Quantification of Relative Gene Dosage by Single-Base Extension and

Anal. Chem. 2005, 77, 6960-6968

Quantification of Relative Gene Dosage by Single-Base Extension and High-Performance Liquid Chromatography: Application to the SMN1/ SMN2 Gene Chia-Cheng Hung,†,¶ Chien-Nan Lee,‡,¶ Chih-Ping Chen,| Yuh-Jyh Jong,⊥,# Chi-An Chen,‡ Wen-Fang Cheng,‡ Win-Li Lin,† and Yi-Ning Su*,§

Institute of Biomedical Engineering, National Taiwan University, Taipei 100, Taiwan, and Department of Medical Genetics, National Taiwan University Hospital, No. 7, Chung-Shan South Road, Taipei, Taiwan

One of the most commonly used techniques for genotyping of single-nucleotide polymorphism (SNP) is detection of single-base extensions (SBEs). We present a new, rapid, simple, and highly reliable method for accurate quantification of SNP variants in a single reaction. Our approach is based on SBE detection coupled with highperformance liquid chromatography (HPLC) quantification. To demonstrate the utility of our approach, we report data to determine the gene dosage for relative amounts of alleles in a homologous gene, allowing detection of mutation causing exon skipping in human SMN genes to determine the ratio between the copy numbers of the SMN1/SMN2 gene. We successfully determined the relative ratio of the SMN1 and SMN2 genes and showed assay characteristics using the SBE reaction coupled with HPLC. This assay approach readily scaled to high parallelization with multiplex SBE reactions in a single sample screened in one analysis. By screening for particular SNP genotypes, this assay can be used to determine the relative gene dosage that correlates highly with the patient’s disease state. The next challenge is to apply this novel methodology in a clinical screening and quantification setting for special gene regions within highly homologous genes. Single-nucleotide polymorphisms (SNPs) are the most common genetic variation in the human genome. SNPs are typically biallelic, occurring on average every thousand base pairs (bp).1-3 * To whom correspondence should be addressed. Phone: +886-2-23123456, ext 6174. Fax: +886-2-23813690. E-mail: [email protected]. † Institute of Biomedical Engineering, National Taiwan University. ‡ Current address: Department of Obstetrics and Gynecology, National Taiwan University Hospital. | Current address: Department of Obstetrics and Gynecology, Mackay Memorial Hospital, Taiwan. ⊥ Current address: Department of Pediatrics, Kaohsiung Medical University Chung-Ho Memorial Hospital. # Current address: Department of Medical Genetics, College of Medicine, Kaohsiung Medical University. § Department of Medical Genetics, National Taiwan University Hospital. ¶ Chia-Cheng Hung and Chien-Nan Lee share the first authorship. (1) Brookes, A. J. Gene 1999, 234, 177-186. (2) Landegren, U.; Nilsson, M.; Kwok, P. Y. Genome Res. 1998, 8, 769-776. (3) Schafer, A. J.; Hawkins, J. R. Nat. Biotechnol. 1998, 16, 33-39.

6960 Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

Because of their great frequency and heritable stability within the human genome, SNPs can be used as genetic markers in linkage and association genetic studies.4 It is important to focus on the detection and analysis of SNPs for human disease genes and pharmacogenetics. Several individual SNPs present in coding regions (cSNPs) are already known to influence gene biological functions and cause several genetic diseases.5 Spinal muscular atrophy (SMA) is the second most frequent autosomal recessive disease with an overall incidence of 1 in 10 000 live births and a carrier frequency of from 1 in 35 to 1 in 50.6-8 It is classified into three types:9 type I SMA (WerdnigHoffmann disease) is the most severe form with an onset in early infancy, type II SMA with intermediate severity, and type III SMA (Kugelberg-Welander disease) is a mild form with onset in late childhood and with patients gaining the ability to walk. This severe neuromuscular disease is caused by homozygous deletion or conversion of at least exons 7 and 8 of the telomeric SMN1 gene in more than 95% of patients,8,10,11 while the remaining cases are related to small deletions or point mutations of the SMN1 gene.12 However, a highly homologous SMN2 gene exists in the same chromosome interval, centromeric to SMN1, and hampers detection of SMN1.12 Only the SMN1 gene is affected in SMA, and there (4) Wang, D. G.; Fan, J. B.; Siao, C. J.; Berno, A.; Young, P.; Sapolsky, R.; Ghandour, G.; Perkins, N.; Winchester, E.; Spencer, J.; Kruglyak, L.; Stein, L.; Hsie, L.; Topaloglou, T.; Hubbell, E.; Robinson, E.; Mittmann, M.; Morris, M. S.; Shen, N.; Kilburn, D.; Rioux, J.; Nusbaum, C.; Rozen, S.; Hudson, T. J.; Lander, E. S.; Lipshutz, R.; Chee, M. Science 1998, 280, 1077-1082. (5) Cargill, M.; Altshuler, D.; Ireland, J.; Sklar, P.; Ardlie, K.; Patil, N.; Shaw, N.; Lane, C. R.; Lim, E. P.; Kalyanaraman, N.; Nemesh, J.; Ziaugra, L.; Friedland, L.; Rolfe, A.; Warrington, J.; Lipshutz, R.; Daley, G. Q.; Lander, E. S. Nat. Genet. 1999, 22, 231-238. (6) Cusin, V.; Clermont, O.; Gerard, B.; Chantereau, D.; Elion, J. J. Med. Genet. 2003, 40, e39. (7) Feldkotter, M.; Schwarzer, V.; Wirth, R.; Wienker, T. F.; Wirth, B. Am. J. Hum. Genet. 2002, 70, 358-368. (8) Ogino, S.; Wilson, R. B. Hum. Genet. 2002, 111, 477-500. (9) Pearn, J. Lancet 1980, 1, 919-922. (10) Wirth, B.; Herz, M.; Wetter, A.; Moskau, S.; Hahnen, E.; Rudnik-Schoneborn, S.; Wienker, T.; Zerres, K. Am. J. Hum. Genet. 1999, 64, 1340-1356. (11) Ogino, S.; Wilson, R. B. Am. J. Hum. Genet. 2002, 70, 1596-1598; author reply 1598-1599. (12) Lefebvre, S.; Burglen, L.; Reboullet, S.; Clermont, O.; Burlet, P.; Viollet, L.; Benichou, B.; Cruaud, C.; Millasseau, P.; Zeviani, M.; Paslier, D. L.; Frzal, J.; Cohen, D.; Weissenbach, J.; Munnich, A.; Melki, J. Cell 1995, 80, 155165. 10.1021/ac0512047 CCC: $30.25

© 2005 American Chemical Society Published on Web 10/04/2005

Table 1. PCR Primers Used and the Genotyping of the SBE Products of the SMN Gene Listed in the HPLC Assay

primer name SMN-F SMN-R SMN-SBE-21 SMN-SBE-30 SMN-SBE-21R

sequence (5′-3′)

primer length (bp)

anneal temp (°C)

TGTCTTGTGAAACAAAATGCTT AAAAGTCTGCTGGTCTGCCTA TTTATTTTCATTACAGGGTTT TTAACTTCCTTTATTTTCATTACAGGGTTT TCCTTCTTTTTGATTTTGTCT

22 21 21 30 21

53 53 43 53 53

are only five nucleotides between SMN1 and SMN2 genes. The SMN2 gene cannot compensate for the SMN1 gene because the mutation at position 6 in exon 7 (c.840C>T) causes exon 7 exclusion.13,14 The difference at this nucleotide position allows the SMN1 gene to be distinguished from the SMN2 gene. Therefore, detection of the absence of SMN1 exon 7 is a useful tool for both pre- and postnatal diagnosis of SMA. At present, a wide variety of methods for SNP genotyping have been developed using different detection techniques15 including allele-specific oligonucleotide hybridization,16,17 allele-specific PCR,18,19 ligation detection reaction assay,20 restriction fragment length polymorphism,21 single-base extension (SBE),22-33 and others.34-36 The SBE method, which is also known as single-nucleotide primer (13) Monani, U. R.; Lorson, C. L.; Parsons, D. W.; Prior, T. W.; Androphy, E. J.; Burghes, A. H.; McPherson, J. D. Hum. Mol. Genet. 1999, 8, 1177-1183. (14) Ogino, S.; Wilson, R. B. Expert Rev. Mol. Diagn. 2004, 4, 15-29. (15) Gut, I. G. Hum. Mutat. 2001, 17, 475-492. (16) Studencki, A. B.; Wallace, R. B. DNA 1984, 3, 7-15. (17) Iitia, A.; Mikola, M.; Gregersen, N.; Hurskainen, P.; Lovgren, T. Biotechniques 1994, 17, 566-573. (18) Myakishev, M. V.; Khripin, Y.; Hu, S.; Hamer, D. H. Genome Res. 2001, 11, 163-169. (19) Morin, P. A.; Saiz, R.; Monjazeb, A. Biotechniques 1999, 27, 538-540, 542, 544 passim. (20) Borodina, T. A.; Lehrach, H.; Soldatov, A. V. Anal. Biochem. 2004, 333, 309-319. (21) Lyamichev, V.; Mast, A. L.; Hall, J. G.; Prudent, J. R.; Kaiser, M. W.; Takova, T.; Kwiatkowski, R. W.; Sander, T. J.; de Arruda, M.; Arco, D. A.; Neri, B. P.; Brow, M. A. Nat. Biotechnol. 1999, 17, 292-296. (22) Syvanen, A. C. Hum. Mutat. 1999, 13, 1-10. (23) Pastinen, T.; Partanen, J.; Syvanen, A. C. Clin. Chem. 1996, 42, 13911397. (24) Li, Z. P.; Tsunoda, H.; Okano, K.; Nagai, K.; Kambara, H. Anal. Chem. 2003, 75, 3345-3351. (25) Kobayashi, M.; Rappaport, E.; Blasband, A.; Semeraro, A.; Sartore, M.; Surrey, S.; Fortina, P. Mol. Cell. Probes 1995, 9, 175-182. (26) Gerard, B.; Ginet, N.; Matthijs, G.; Evrard, P.; Baumann, C.; Da Silva, F.; Gerard-Blanluet, M.; Mayer, M.; Grandchamp, B.; Elion, J. Hum. Mutat. 2000, 16, 253-263. (27) Piggee, C. A.; Muth, J.; Carrilho, E.; Karger, B. L. J. Chromatogr., A 1997, 781, 367-375. (28) Hoogendoorn, B.; Owen, M. J.; Oefner, P. J.; Williams, N.; Austin, J.; O’Donovan, M. C. Hum. Genet. 1999, 104, 89-93. (29) Devaney, J. M.; Pettit, E. L.; Kaler, S. G.; Vallone, P. M.; Butler, J. M.; Marino, M. A. Anal. Chem. 2001, 73, 620-624. (30) Schultz, G. A.; Corso, T. N.; Prosser, S. J.; Zhang, S. Anal. Chem. 2000, 72, 4058-4063. (31) Zhang, S.; Van Pelt, C. K.; Schultz, G. A. Anal. Chem. 2001, 73, 21172125. (32) Mengel-Jorgensen, J.; Sanchez, J. J.; Borsting, C.; Kirpekar, F.; Morling, N. Anal. Chem. 2004, 76, 6039-6045. (33) Li, J.; Butler, J. M.; Tan, Y.; Lin, H.; Royer, S.; Ohler, L.; Shaler, T. A.; Hunter, J. M.; Pollart, D. J.; Monforte, J. A.; Becker, C. H. Electrophoresis 1999, 20, 1258-1265. (34) Kerman, K.; Saito, M.; Morita, Y.; Takamura, Y.; Ozsoz, M.; Tamiya, E. Anal. Chem. 2004, 76, 1877-1884. (35) Long, Y. T.; Li, C. Z.; Sutherland, T. C.; Kraatz, H. B.; Lee, J. S. Anal. Chem. 2004, 76, 4059-4065.

PCR/SBE product length (bp)

SBE product SMN1 gene

SMN2 gene

ddC ddC ddG

ddT ddT ddA

460 22 31 22

extension or minisequencing, is the most widely used strategy for SNP typing because it has higher specificity in distinguishing between sequence variants at an SNP site in a one-tube reaction.37 This method was modified to allow the simultaneous detection of all four possible bases in one tube.38 In this technique, a DNA fragment containing the SNPs of interest is amplified, and an SBE oligonucleotide primer is designed that anneals to the template sequence immediately adjacent to the polymorphic site. This method is based on the 3′ end of the SBE primer being specifically extended by a single dideoxynucleotide (ddNTP) complementary to the mutation site of interest to be genotyped with a DNA polymerase. The SBE primer is only extended one base because the ddNTP acts as a terminator in the extension reaction. The high specificity of single ddNTP incorporation makes the SBE reaction an ideal tool for quantitative SNP analysis.33 Since the advent of SBE for the identification of genetic disease, several new techniques to detect the extension products have been developed including gel-based fluorescent detection,23,24 capillary gel electrophoresis,25-27 HPLC,28,29 and matrix-assisted laser desorption ionization time-of-flight.30-33 Most of these assays rely on detection of fluorescence. While there are many devices and systems for SNP in SBE analysis, there are few methods for quantification of gene dosage. High-performance liquid chromatography (HPLC) is a novel, simple, fast, highly reliable, nongelbased, and nonfluorescence-based method that has proven to be a promising tool due to its sensitivity and specificity in the detection of variations in DNA by ion-pair, reversed-phase liquid chromatography.39 In contrast to all existing SBE genotyping tools, HPLC provides a detection platform that is not labeled with a fluorescent tag in either the SBE primers or ddNTPs. We present the new methodology of using an SBE quantitative assay coupled with HPLC for accurate determination of relative gene dosage. Relative quantification of allele-specific SBE reactions allows accurate determination of the initial ratio of the corresponding template sequences. Traditionally, quantitative SBE analyses have been performed using fluorescence-based methods that require relatively expensive assay kits.26 We optimized and automated our protocol to analyze the relative ratio of the SMN genes (SMN1/SMN2) by SBE reaction of the four different ddNTPs with detection and quantification of the SBE products by HPLC. We describe the application of this method for gene (36) Ahmadian, A.; Gharizadeh, B.; Gustafsson, A. C.; Sterky, F.; Nyren, P.; Uhlen, M.; Lundeberg, J. Anal. Biochem. 2000, 280, 103-110. (37) Sokolov, B. P. Nucleic Acids Res. 1990, 18, 3671. (38) Nikiforov, T. T.; Rendle, R. B.; Goelet, P.; Rogers, Y. H.; Kotewicz, M. L.; Anderson, S.; Trainor, G. L.; Knapp, M. R. Nucleic Acids Res. 1994, 22, 4167-4175. (39) Xiao, W.; Oefner, P. J. Hum. Mutat. 2001, 17, 439-474.

Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

6961

Figure 1. (a) Sequence and consist of the SMN1 gene and (b) the position of the SNPs sites in the SMN gene.

dosage determination of genomic DNA. We also describe a novel multiplex SBE assay strategy using different-sized primers in order to simultaneously screen for the main mutations in SMN genes and to calculate the ratio of copy numbers of SMN1 and SMN2 genes. EXPERIMENTAL SECTION DNA Extraction. DNA samples from all SMA patients and normal individuals were obtained from National Taiwan University Hospital. A total of 137 DNA samples were analyzed in this study, including 17 patients previously diagnosed with SMA and 120 individuals from the general population. Genomic DNA was collected from peripheral whole blood using a Puregene DNA Isolation Kit (Gentra Systems, Inc., Minneapolis, MN), according to the manufacturer’s instructions. Polymerase Chain Reaction. To amplify SMN1/SMN2 genes including the mutation site of interest, we used the PCR primers as described in Table 1. PCR for the provided DNA fragments was performed in a total volume of 25 µL containing 100 ng of genomic DNA, 0.12 µM of each primer, 100 µM of dNTPs, 0.5 units of AmpliTaq Gold enzyme (PE Applied Biosystems, Foster City, CA), and 2.5 µL of GeneAmp 10× buffer II (10 mM TrisHCl, pH ) 8.3, 50 mM KCl), in 2 mM MgCl2, as provided by the manufacturer. Amplification was performed in a multiblock system (MBS) thermocycler (ThermoHybaid, Ashford, U.K.). PCR amplification was performed with an initial denaturation step at 95 °C for 10 min, followed by 35 cycles consisting of denaturation at 6962 Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

Figure 2. HPLC chromatographic analysis for PCR products of (a) an individual with a gene ratio of SMN1/SMN2 ) 1, (b) an individual with a gene ratio of SMN1/SMN2 ) 1:2, (c) an individual with a gene ratio of SMN1/SMN2 ) 1:3, (d) an individual with a gene ratio of SMN1/SMN2 ) 2:1, (e) an individual with a gene ratio of SMN1/SMN2 ) 3:1, (f) an individual with an SMN1 gene only, and (g) an individual with an SMN2 gene only.

94 °C for 30 s, annealing at 53 °C for 45 s, extension at 72 °C for 45 s, and then a final extension step at 72 °C for 10 min.

Figure 3. HPLC chromatography and sequence analysis for PCR products of (a) an individual with a gene ratio of SMN1/SMN2 ) 1 without any further SNPs, (b) an individual with a gene ratio of SMN1/SMN2 ) 3:1 with a c.835-50 SNP of SMN1, and (c) an individual with an SMN1 gene only with a c.835-50 SNP of SMN1.

Purification of PCR Products. For single-base extension analysis, PCR products were treated with the Microcon YM-100 Kit (Millipore Corp., Bedford, MA) to remove unincorporated primers and dNTPs, and then the purified PCR products were subsequently used for the single-base extension reactions. The quantity of PCR products was determined using the GeneQuant Pro spectrophotometer (Amersham Pharmacia Biotech, Piscataway, NJ), with the samples being diluted to a final concentration of 10 ng/µL of DNA. SBE Reactions. The SBE primers were used to detect the mutation cause of SMA at position 6 in exon 7 (c.840C>T) of the SMN gene that causes exon 7 exclusion, the details of which are described in Figure 1. Single-base extension reactions were performed in a volume of 20 µL containing 50 ng input PCR product and 0.75 µM of SBE primer, 25 µM of each of the ddNTPs (Amersham Pharmacia Biotech), 0.5 units of ThermoSequenase DNA polymerase (Amersham Pharmacia Biotech), and 2 µL of 10× reaction buffer (260 mM Tris-HCl, pH ) 9.5, 65 mM MgCl2) provided by the manufacturer. The reaction was performed in a MBS thermocycler (ThermoHybaid) with an initial denaturation

step at 96 °C for 60 s, followed by 50 cycles of 96 °C for 15 s, 43 °C for 15 s, and 60 °C for 100 seconds, and finally 96 °C for 30 s. The nucleotide compositions and product lengths for the primer extension reactions are listed in Table 1. For multiplex singlebase extension reactions, the primer lengths were modified in order to attain a better level of resolution, and the annealing temperature was modified slightly to 53 °C. HPLC Analysis. Mutation screening was performed using a Transgenomic Wave nucleic acid fragment analysis system (Transgenomic Inc., San Jose, CA) with a C18 reversed-phase column, using 2 µm nonporous polystyrene/divinylbenzene) particles (DNASep column, Transgenomic Inc.). PCR products were analyzed with linear acetonitrile gradient and triethylammonium acetate as mobile phases by using buffer A (0.1 M TEAA, trietil ammonio acetato) and buffer B (0.1 M TEAA with 25% acetonitrile) (WAVE Optimized, Transgenomic Inc.). The starting and ending points of the gradient were adjusted according to the size of the PCR products using the algorithm provided by WAVE MAKER system control software (version 4.1; Transgenomic Inc.). DNA molecules that eluted from the column were detected by Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

6963

Figure 4. The flowchart of the SBE assay analyzed by HPLC.

scanning with a UV detector at 260 nm using an autosampler with the capacity to handle 192 samples. For heteroduplex detection, crude PCR products were subjected to an additional 5 min 95 °C denaturing step, followed by gradual reannealing from 95 to 25 °C over a period of 70 min. The start and end points of the gradient were 57% B and 66% B in 4.5 min. A total of 20 µL of PCR product was injected for analysis in each run. The samples were run under partially denaturing conditions at 52.5 °C according to the nature of each amplicon as indicated by the WAVE MAKER system control software (Transgenomic Inc.). For single-base extension analysis, 15 µL of single-base primer extension reaction product was loaded into a DNASep column. HPLC was performed with a column temperature of 75 °C with a flow rate of 0.9 mL/min. The start and end points of the gradient were 20% B and 44% B in 12 min for either simplex or multiplex reactions. RESULTS AND DISCUSSION PCR-Coupled HPLC Assay. HPLC is a promising tool for nucleic acid separation.40,41 We developed a powerful and rapid PCR-HPLC assay for detection of SMA carrier and homozygous deletion/conversion status for which the assay characteristics follow.42 This novel methodology increases the sensitivity of SMA diagnosis and allows for direct carrier testing. The assay can be used for quantification of the SMN1 and SMN2 genes in the (40) Premstaller, A.; Oefner, P. J.; Oberacher, H.; Huber, C. G. Anal. Chem. 2002, 74, 4688-4693. (41) Premstaller, A.; Oberacher, H.; Huber, C. G. Anal. Chem. 2000, 72, 43864393. (42) Su, Y. N.; Hung, C. C.; Li, H.; Lee, C. N.; Cheng, W. F.; Tsao, P. N.; Chang, M. C.; Yu, C. L.; Hsieh, W. S.; Lin, W. L.; Hsu, S. M. Hum. Mutat. 2005, 25, 460-467.

6964

Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

general population (Figure 2). The method, which is based on analysis of PCR products, encompasses 4 out of the 5 nucleotide differences by which the SMN1 gene can be distinguished from the SMN2 gene (Figure 1B). The HPLC retention times for the analysis allow differentiation of the SMN1 peak at 5.0 min and the SMN2 peak at 4.8 min. While this is a simple and novel approach, either SMN1 or SMN2 can contain one or more SNPs (c.835-50), which would affect the results. In addition, hybrid or fused SMN genes arise through gene conversion and can contain one, two, three, or four base pair differences for SMN1 and the remainder of SMN, or vice versa. The variable DNA content affects the HPLC running conditions and the melting peaks at various temperatures. This results in another peak at 5.2 min (Figure 3), and thus, failure to quantify the gene dosage between SMN1 and SMN2 in such condition. To resolve this problem, we developed another strategy to detect the SNP sites directly for gene quantification. SBE for SNP Analysis. SBE, single-nucleotide primer extension or minisequencing, has been used many researchers for SNP analysis.23-33,43 It is relatively fast and accurate. The SBE assays coupled with HPLC are shown in Figure 4. After genomic DNA is extracted from peripheral whole blood, the template is a 460 bp fragment generated from PCR amplification of the SMN gene using the appropriate forward and reverse primers. The mutation site of the SMN gene (c.840C>T) lies immediately adjacent to the 3′ end of the SBE primer, which is extended one base by ddNTPs. Finally, HPLC is used to analyze the SBE products for quantitation of the SMN1 and SMN2 genes. The illustrated technique can be used for screening and quantifying samples for a known mutation of interest. (43) Brazill, S. A.; Kuhr, W. G. Anal. Chem. 2002, 74, 3421-3428.

Figure 5. HPLC chromatography and sequence analysis for SBE products of (a) an individual with a gene ratio of SMN1/SMN2 ) 1, (b) an individual with the SMN1 gene only, and (c) an individual with the SMN2 gene only.

The SBE reaction is similar to PCR, except that ddNTPs are used. As shown in Figure 1a, the mutation sites are labeled in blue and the primer is labeled in purple. The c.840C>T site is identical to SBE reaction, and the nucleotides incorporated in our system are the bases cytosine and thymine. This DNA polymerase effectively incorporates the ddNTPs with similar efficiency compared to dNTPs.44 The accuracy of this method lies in the high fidelity of DNA polymerase to only incorporate the complementary base. SBE-Coupled HPLC. Several SBE strategies have been developed for HPLC,28,29 and almost all of them are designed to overcome the problem of distinguishing between different alleles. In the present study, we improved on differentiating known mutations by using the SBE assay and coupling it with HPLC, compared to the very short extension (VSET) assay and PinPoint assay.45 By using the PinPoint assay with ddNTPs, we were able to accurately determine the SNP allele of SBE products by their (44) Dubiley, S.; Kirillov, E.; Mirzabekov, A. Nucleic Acids Res. 1999, 27, e19. (45) Su, Y. N.; Lee, C. N.; Hung, C. C.; Chen, C. A.; Cheng, W. F.; Tsao, P. N.; Yu, C. L.; Hsieh, F. J. Hum. Mutat. 2003, 22, 326-336.

different retention times. Additionally, we developed a multiplex SBE protocol for the detection of common β-thalassemia mutations. With the use of the HPLC platform, two SBE products of the same length can be easily separated. Furthermore, we improved the sensitivity of single-base primer extension analysis by using a fluorescence-enhanced detection system.46 Our interest in SMN genotyping was to develop a highly efficient and inexpensive genotyping method. While quantifying the relative DNA fragments by SNP assay with HPLC is difficult, relatively small differences of small DNA fragments can be determined sufficiently accurately by verification of the nucleotide composition. Therefore, the advantages of speed, low cost, and ease of automation make HPLC ideal for the analysis of SBE products. We used this method for detecting SMN1 deletion/ conversion and for further determining the relative copy numbers of the SMN1 and SMN2 genes. For the SMN gene (SMN1 and SMN2) assay using HPLC, SBE products were constituted by SBE primers and extended with (46) Su, Y. N.; Lee, C. N.; Chien, S. C.; Hung, C. C.; Chien, Y. H.; Chen, C. A. J. Hum. Genet. 2004, 49, 399-403.

Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

6965

Figure 6. HPLC chromatography analyzed for SBE products of (a) unextended primer only, (b) an individual with a gene ratio of SMN1/SMN2 ) 1, (c) an individual with a gene ratio of SMN1/SMN2 ) 1:2, (d) an individual with a gene ratio of SMN1/SMN2 ) 1:3, (e) an individual with a gene ratio of SMN1/SMN2 ) 2:1, (f) an individual with a gene ratio of SMN1/SMN2 ) 3:1, (g) an individual with an SMN1 gene only, and (h) an individual with an SMN2 gene only.

ddNTPs. Both SMN1 and SMN2 extension products were the same in length, yet were clearly resolved by HPLC. The only difference between the extension products was the presence of a different ddNTP at the final base position. When TEAA was used as an ion-pairing reagent, the retention time for the oligonucleotides was affected by both the size and composition of the singlestranded DNA fragments.29 In our experiment, the retention time for the SBE products correlated to the hydrophobic nature of the ddNTPs. We predicted that the retention time of SMN1 would be shorter than for SMN2 because the elution order is C < G < A < T at a column temperature of 70 °C.29 By comparing known SBE products for SMN1 and SMN2, we distinguished between SMN1 and SMN2 peaks using HPLC. With our experiments, the retention time of the unextended primer was 7.9 min, that of SMN1 was 8.1 min, and that of SMN2 was 8.7 min. These results are comparable to those of others for elution order (C < T) of oligonucleotides.29 We identified SMA in affected patients efficiently and sensitively by recognizing the SMN2-only peak with HPLC. Therefore, for each example of a chromatogram from SBE analysis, the first peak corresponded to the unextended SBE primer and always presented the same retention time in each chromatogram. There were two extended peaks that were identified for individuals with SMN1/SMN2: the middle peak referred to the SMN1 gene and 6966 Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

the last peak referred to the SMN2 gene. These results were confirmed by direct sequencing (Figure 5), even though direct sequencing failed to quantify the relative gene dosage. Quantification of SMN Genes. Many analytical methods for the quantification of the gene dosage have been developed.26,47,48 The copy numbers of SMN1 and SMN2 genes were determined by SBE reaction to amplify the mutation at position 6 in exon 7 (c.840C>T). After amplification, the SBE products were assayed using HPLC to differentiate the SMN1 from the SMN2 gene. To quantify each PCR product, we measured the peak height and area of each SMN gene using the WAVE MAKER software to label the peak height and area automatically. The copy numbers of SMN1 and SMN2 genes were then calculated based on the ratio of SMN1 to SMN2 by peak area. At oven temperatures of 75 °C, the equal and unequal SMN1/ SMN2 gene dosages could be differentiated (Figure 6) and were compatible with gene dosages determined by quantitative realtime PCR analysis.49 To test the validity and reproducibility of our detection system for relative gene dosage determination of the (47) Matyas, G.; Giunta, C.; Steinmann, B.; Hossle, J. P.; Hellwig, R. Hum. Mutat. 2002, 19, 58-68. (48) Schwartz, M.; Sorensen, N.; Hansen, F. J.; Hertz, J. M.; Norby, S.; Tranebjaerg, L.; Skovby, F. Hum. Mol. Genet. 1997, 6, 99-104. (49) Anhuf, D.; Eggermann, T.; Rudnik-Schoneborn, S.; Zerres, K. Hum. Mutat. 2003, 22, 74-78.

Table 2. Different SMN1/SMN2 Ratios Calculated and Analyzed by HPLC genotype (SMN1/SMN2)

measured SMN1/SMN2 ratio by peak height (mean ( SD)

measured SMN1/SMN2 ratio by peak area (mean ( SD)

interpretation

number of subjects

status

1:1 1:2 1:3 2:1 3:1 SMN1 only SMN2 only

1.07 ( 0.06 0.57 ( 0.04 0.38 ( 0.03 1.90 ( 0.13 2.82 ( 0.19 no SMN2 peak no SMN1 peak

1.01 ( 0.09 0.52 ( 0.05 0.36 ( 0.03 1.94 ( 0.12 2.88 ( 0.17 no SMN2 peak no SMN1 peak

1 0.5 0.33 2 3 ∞ 0

44 20 18 14 11 13 17

normal SMA carrier SMA carrier normal normal normal SMA affected

Figure 7. The different observed SMN1/SMN2 ratio values vs the theoretical SMN1/SMN2 ratio are approximate to ones (mean ratio ( SD) (a) measured by peaks height and (b) measured by peaks area.

SMN1/SMN2 genes, we analyzed every sample in triplicate, and all demonstrated reproducible results. Standard deviations of the observed gene ratios are listed in Table 2. Different samples were run corresponding to the expected ratio: R(SMN1/SMN2) ) 0, 0.33, 0.5, 1, 2, 3, ∞. Figure 7 shows a linear relationship between the observed and theoretical SMN1/SMN2 ratios. For individuals from the normal population, the ratios of SMN1/SMN2 copy numbers by the measured peak height and area are listed in Table 2. The peak ratio was 1.01 ( 0.09 for the wild type with four gene copies (2-SMN1/2-SMN2), 2.88 ( 0.17 for the wild type with four copies (3-SMN1/1-SMN2), 1.94 ( 0.12 for the wild type with three copies (2-SMN1/1-SMN2), 0.36 ( 0.03 for the carrier with four copies (1-SMN1/3-SMN2), and 0.52 ( 0.05 for the carrier with three copies (1-SMN1/2-SMN2). We also calculated the copy numbers by peak height and compared it with the data for peak area; both had similar tendency. Our screening approach could be reliably and easily used in the clinical setting for direct detection of SMA carriers. We assumed that the SMN1/SMN2 ratio of 1 is two copies of SMN1 and two copies of SMN2. However, some individuals with equal SMN1 and SMN2 dosage are carriers. According to Ogino et al.,50 some individuals with SMN1/SMN2 ratios of 1 in the general populations are carriers (1-SMN1/1-SMN2). These data suggest that close to 2% of individuals with SMN1/SMN2 ratios of 1 are carriers. Similarly, some individuals with only SMN1 but no SMN2 are carriers (1-SMN1/0-SMN2). These data suggest that about 3% of individuals with only SMN1 are carriers.50 Using our approach, we did not determine the absolute copy numbers of SMN1 and SMN2. Accordingly, we would miss some carriers who would not be missed by other dosage analyses described by many (50) Ogino, S.; Wilson, R. B.; Gold, B. Eur. J. Hum. Genet. 2004, 12, 10151023.

other investigators.7,10,11,26,49,51-57 Nonetheless, the purpose of our report is to characterize a new methodology as an accessory tool for gene dosage analysis. Although there are many assays that can determine the absolute gene dosage of SMN1/SMN2, some produce indeterminate results. Therefore, if we can determine the gene dosage of SMN1/SMN2 using a combination of different methods, we believe that this makes gene dosage detection more powerful and accurate. Multiplex Single-Base Extension. Recently, multiplex singlebase extension assays have been reported in many publications.58-62 It is well-known that HPLC separates DNA oligonucleotides based (51) Ogino, S.; Gao, S.; Leonard, D. G.; Paessler, M.; Wilson, R. B. Eur. J. Hum. Genet. 2003, 11, 275-277. (52) van der Steege, G.; Grootscholten, P. M.; van der Vlies, P.; Draaijers, T. G.; Osinga, J.; Cobben, J. M.; Scheffer, H.; Buys, C. H. Lancet 1995, 345, 985986. (53) Ogino, S.; Leonard, D. G.; Rennert, H.; Gao, S.; Wilson, R. B. J. Mol. Diagn. 2001, 3, 150-157. (54) McAndrew, P. E.; Parsons, D. W.; Simard, L. R.; Rochette, C.; Ray, P. N.; Mendell, J. R.; Prior, T. W.; Burghes, A. H. Am. J. Med. Genet. 1997, 60, 1411-1422. (55) Chen, K. L.; Wang, Y. L.; Rennert, H.; Joshi, I.; Mills, J. K.; Leonard, D. G.; Wilson, R. B. Am. J. Med. Genet. 1999, 85, 463-469. (56) Scheffer, H.; Cobben, J. M.; Mensink, R. G.; Stulp, R. P.; van der Steege, G.; Buys, C. H. Eur. J. Hum. Genet. 2000, 8, 79-86. (57) Semprini, S.; Tacconelli, A.; Capon, F.; Brancati, F.; Dallapiccola, B.; Novelli, G. Genet. Test. 2001, 5, 33-37. (58) Wang, W.; Kham, S. K.; Yeo, G. H.; Quah, T. C.; Chong, S. S. Clin. Chem. 2003, 49, 209-218. (59) Sanchez, J. J.; Borsting, C.; Hallenberg, C.; Buchard, A.; Hernandez, A.; Morling, N. Forensic Sci. Int. 2003, 137, 74-84. (60) Revillion, F.; Verdiere, A.; Fournier, J.; Hornez, L.; Peyrat, J. P. Clin. Chem.2004, 50, 203-206. (61) Vreeland, W. N.; Meagher, R. J.; Barron, A. E. Anal. Chem. 2002, 74, 43284333. (62) Knaapen, A. M.; Ketelslegers, H. B.; Gottschalk, R. W.; Janssen, R. G.; Paulussen, A. D.; Smeets, H. J.; Godschalk, R. W.; Van Schooten, F. J.; Kleinjans, J. C.; Van Delft, J. H. Clin. Chem. 2004, 50, 1664-1668.

Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

6967

design of primers with similar annealing temperatures and different chain lengths is difficult. Thus, one must seek a balance between similar annealing temperatures and maximize the difference in the retention time. The primers modified for the multiplex SBE reaction are labeled orange as shown in Figure 1a. In the multiplex reaction, the retention time of the unextended SMNPE-21R primer was 7.4 min, the SMN1 peak was at 8.0 min, and the SMN2 peak was at 8.5 min; the retention time of the unextended SMN-PE-30 primer was 9.4 min, the SMN1 peak was at 9.6 min and the SMN2 peak was at 10.0 min. The results of SMN1/SMN2 ratio by multiplex SBE reaction were coincident with the singleplex reaction (Figure 8).

Figure 8. HPLC chromatography analyzed for multiplex SBE products of (a) unextended primers, (b) an individual with a gene ratio of SMN1/SMN2 ) 1, (c) an individual with a gene ratio of SMN1/ SMN2 ) 1:2, (d) an individual with a gene ratio of SMN1/SMN2 ) 1:3, (e) an individual with a gene ratio of SMN1/SMN2 ) 2:1, (f) an individual with a gene ratio of SMN1/SMN2 ) 3:1, (g) an individual with an SMN1 gene only, and (h) an individual with an SMN2 gene only.

on their molecular weight and chain length. In multiplex SBE for SNP genotyping, SBE primers need to have different chain lengths. Furthermore, to perform optimal multiplex SBE reactions, the multiple SBE primers have to be designed with similar annealing temperatures and to allow similar efficiencies of different primers in one tube. It is necessary to design the primers to have different retention times according to primer length so that the primers and SBE products do not overlap. Since the annealing temperature of a primer corresponds to the primer length, the

6968 Analytical Chemistry, Vol. 77, No. 21, November 1, 2005

CONCLUSIONS The most important advantages of this novel method are that the SBE detection coupled with HPLC equipment uses nonfluorescence-labeled primers or ddNTPs and is a nongel-based protocol. Furthermore, HPLC has advantages of accuracy, high resolution, semiautomation, and rapid analysis. Therefore, it is a good methodology for quantification of relative gene dosage by SBE. We believe that this technique will be especially applicable for clinical screening of genetic diseases in which the gene dosage has a high correlation with disease state. Finally, we can apply this methodology to special gene regions where highly homologous genes exist in the genome, such as with spinal muscular dystrophy, R-thalassemia, and others. ACKNOWLEDGMENT This work was supported by Grants from the National Science Council of Taiwan (NSC 94-2314-B-002-193) and National Taiwan University Hospital (NTUH 93A11-1). Received for review July 7, 2005. Accepted August 13, 2005. AC0512047