Quantification of Exosome Based on Copper-Mediated Signal

Subscriber access provided by UNIVERSITY OF TOLEDO LIBRARIES

Article

Quantification of Exosome Based on CopperMediated Signal Amplification Strategy Fang He, Jing Wang, Bin-Cheng Yin, and Bang-Ce Ye Anal. Chem., Just Accepted Manuscript • DOI: 10.1021/acs.analchem.8b01187 • Publication Date (Web): 12 Jun 2018 Downloaded from http://pubs.acs.org on June 12, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Analytical Chemistry

Quantification of Exosome Based on Copper-Mediated Signal Amplification Strategy Fang He†, Jing Wang†, Bin-Cheng Yin*,†, and Bang-Ce Ye*,†‡ξ †

Lab of Biosystem and Microanalysis, State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, 200237, China ‡

Collaborative Innovation Center of Yangtze River Delta Region Green Pharmaceuticals, College of Pharmaceutical Sciences, Zhejiang University of Technology, Hangzhou 310014, Zhejiang, China ξ

School of Chemistry and Chemical Engineering, Shihezi University, Xinjiang, 832000, China

Corresponding Authors *Bin-Cheng Yin, [email protected], Tel/Fax no. 0086-21-6425383; *Bang-Ce Ye, [email protected], Tel/Fax no. 0086-21-64252094 ABSTRACT: Exosomes, a class of small extracellular vesicles, play important roles in various physiological and pathological processes by serving as vehicles for transferring and delivering membrane and cytosolic molecules between cells. Since exosomes widely exist in various body ﬂuids and carry molecular information of their originating cells, they are being regarded as potential noninvasive biomarkers. Nevertheless, the development of convenient and quantitative exosome analysis methods is still technically challenging. Here, we present a low-cost assay for direct capture and rapid detection of exosomes based on copper-mediated signal amplification strategy. The assay involves three steps. First, bulk nanovesicles are magnetically captured by cholesterol-modified magnetic beads (MB) via hydrophobic interaction between cholesterol moieties and lipid membranes. Second, bead-binding nanovesicles of exosomes with specific membrane protein are anchored with aptamer-modified copper oxide nanoparticles (CuO NPs) to form sandwich complexes (MB-exosome-CuO NP). Third, the resultant sandwich complexes are dissolved by acidolysis to turn CuO NP into copper(II) ions (Cu2+), which can be reduced to fluorescent copper nanoparticles (CuNPs) by sodium ascorbate in the presence of poly(thymine) (poly T). The fluorescence emission of CuNPs increases with the increase of Cu2+ concentration, which is directly proportional to the concentration of exosomes. Our method allows quantitative analysis of exosomes in the range of 7.5×104 to 1.5×107 particles/μL with a detection of limit (LOD) of 4.8×104 particles/μL in biological sample. The total working time is about 2 h. The assay has the potential to be a simple and cost-effective method for routine exosome analysis in biological sample.

Extracellular vesicles (EVs) are membrane vesicles containing cytosol from the secreting cells enclosed in a lipid bilayer. They are detectable in various bodily fluids, including blood, urine, saliva, breast milk, amniotic fluid, etc.1 In the 1980s, Johnstone defined the term ‘exosomes’ for small EVs (30-150 nm) of endosomal origin, as a result of the fusion of multivesicular endosomes or multivesicular bodies with the plasma membrane and release outside the cell.2,3 Recently, exosomes are attracting attentions because they carry abundant molecular information, including RNAs (messenger RNAs and microRNAs), DNA fragments, proteins, and lipids of their parent cells. Thus, exosomes provide a convenient approach to monitor and analyze the state of parental tumor cells without the need for biopsy.4,5 Moreover, mounting evidence suggests that the shedding of exosomes is correlated with tumor antigens and anti-tumor immune response by serving as signals in the immune system, and thus, have potential appli-

cation value for cancer diagnostics.6-8 Melo et al. reported that levels of GPC1 positive (GPC1+) circulation exosomes can accurately and sensitively differentiate early- and latepancreatic cancer from benign disease.9 Additionally, the exosomes secreted from epithelial tumor cells carry the epithelial cell adhesion molecule (EpCAM), which is a transmembrane glycoprotein mediating Ca2+-independent homotypic cell–cell adhesion in epithelia.10,11 A growing number of studies have shown that using the cargo of exosomes as disease markers is quite promising and can overcome current challenges in cancer detection and monitoring, especially the expense of invasive screening.12,13 Currently, the gold standard method for isolation of exosomes is based on differential centrifugation, which requires centrifugation up to 120 000 g.14 This method is time consuming (>10 h), tedious, and inefficient. The other approaches reported for the isolation of exosomes, such as filtration and polymer-based precipitation, can introduce

ACS Paragon Plus Environment

Analytical Chemistry 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

impurities and lead to exosome damage.15,16 Another option is affinity purification with specific antibodies, such as affinity-binding beads and microfluidic immunocapture, both of which depend on the presence of target proteins.17 In addition, separation of exosomes using hydrophobic interaction with a lipid nanoprobe, such as cholesterol, monoacyl lipid (C18), and diacyl lipid (DSPE), is a new choice, which is not affected by the number of exosome surface proteins.18 We also have reported a method based on affinity-binding and a cholesterol-labeled DNA anchor for direct and sensitive detection of exosomes from serum and cell culture supernatant.19 Currently, the identification of exosome proteins is commonly based on mass spectrometry and immunoassays (e.g. enzyme-linked immunosorbent assay (ELISA) and western blot), which have excellent analytical performances, but require laborious sample pretreatment, thus limiting their application for rapid exosome protein identification.20 Besides that, increasingly new technologies have been used in exosome detection to increase sensitivity, speed, and efficiency, including surface enhanced Raman scattering (SERS),21 microfluidics,22 nano-plasmonic sensors,23 electrochemistry,24 and localized surface plasmon resonance.25 However, most of the above-mentioned analytical methods depend on expensive or specially designed instruments. In this context, the development of a convenient and reliable method for efficient exosome separation and identification would be very beneficial in the clinical research of exosome biomarkers. Here, we present a low-cost, copper-mediated signal amplification strategy for direct capture and rapid detection of exosomes. In our design, magnetic beads (MBs) and copper(II) oxide nanoparticles (CuO NPs) are modified with a cholesterol anchor and CD63 aptamer for membrane vesicles capture and specific exosome identification, respectively. When exosomes are present, MB probe and CuO NP probe can form sandwich complexes (MB-exosome-CuO NP). After sandwich-capture of exosomes, the MB-captured CuO NP are separated from unbound CuO NP probes by a magnet, and are fully dissolved by acidolysis to convert CuO NPs into copper(II) ions (Cu2+). As a result, the detection of exosome is transferred to the detection of Cu2+ with a high amplification effect.26 The Cu2+ can be reduced to fluorescent copper nanoparticles (CuNPs) by sodium ascorbate (SA) in the presence of poly(thymine) (poly T).27,28 The fluorescence intensity of CuNPs increases with the increase of Cu2+ concentration, which is directly proportional to the concentration of exosomes.

EXPERIMENTAL SECTION Reagents and Materials. The oligonucleotides were custom-synthesized and HPLC purified by Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). The sequence information is shown in Table 1. Dynabeads MyOne streptavidin magnetic beads, Dulbecco’s Modified Eagle Medium (DMEM), and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Hepatocellular carcinoma

Page 2 of 10

cell line (HepG2) was obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). RIPA lysis buffer, trypsin-EDTA, and penicillin-streptomycin were purchased from Solarbio Science and Technology Co., Ltd. (Beijing, China). Deoxyribonuclease (DNase I) was purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). ExoEasy Maxi Kit was purchased from Qiagen Inc. (Hilden, GER). The filters (0.22 μm) were purchased from Millipore Corp. (Bedford, MA, USA). Copper(II) oxide (CuO) nanopowder (ca. 50 nm in diameter) was purchased from Sigma-Aldrich, Inc. (Saint Louis, MO, USA). CuO nanopowder (ca. 150-250 nm in diameter) was purchased from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). Copper(II) nitrate tris(2-chloro-2trihydrate (Cu(NO3)2•3H2O), ethyl)phosphate (TCEP), and sodium ascorbate were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). All chemicals used were of analytical reagent grade, and directly used without additional purification. The solutions were prepared using deionized water with an electrical resistance of 18.2 MΩ∙cm. Table 1. Sequences information for oligonucleotides used in this study Name

Sequences (5'→3')

Cholesterol anchor

Biotin-T30-Cholesterol

CD63 aptamer

CACCCCACCTCGCTCCCGT GACACTAATGCTATTTTTTT TTT-SH

Random sequence

GTGGGGTGGAGCGAGGG CACTGTGATTACGATTTTTT TTTTT-SH

F-CD63 aptamer

FAMCACCCCACCTCGCTCC CGTGACACTAATGCTATTTT TTTTTT-SH

F-anchor

Biotin-T30-FAM

Instrumentation. The spectra of UV-Vis absorption and fluorescence excitation and emission were recorded on a microplate reader (SynergyMX, Bio-Tek, Winooski, USA) using a transparent 384-well microplate (Corning Inc., NY, USA) and a black 384-well microplate (Fluotrac 200, Greiner, Germany), respectively. HepG2 cells were cultured in a constant temperature incubator (Eppendorf Galaxy 170S, Germany). The transmission electron microscopy (TEM) images of particles and exosomes were performed on a Jeol JEM-2100 instrument (JEOL Ltd., Japan). The particle diameter and concentration of exosomes were measured using qNano (Izon Science Ltd., Oxford, UK). The sizes of MB and CuO NP with and without probe modification were measured using a Zetasizer Nano ZS (Malvern Instruments Ltd., UK). The gel photo was taken by a BioRad Molecular imager (Tanon-1600, China). The colloids were sonicated using a Qsonica Q500 (Newtown, CT) standard probe system. Mixing operation were performed on a HulaMixer Sample Mixer (Thermo Fisher Scientific Co., Ltd., Waltham, MA).


Page 3 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Preparation of Cell Culture Supernatant. The HepG2 cells were cultured in DMEM, which was supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin, and maintained at 37 °C in a humidified atmosphere of 5% CO2. Once 50% confluency was achieved, the supernatant was carefully removed and the cells were rinsed twice with phosphate-buffered saline (PBS), followed by incubation for 48 h in serum-free medium. The conditioned cell culture supernatant was harvested and centrifuged at 480 g for 5 min and followed by 2000 g for 10 min to remove intact cells and cell debris. All centrifugal processes were performed at 4 °C. To further remove large contaminating vesicles, the supernatant was filtered through a filter (0.22 μm) before exosome preparation. Exosome Isolation and Quantification. Exosomes in the prepared cell culture supernatant were isolated using exoEasy Maxi Kit according to the manufacturer’s instructions, and used as exosome standard for subsequent experiments. The concentration of purified exosome was measured by qNano. Preparation of MB Probe. The magnetic bead probe (MB probe) was prepared as follows. Briefly, 10 μL of streptavidin magnetic beads (MBs) were washed three times with binding and washing (B&W) buffer (5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl, pH 7.5) using an external magnetic field, and then suspended in 195 μL B&W buffer. Five microliters of 20 μM cholesterol anchor was incubated with the above MBs for 20 min at 25 °C on a mixer. To remove excess cholesterol, the MB probe was washed three times with B&W buffer and finally suspended in 200 μL PBS (0.1 M, pH 7.0) solution for subsequent experiments. For control experiment, F-anchor labeled with a fluorophore instead of a cholesterol was employed to verify the anchor immobilization on MB. F-anchor modified MB probe (200 µL) was mixed with DNase I (100 U) for 30 min, and the supernatant was collected to measure the fluorescence intensity. Preparation of CuO NP Probe. CuO nanoparticle probe (CuO NP probe) was prepared according to a reported literature. 26 Briefly, 20 mg of CuO nanopowder was suspended in 25 mL PBS solution containing Tween20 (PBST) (0.1 M, 0.1% Tween-20, pH 7.0) (PBST), and then sonicated at 200 W for 4 min, with 2 s pulses separated by 1 s, to rapidly obtain CuO NP colloid. Prior to use, 9 μL thiolated CD63 aptamer (100 μM) was incubated with 6 μL TCEP (50 mM) and 45 μL deionized water for 30 min to reduce disulfide bonds. Then, 240 μL CuO NP colloid was mixed with above CD63 aptamer at a final concentration of 3 μΜ, and incubated on a mixer for 12 h at room temperature. Subsequently, NaCl solution (2 M) was dropwise added to the above mixture to a final concentration of 0.1 M. After 24 h shaking, the CuO NP probe was washed by centrifugation four times at 12 400 g for 5 min to remove excess aptamer, and finally resuspended in 20 μL PBS solution (0.3 M, pH 7.0) for further use. For control experiment, a CD63 aptamer labeled with a fluorophore (F-CD63 aptamer) was employed to verify the modification of aptamer on CuO NP. F-CD63 aptamer modified CuO NP probe (20 µL) was mixed with DNase I (100 U) for 30 min,

and the supernatant was collected to measure the fluorescence intensity. Exosomes Detection Procedure. The detailed procedure for exosome detection of our method was as follows. First, 200 μL of MB probe was incubated with exosome sample for 45 min at room temperature with gentle shaking, followed by three washes with PBST. Then, 20 μL CuO NP probe and 180 μL PBS buffer were added to resuspend the MB probe. After incubation for 45 min with gentle agitation on the mixer, the sandwich complexes consisting of MB–exosome–CuO NP were collected, and washed three times using PBST to remove unbound CuO NP probes and other residues. Then, 100 μL HNO3 (10 mM) solution was added and incubated with above complexes for 5 min to convert CuO to Cu2+. Next, the supernatant was transferred to a new tube and mixed with a solution containing 20 μL MOPS buffer (0.1 M MOPS, 1.5 M NaCl, pH 7.5), 20 μL T50 probe (20 μM), 10 μL sodium ascorbate (20 mM), and 50 μL deionized water. After incubation in the dark at room temperature for 15 min, the solution was measured by the Bio-Tek equipment with an excitation at 340 nm. Unless noted otherwise, all measurements in this study were performed in triplicate. Detection of Exosomes in Human Serum. To investigate the application of our method in testing exosome levels, we quantified exosomes in serum from healthy individuals and cancer patients. The human serum samples were obtained from the Eastern Hepatobiliary Surgery Hospital. Written informed consent was obtained from the participants prior to enrollment, and the experiment was approved by the ethics committees from institution involved. The detection procedure for exosomes in human serum was the same as the procedure for exosome detection described above. Characterization of Exosomes. The exosomes were dropped on Cu grids and negatively stained with 1% phosphotungstic acid before TEM measurements. The western blot analysis procedure was as follows. First, HepG2 cells and exosomes were lysed by RIPA buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 0.5% sodium deoxycholate, 1% NP-40, and 1 mM PMSF) according to the instructions. Then, total proteins were electrophoresed by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to a nitrocellulose filter membrane. The membranes were then blocked in 5% BSA blocking buffer for 120 min, and washed three times for 10 min using TBST buffer (20 mM Tris, pH 7.6, 137 mM NaCl, and 0.05% Tween 20). Next, the membranes were incubated overnight with primary antibodies against exosome proteins at 4 °C, followed by washing three times using TBST, incubation with HRP-labeled secondary antibodies for 1 h at room temperature, and additional washing. Finally, the signal was measured by an ECL kit using a Gel Imaging System.

RESULTS AND DISCUSSION Working Principle of the Proposed Method for Exosomes Detection. The working principle of exosome detection method is schematically illustrated in Scheme 1. The proposed assay system mainly consists of MB probe,



Page 4 of 10

CuO NP probe, exosomes, and fluorescent CuNPs. First, anchor to construct MB probe and CuO NP probe, cholesterol SCHEMES 1. Working principle of the proposed method for exosome detection based on copper-mediated signal amplification strategy.

and the aptamer of the CD63 protein are immobilized to the surfaces of MB and CuO NP via biotin-streptavidin linkage and Cu-sulfhydryl (Cu-S) bonds, respectively. When exosomes are present, they are captured by the MB probe based on the hydrophobic interaction between cholesterol anchor and nanovesicle lipid membrane. Then, the CuO NP probe specifically recognizes MB bound exosomes through the binding between the aptamer and exosome surface protein, thus forming a MB-exosome-CuO NP sandwich complex. The sandwich complexes and unbound CuO NP probes are separated from each other using a magnetic separator. Subsequently, with the addition of HNO3 solution, CuO NP probes in the collected sandwich complexes are completely convert to Cu2+, which is the species that is actually detected. The free Cu2+ forms highly fluorescent CuNPs using poly(thymine) (poly T) single strand DNA as a template, according to previous reports.27,29 The final fluorescence signal is directly proportional to the concentration of exosomes, allowing quantitative detection of exosomes. Characterization and Quantification of Exosomes. The standard samples of exosomes were prepared from the cell culture supernatant of HePG2 cells by commercial exoEasy Maxi Kit. The concentration and size distribution of the acquired exoxomes were quantified using qNano as shown in Figure S1A, and the concentration was about 1.6×107 particles/μL. TEM was performed to examine the morphology of the purified exosomes, showing a uniform diameter with qNano result (Figure S1B), which was consistent with previous literature reports.8 In addition, in order to further validate the presence of exosomes, we analyzed the expression of CD63 protein, which is a universal exosome marker, in HepG2 cell lysates and isolated exosomes by western blotting. As shown in Figure S1C, distinct bands of CD63 protein were observed on the membrane in all tested samples, confirming that CD63 antigen was actually present on the isolated exosome surface. Performance Investigation of Fluorescent CuNPs. Because the proposed method for exosome detection depends on the fluorescence intensity of the poly T templated CuNPs, the synthetic conditions for CuNPs using

Cu(NO3)2 were investigated. The feasibility of CuNPs synthesis was first verified in buffer solution by fluorescence measurements. As shown in Figure 1 A (red curve), the introduction of Cu2+ induces intense fluorescence in the MOPS buffer, indicating that Cu2+ can be detected by using T50 in the presence of sodium ascorbate (SA). The formation of CuNPs was characterized by absorption spectrum, TEM image, and fluorescence emission and excitation spectra (Figure S2). The CuNPs were small particles larger than 1 nm, and exhibited strong fluorescence emission at 660 nm with excitation at 340 nm. To obtain optimal fluorescence performance, the effects of reaction time, concentration of SA, pH, and the length of poly T were investigated. From the real-time monitoring of fluorescence intensity (Figure 1B), we can see that the fluorescence intensity increased rapidly and then approached a plateau within 15 min. Furthermore, the concentration of SA had a significant effect on the fluorescence signal of the CuNPs. As can be seen from Figure 1C, the fluorescence intensity increased notably with increasing concentration of SA and reached a maximum when the concentration was about 1 mM. Then we investigated the influence of pH on fluorescence signal generation. As shown in Figure S3A, the fluorescence intensity had a slight fluctuation when the pH value changed from 6.7 to 9.0, and the strongest fluorescence intensity was observed when the pH was 7.5, indicating that a weakly alkaline buffer was more suitable for signal formation than an acidic buffer. In addition, the fluorescence intensity increased with increasing length of poly T and reached a maximum when the length of poly T was 50 (Figure S3B). Therefore, using poly T50 as template in MOPS buffer (pH 7.5), the final concentration of SA was 1 mM, and incubated for 15 min to get fluorescence signal. Next, the sensitivity of the signal generation system of CuNPs for Cu2+ detection was investigated. As shown in Figure 1D, the fluorescence intensity increased with the concentration of Cu2+ ranging from 20 μM to 130 μM. The inset of Figure 1D illustrates that the fluorescence intensity exhibited a good linear relationship with the concentration of Cu2+. The correlation equation is F=85×Cu2+ -2262 (R2 = 0.9932). Considering ferric ions (Fe3+), which were released


Page 5 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


from the core of the MB with Fe3O4 as main component, were present in the subsequent signal generation step. We

tested the selectivity of the signal generation system by adding seven other

Figure 1. (A) Fluorescence emission spectra of MOPS buffer (blank) containing different reagents. Inset: fluorescence 2+ emission spectra of purple, blue, and green line. [T50] = 2 μM, [SA] = 1 mM, [Cu ] = 100 μM. (B) Real-time monitoring 2+ of the fluorescence intensity in MOPS buffer (blank) containing different reagents. [T50] = 2 μM, [SA] = 1 mM, [Cu ] = 2+ 100 μM. (C) Effect of SA concentration on the fluorescence intensity of CuNPs. [T50] = 2 μM, [Cu ] = 100 μM. (D) Fluo2+ rescence emission spectral response of CuNPs to various concentrations of Cu (20, 40, 50, 60, 70, 80, 90, 100, 110, 120, 2+ and 130 μΜ). Inset: linear plot of fluorescence response to different concentrations of Cu (40, 50, 60, 70, 80, 90, 100, 110, 120, and 130 μΜ). [T50] = 2 μM, [SA] = 1 mM. The error bars represent the standard deviations of three repetitive measurements.

metal ions, including Fe3+, Al3+, Ca2+, Zn2+, Mn2+, Mg2+, and K+ (1 mM), under the same conditions as Cu2+ (100 µM). As shown in Figure S4, significant fluorescence was observed only in the case of Cu2+. These data vividly demonstrated that the signal generation system of CuNPs is not subjected to interference by other metal ions. Feasibility Test of Exosome Detection using CuNPs. As the fluorescence intensity of CuNPs had a slight fluctuation when the pH value of MOPS buffer changed, we further investigated the influence of HNO3 addition on CuNPs formation in the process of acidolysis. As shown in Figure 2A, at the same concentration of Cu(NO3)2, the difference in fluorescence intensity of CuNPs in the presence

(blue line) and absence (red line) of HNO3 was very small. In addition, almost the same fluorescence intensity was achieved by adding CuO NPs (green line) with the acidolysis of HNO3 in the case of equal amounts of Cu2+. Figure S5 shows that with the addition of different amounts of HNO3, the pH of MOPS buffer reaction solution changes from 7.5 to 6.7, in which the fluorescence intensity of CuNPs changes a little as shown in Figure S3A. Note that MB probes and partial CuO NP probes also consumed some HNO3 in the process of acidolysis. Thus, the influence of acid addition on the formation of CuNPs was negligible in



Page 6 of 10

Figure 2. (A) Investigation the influences of HNO3 on the formation of CuNPs. The fluorescence emission spectra of MOPS buffer solution containing different reagents. Note that three tested samples were all added 0.1 mg MBs to simulate the environmental components in our proposed system. [T50] = 2 μM, [SA] =1 mM, [Cu(NO3)2]=100 μM, [CuO NP] = 100 μM, [HNO3] = 5 mM. (B) Feasibility test of the proposed method. The fluorescence emission spectral responses of the proposed system obtained in the presence of different reagents. [T50] = 2 μM, [SA] =1 mM, [Exo] = 5 9.0×10 particles/μL.

Figure 3. Sensitivity investigation of the proposed assay for exosome detection. (A) Fluorescence emission spectral responses of the proposed system obtained at different concentrations of exosomes. (B) Linear plot of fluorescence 4 7 intensity as a function of the base-10 logarithm (lg for short) of the concentration of exosomes from 8 × 10 to 1.6 × 10 particles/μL. The error bars represent the standard deviations of three repetitive measurements.

our experimental condition. In addition, the particle size distributions of MBs and CuO NPs before and after probe modification were characterized using a Zetasizer Nano ZS. Figure S6 clearly shows that the sizes of two particles both had a slight increase after probe modification. We also designed FAM-labeled probes (F-anchor and F-CD63 aptamer) to verify the modification of probes on MBs and CuO NPs by performing DNase I hydrolyzation experiment (Figure S7). Next, we investigated the fluorescent signal of CuNPs from MB-exosome-CuO NP sandwich complex for exosome detection. As shown in Figure 2B, in the presence of CuO NP probe, when cholesterol anchor or exosomes were absent from the assay system, only fairly low fluorescence was detected, demonstrating that the MB-exosome-CuO NP sandwich complex was not formed in the absence of cholesterol anchor or exosomes. However, in the presence of exosomes and cholesterollabeled MB, the particle hybrids were successfully formed, and a subsequent signal was generated (red line). As shown in Figure S8, the TEM image of MB-exosome-CuO NP complex, in contrast to that of MBs, further provided the evidence of the feasibility of the proposed exosome detection method. Optimization of Experimental Conditions. In order to determine the conditions for optimal assay performance, five experimental parameters in the detection protocol, including exosome capture time, CuO NP probe recognition time, concentration of HNO3, acidolysis time, and size of CuO NP were optimized. As shown in Figure S9, when the capture time was 45 min, the best fluorescence

change ratio 1 was achieved with high efficiency.

With increasing recognition time, the fluorescence change ratio increased gradually, and reached a plateau when the recognition time was 45 min (Figure S10). Since the number of Cu2+ released from CuO NP probe directly affects

the sensitivity of the method, CuO NPs should be fully dissolved by HNO3 solution. The optimal HNO3 concentration was found to be 10 mM (Figure S11). In addition, the acidolysis time was optimized to completely dissolve the CuO NPs. The result is shown in Figure S12. When the sandwich complex was incubated with HNO3, the fluorescence change ratio of the reaction system gradually increased and achieved a plateau after 5 min, indicating that the acidolysis reaction is a rapid process. In addition, we found that CuO NPs in ca. 50 nm diameter was more suitable in our proposed method compared to larger size CuO NPs (ca. 150-250 nm) (Figure S13). We suspected this result is due to the steric hindrance from a great disparity in size between CuO NPs (ca. 150-250 nm in diameter) and exosomes (ca. 100 nm in diameter). Thus, the optimal experimental conditions were as follows: exosomes were incubated with MB probe for 45 min, and then incubated with ca. 50 nm CuO NP probe for 45 min to form MB-exosomeCuO NP sandwich complex, and the sandwich complex was dissolved by 100 μL of 10 mM HNO3 for 5 min. Sensitivity Investigation. Using the above optimal experimental conditions, we further assessed the capability of our method for quantitative analysis of exosomes in PBS buffer. As shown in Figure 3A, a gradual increase in the fluorescent peak at 660 nm was clearly observed with an increase of exosome concentration. A plot of the fluorescence intensity against the logarithm of the concentration of exosomes reveals a good linear relationship (Figure 3B). The correlation equation is F=2650×lgExo-12395 (R2 = 0.9938). The limit of detection (LOD) of the proposed method in PBS buffer was calculated to be 5.0×104 particles/μL based on 3σb/slope (σb is the standard deviation of the blank samples). Besides that, a recovery experiment was performed by spiking different amounts of exosomes into 5% diluted supernatant of ultracentrifuged FBS (5%


Page 7 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


diluted UC FBS) to test the accuracy of the method. The results of recovery experiment were summarized in Table S1, which shows a good agreement with the added concentration with recoveries from 95.5~110.0%. These results demonstrate the potential practical applicability of our method. Selectivity Test. We chose two kinds of DNA sequences, CD63 aptamer and random sequence, to modify the CuO NP for the selectivity investigation of the proposed method. Three different inputs, including cell culture medium (DMEM), cell culture supernatant filtrate (CCS filtrate) with 10 kDa filter, and cell culture supernatant (CCS) were used to test the selectivity of the proposed method. As expected, only CCS input showed significant fluorescence change using CD63 aptamer compared to DMEM and CCS filtrate (Figure 4). Almost no fluorescence change was observed in all inputs using the random sequence, indicating that the proposed method was able to discriminate exosomes from the distractions with high specificity.

Figure 4. Selectivity investigation of the proposed method. Bars represent the relative fluorescence change ratio

from the different inputs of

DMEM, CCS filtrate, and CCS with CD63 aptamer and random sequence-modified CuO NP probe. The error bars represent the standard deviations of three repetitive measurements.

Biological Sample Application. To demonstrate the practical application of the proposed method, we first spiked exosomes in 5% diluted supernatant of ultracentrifuged FBS (5% diluted UC FBS) to simulate a biological sample. Figure S14A shows that the fluorescence intensity was linearly related to the logarithm of the concentration of exosomes in the range from 7.5×104 to 1.5×107 particles/μL with a LOD of 4.8×104 particles/μL based on the regression equation F=2573×lgExo-11808. Note that the regression curves obtained in 5% diluted UC FBS and PBS buffer were nearly overlapped (Figure S14B), indicating that the biological matrix has a negligible effect in our proposed method. Besides, eight clinical serum samples from healthy individuals and cancer patients were measured by our method using the calibration equation of Figure S14A. As a control to assess the accuracy of our method, we employed exoEasy Maxi Kit to isolate exosomes from these serum samples, and measured the amount of the

isolated exosomes by qNano. Figure 5 shows that our results were comparable to those obtained by the kit coupled qNano. The concentrations of exosome in serum from healthy individuals and cancer patients had significant difference in statistics (P < 0.05) (Figure S15), which is consisted with that the abundance of CD63 in nontumorigenic cells-derived exosomes is less than that of tumor cells-derived exosomes.30 In addition, we compared the sensitivity, assay time, and linear range of our method with currently available methods. As shown in Table 2, we found that the LOD of our assay was comparable to some of the other methods, although some methods achieved better analytical performance than our method. However, most of these methods require special equipment, such as electrochemical methods, which require a specially designed electrochemical platform. Thus, the proposed method has the advantage of simplicity, low cost, and convenience for use.

Figure 5. Comparison of our method and the kit coupled qNano method for the detection of exosomes in serum samples from four healthy individuals (H) and four cancer patients (P).

CONCLUSION In summary, we have reported a sensitive, convenient method for quantitative detection of exosomes based on copper-mediated signal amplification strategy. The proposed method takes full advantage of magnetic beadbased platform, hydrophobic interaction, and copper nanoparticle. Compared to previous methods, our assay exhibits advantages of ease of operation, low cost, sensitivity, and selectivity. First, the magnetic bead-based platform makes the proposed method universal, convenient, and simple. Second, the fluorescent signal generation system of our method involves cost-efficient CuO NP and poly T templated CuNPs. Instead of antibody, the use of aptamer further saves the detection cost. Third, thanks to the high transformation efficiency of CuO NP to Cu2+, our method is able to detect exosomes with a detection of limit of 4.8×104 particles/μL within 2 h. Considering the above distinct advantages, we envision that our method holds potential to be a cost-effective, selective and sensitive platform for exosome detection in laboratory studies and clinical researches.

Table 2. Comparison of currently available methods for the detection of exosomes.



N O.

LOD

Method

(particles/μL)

Page 8 of 10

Assay time

Linear range (particles/μL)

Reference

1

Nanotetrahedron-assisted electrochemical aptasensor

20.9

~0.5 h

102-109

31

2

Quantum dot-based electrochemical detection

100

~2.5 h

102-107

32

3

Electrochemical sandwich immunosensor

200

~1 h

102-106

24

4

Paper-based aptasensor

1.1 × 103

~0.5 h

1.0 × 104 -1.0 × 108

33

5

B-Chol anchor assay with enzyme-linked HCR

2.2×103

>12 h

2.3×103-2.3×105

19

6

Alternating current electrohydrodynamic (ac-EHD) induced nanoshearing

2.76×103

~2 h

2.76×1034.15×104

34

7

Microﬂuidic-based mobile exosome detector (μMED)

1×104

~1.67 h

104-108

35

8

Aptasensor based on DNAcapped s-SWCNTs

5.2×105

~0.67 h

1.84×1062.21×107

30

9

Lateral flow immunoassay (LFIA)

8.54×105

~0.25 h

9×106-1.44×108

36

Copper-mediated exosome detection

4.8×104

~2 h

7.5×104-1.5×107

Our method

1 0

ASSOCIATED CONTENT Supporting Information This material is available free of charge via the Internet at http://pubs.acs.org. Characterization of exosomes (Figure S1), characterization of CuNPs (Figure S2), CuNPs formation optimization and performance investigation (Figure S3-S5), characterization of MB probe and CuO NP probe (Figure S6 and S7), TEM images of MBs, CuO NPs, and MB-exosome-CuO NP complex (Figure S8), assay optimization and performance investigation (Figure S9-S15, Table S1).

AUTHOR INFORMATION Corresponding Author *Bin-Cheng Yin, [email protected]; Bang-Ce Ye, [email protected].

Author Contributions All authors have given approval to the final version of the manuscript.

Notes The authors declare no competing financial interest.

ACKNOWLEDGMENT This work was jointly supported by the National Natural Science Foundation of China (Grants 21335003, 21675052, 21575089), the Fundamental Research Funds for the Central Universities, the Science Fund for Creative Research Groups (Grant 21421004), and Programme of Introducing Talents of Discipline to Universities (Grant B16017).

REFERENCES

(1) Colombo, M.; Raposo, G.; Thery, C. Annu. Rev. Cell Dev. Biol. 2014, 30, 255. (2) Johnstone, R. M.; Adam, M.; Hammond, J. R.; Orr, L.; Turbide, C. J. Biol. Chem. 1987, 262, 9412. (3) Kowal, J.; Tkach, M.; Thery, C. Curr. Opin. Cell Biol. 2014, 29, 116. (4) Kourembanas, S. Annu. Rev. Physiol. 2015, 77, 13. (5) Balaj, L.; Lessard, R.; Dai, L.; Cho, Y. J.; Pomeroy, S. L.; Breakefield, X. O.; Skog, J. Nat. Commun. 2011, 2, 180. (6) S, E. L. A.; Mager, I.; Breakefield, X. O.; Wood, M. J. Nat. Rev. Drug Discov. 2013, 12, 347. (7) Pitt, J. M.; Charrier, M.; Viaud, S.; Andre, F.; Besse, B.; Chaput, N.; Zitvogel, L. J. Immunol. 2014, 193, 1006. (8) Steinbichler, T. B.; Dudas, J.; Riechelmann, H.; Skvortsova, II Semin. Cancer Biol. 2017, 44, 170. (9) Melo, S. A.; Luecke, L. B.; Kahlert, C.; Fernandez, A. F.; Gammon, S. T.; Kaye, J.; LeBleu, V. S.; Mittendorf, E. A.; Weitz, J.; Rahbari, N.; Reissfelder, C.; Pilarsky, C.; Fraga, M. F.; PiwnicaWorms, D.; Kalluri, R. Nature 2015, 523, 177. (10) Silva, J.; Garcia, V.; Rodriguez, M.; Compte, M.; Cisneros, E.; Veguillas, P.; Garcia, J. M.; Dominguez, G.; Campos-Martin, Y.; Cuevas, J. Gene. Chromosome. Canc. 2012, 51, 409. (11) Runz, S.; Keller, S.; Rupp, C.; Stoeck, A.; Issa, Y.; Koensgen, D.; Mustea, A.; Sehouli, J.; Kristiansen, G.; Altevogt, P. Gynecol. Oncol. 2007, 107, 563. (12) Sheridan, C. Nat. Biotechnol. 2016, 34, 359. (13) Yoshioka, Y.; Kosaka, N.; Konishi, Y.; Ohta, H.; Okamoto, H.; Sonoda, H.; Nonaka, R.; Yamamoto, H.; Ishii, H.; Mori, M.; Furuta, K.; Nakajima, T.; Hayashi, H.; Sugisaki, H.; Higashimoto, H.; Kato, T.; Takeshita, F.; Ochiya, T. Nat. Commun. 2014, 5, 3591. (14) Tauro, B. J.; Greening, D. W.; Mathias, R. A.; Ji, H.; Mathivanan, S.; Scott, A. M.; Simpson, R. J. Methods 2012, 56, 293. (15) Liga, A.; Vliegenthart, A. D.; Oosthuyzen, W.; Dear, J. W.; Kersaudy-Kerhoas, M. Lab. Chip 2015, 15, 2388.


Page 9 of 10 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


(16) Rider, M. A.; Hurwitz, S. N.; Meckes, D. G., Jr. Sci. Rep. 2016, 6, 23978. (17) Mizutani, K.; Terazawa, R.; Kameyama, K.; Kato, T.; Horie, K.; Tsuchiya, T.; Seike, K.; Ehara, H.; Fujita, Y.; Kawakami, K. Anticancer Res. 2014, 34, 3419. (18) Wan, Y.; Cheng, G.; Liu, X.; Hao, S.-J.; Nisic, M.; Zhu, C.-D.; Xia, Y.-Q.; Li, W.-Q.; Wang, Z.-G.; Zhang, W.-L.; Rice, S. J.; Sebastian, A.; Albert, I.; Belani, C. P.; Zheng, S.-Y. Nat. Biomed. Eng. 2017, 1, 0058. (19) He, F.; Liu, H.; Guo, X.; Yin, B. C.; Ye, B. C. Anal. Chem. 2017, 89, 12968. (20) Weng, Y.; Sui, Z.; Shan, Y.; Hu, Y.; Chen, Y.; Zhang, L.; Zhang, Y. Analyst 2016, 141, 4640. (21) Stremersch, S.; Marro, M.; Pinchasik, B. E.; Baatsen, P.; Hendrix, A.; De Smedt, S. C.; Loza-Alvarez, P.; Skirtach, A. G.; Raemdonck, K.; Braeckmans, K. Small 2016, 12, 3292. (22) Zhang, P.; He, M.; Zeng, Y. Lab. Chip 2016, 16, 3033. (23) Im, H.; Shao, H.; Park, Y. I.; Peterson, V. M.; Castro, C. M.; Weissleder, R.; Lee, H. Nat. Biotechnol. 2014, 32, 490. (24) Doldan, X.; Fagundez, P.; Cayota, A.; Laiz, J.; Tosar, J. P. Anal. Chem. 2016, 88, 10466. (25) Thakur, A.; Qiu, G.; Ng, S. P.; Guan, J.; Yue, J.; Lee, Y.; Wu, C. L. Biosens. Bioelectron. 2017, 94, 400. (26) Li, R. D.; Wang, Q.; Yin, B. C.; Ye, B. C. Biosens. Bioelectron. 2016, 77, 995. (27) Mao, Z.; Qing, Z.; Qing, T.; Xu, F.; Wen, L.; He, X.; He, D.; Shi, H.; Wang, K. Anal. Chem. 2015, 87, 7454. (28) Qing, Z.; He, X.; Qing, T.; Wang, K.; Shi, H.; He, D.; Zou, Z.; Yan, L.; Xu, F.; Ye, X.; Mao, Z. Anal. Chem. 2013, 85, 12138. (29) Qing, Z.; Mao, Z.; Qing, T.; He, X.; Zou, Z.; He, D.; Shi, H.; Huang, J.; Liu, J.; Wang, K. Anal. Chem. 2014, 86, 11263. (30) Xia, Y.; Liu, M.; Wang, L.; Yan, A.; He, W.; Chen, M.; Lan, J.; Xu, J.; Guan, L.; Chen, J. Biosens. Bioelectron. 2017, 92, 8. (31) Wang, S.; Zhang, L.; Wan, S.; Cansiz, S.; Cui, C.; Liu, Y.; Cai, R.; Hong, C.; Teng, I. T.; Shi, M.; Wu, Y.; Dong, Y.; Tan, W. ACS Nano 2017, 11, 3943. (32) Boriachek, K.; Islam, M. N.; Gopalan, V.; Lam, A. K.; Nguyen, N.-T.; Shiddiky, M. J. A. Analyst 2017, 142, 2211. (33) Chen, X.; Lan, J.; Liu, Y.; Li, L.; Yan, L.; Xia, Y.; Wu, F.; Li, C.; Li, S.; Chen, J. Biosens. Bioelectron. 2018, 102, 582. (34) Vaidyanathan, R.; Naghibosadat, M.; Rauf, S.; Korbie, D.; Carrascosa, L. G.; Shiddiky, M. J.; Trau, M. Anal. Chem. 2014, 86, 11125. (35) Ko, J.; Hemphill, M. A.; Gabrieli, D.; Wu, L.; Yelleswarapu, V.; Lawrence, G.; Pennycooke, W.; Singh, A.; Meaney, D. F.; Issadore, D. Sci. Rep. 2016, 6, 31215. (36) Oliveira-Rodriguez, M.; Lopez-Cobo, S.; Reyburn, H. T.; Costa-Garcia, A.; Lopez-Martin, S.; Yanez-Mo, M.; CernudaMorollon, E.; Paschen, A.; Vales-Gomez, M.; Blanco-Lopez, M. C. J. Extracell. Vesicles 2016, 5, 31803.



for TOC only


Page 10 of 10

Quantification of Exosome Based on Copper-Mediated Signal

Recommend Documents