratios, were 60%, 17%, 16%, and 6.0%, Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

9439

respectively. The S/B ratio obtained for 20 copies of NK target DNA was found to be 2.9. CONCLUSION The proposed hybridization assay combines the high sensitivity, wide dynamic range, and simple instrumentation of chemiluminometric assays with the ability to quantify simultaneously four nucleic acid sequences in a single microtiter well. Microtiter wellbased assays are amenable to automation and high-throughput analysis, because they allow parallel processing of multiple samples. The assay employs four chemiluminescent reporters, i.e., aequorin-(dT)30, galactosidase-oligo, HRP-antifluorescein, and ALP-antidigoxigenin. The four conjugates react with any probe, which either carries a segment complementary to any of the oligos attached to aequorin and galactosidase or is labeled with a hapten

9440

Analytical Chemistry, Vol. 79, No. 24, December 15, 2007

(fluorescein or digoxigenin). Consequently, the assay is universal since the same reporter conjugates can be used for multianalyte quantification of any sequences with properly designed probes. Also, it can be combined with array-based assays (spatial separation) for greater multiplexing ability. Furthermore, we have demonstrated the applicability of the proposed quadruple-analyte hybridization assay to high-throughput quantitative competitive PCR of two target sequences in the presence of the corresponding competitors.

Received for review September 7, 2007. Accepted October 7, 2007. AC7018848