Chem. Res. Toxicol. 1994, 7,420-427
420
Reaction with DNA and Mutagenic Specificity of syn-Benzo[g]chrysene 11,12-Dihydrodiol 13,14-Epoxide Jan Szeliga,? Hongmee Lee,$ Ronald G. Harvey,$ John E. Page,? Helen L. ROSS,~ Michael N. Routledge,t Bruce D. Hilton,§ and Anthony Dipple'9t Chemistry of Carcinogenesis Laboratory, ABL-Basic Research Program, Chemical Synthesis and Analysis Laboratory, PRI, DynCorp, Inc., NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21701, and Ben May Institute, University of Chicago, Chicago, Illinois 60637 Received December 20, 1993" The spectroscopic characterization of purine deoxyribonucleoside adducts derived from the and the mutagenic specificity fjord-region syn-benzo[glchrysene 11,12-dihydrodiol13,14-epoxide of the latter compound for the supF gene in the pSP189 shuttle vector are described. This dihydrodiol epoxide preferentially forms adducts with deoxyadenosine residues in DNA and is preferentially opened trans in reactions with DNA or with deoxyribonucleotides. In common with other fjord-region syn-dihydrodiol epoxides, the most frequently observed mutational changes were A T and G T changes. This hydrocarbon dihydrodiol epoxide is structurally similar to syn-benzo[clphenanthrene3,4-dihydrodiol1,2-epoxide but has a n additional benzene ring annelated distant from the reaction center. As anticipated, there were some common features in the chemistry and mutagenicities of these two compounds, but there were also substantive differences which indicate factors of importance in controlling reactions of these kinds of compounds with DNA.
-
-
Introduction Polycyclic aromatic hydrocarbons are responsible for the carcinogenic properties of coal tar (11, and their biological action is mediated, in turn, by vicinal dihydrodiol epoxide metabolites (2)in which the epoxide is in a sterically hindered site, commonly a bay region (3). The reactions of such dihydrodiol epoxides with DNA have been subject to intensive investigation (reviewed in refs 4-7), yet because of the variety of structure possible, a comprehensive understanding of all aspects of these reactions has not yet been obtained. At present, it is clear that polycyclic aromatic hydrocarbon dihydrodiol epoxides aralkylate the amino groups of the bases in DNA, followingthe chemistry first described for 7-(bromomethyl)benz[a]anthracene (8). For some anti-dihydrodiol epoxides such as that derived from the planar benzo[a]pyrene, the amino group of guanine is the almost exclusive site of reaction in DNA (91, whereas for anti-dihydrodiol epoxides derived from the nonplanar 7,lBdimethylbenz[al anthracene or benzo[cl phenanthrene, comparable extents of reaction with both adenine and guanine residues in DNA were found (10-13). The lack of planarity in the latter cases arises from steric hindrance in the bay regions, and for these compounds, one enantiomer of the syn-dihydrodiol epoxide reacts almost exclusively with adenine residues in DNA (12, 14, 15). The dihydrodiol epoxides derived from benzo[clphenanthrene, which has a sterically hindered fjord region, show unusually high tumorigenic activities (16). One enantiomer of the anti-dihydrodiol epoxide is the most potent tumor initiator among the dihydrodiol epoxides tested to date, and, in contrast to syn-dihydrodiolepoxides t ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center. t Ben May Institute. I PRI, DynCorp, Inc., NCI-Frederick Cancer Research and Development Center. 0 Abstract published in Advance ACS Abstracts, April 1, 1994.
from nonhindered hydrocarbons, one of the enantiomers of the syn-dihydrodiol epoxide of benzo[clphenanthrene also has potent tumor-initiating activity (16). To extend our investigations of fjord-region hydrocarbons and the chemistry of adduct formation by dihydrodiol epoxides, we have now undertaken studies of adduct formation and mutagenic specificity of the racemic syn-11,12-dihydrodiol 13,14-epoxide of benzo[glchrysene (1) (17, 18). This hydrocarbon derivative is known to be mutagenic and highly reactive toward DNA (18, 19). I t has the same structure as the benzo[clphenanthrene derivative except it carries an additional benzene ring allowing the effect of this substituent on chemical and biological properties to be evaluated.
Materials and Methods Racemic syn-benzo[glchrysene ll,l2-dihydrodiol 13J4-e~oxide was prepared as described elsewhere.* Calf thymus DNA,
deoxyribonucleotides, and enzymes were all obtained commercially and used without further purification.
CD spectra were measured on a Jasco Model J500A spectropolarimeterequipped with a data processing system for signal averaging. CD spectra of nucleoside adducts in methanol were normalized to 1.0absorbance unit at A-. Ultraviolet absorption spectra were recorded with a Milton Roy spectronic 3000 diode array spectrophotometerand were also monitored on-line with a Hewlett-Packard Model 1090 Series I1 high-pressure liquid chromatographequipped with a diode array detector. Proton NMR spectra of acetylated tetraols and adducts were obtained using a Varian VXR-SOOSspectrometerwith an indirect detection 2.5-mm probe (Nalorac, Inc., Martinez, CA). Proton acquisitiontimes were 1h or less. Proton spectra of peracetates of deoxyguanosine adducts and of tetraols were recorded at 27 "C whereas those for deoxyadenosine adduct peracetates were Harvey et al., in preparation.
0893-228~/94/2707-0420~04.50/0 0 1994 American Chemical Society
Chem. Res. Toxicol., Val. 7,No. 3, 1994 421
DNA Reactions of Benzo[g]chrysene Diol Epoxide recorded at -20 O C . COSY2 homonuclear 2D spectraand NOESY or transverse ROESY spectra (20) were obtained by acquiring for up to 16 h. For the deoxyadenosine adducts a reduced temperature of either 5 or -5 'C was used. DNA Adduct Formation and Isolation. Reactions with calf thymus DNA and with deoxyadenylic and deoxyguanylic acids were essentially as described previously (9) except that in the present studiesethyl acetate was used to extract dihydrodiol epoxide hydrolysis products from nucleotide reactions and nucleotides were used at 40 mg/mL. Adduct Separation. All deoxyribonucleoside adducts and tetraols were separated initially on a Beckman Ultrasphere ODS column (5pm, 4.6 X 250 mm) eluted withvarioussolvent systems. Tetraols were recovered from the ethyl acetate extractsand were separated isocratically with 30% acetonitrile in water to yield a trans-opened tetraol at 14 min and a cis-opened tetraol at 21 min. For isolation of sufficientadducts for CD and NMR studies, products were pooled from many separate runs. The four deoxyadenosine adducts were separated in a gradient system that changed linearly from 25% acetonitrile in water to 12% acetonitrile/bO%methanol in water over 50 min. Retention times for the four adducts were 26, 29, 36, and 39 min. The deoxyguanosine adducts were separated in two steps. Initially, an isocratic elution with 24% acetonitrile in water gave two adducts as a single peak at 19 min and two individual adducts at 28 and 30 min. The pooled peak at 19 min was then concentratedand separated into individualadducts at 53 and 58 min by isocratic elution in 18% tetrahydrofuran in water. For NMR studies,the individual tetraols and adductswere acetylated (9)and further purified on a normal-phase DuPont Zorbax SIL column (5 pm, 4.6 X 250 mm) using 5% ethyl acetate in dichloromethane for the tetraol tetraacetates and using 90 % methanol/ethyl acetate/dichloromethane [(1:1584)for deoxyadenosine peracetates and (5:1481) for deoxyguanosine peracetates]. Polymerase Arrest Assay. These studies on pSP189 DNA were carried out as described earlier (21). pSP189 DNA (10 pg) in 90 pL of buffer was treated with racemic dihydrodiol epoxide (50 ng/pg of DNA). Primers used were 5'-AAAAAATCCTTACGTTTCGC-3' complementary to the sequencebetween 212 and 230 in the pBR 327 origin of replication and 5'-GAATTCGAGAGCCCTGCTCG-3'representingthe sequence between 73 and 102 in the supF gene. Mutation Studies. These studieswere undertaken following the procedures described earlier for benzo[c]phenanthrene dihydrodiol epoxides (22) with the exception that pSP189 (23), which contains a random sequence of eight nucleotides and permits the recognition of siblings, was used instead of pS189 and that electroporation was used for transformations, as described (24). pSP189 DNA was treated at 10,50, and 100 ng of dihydrodiol epoxide/pg of DNA.
Results On the basis of earlier studies with other hydrocarbon dihydrodiol epoxides, reaction of racemic syn-benzo [glchrysene 11,12-dihydrodiol 13,14-epoxide (la and l b in Scheme 1) with DNA and deoxyribonucleotides should principally lead to products wherein the epoxide has been opened either cis or trans at C14 by the amino groups of adenine or guanine residues, as shown in Scheme 1. In this scheme,these deoxyribonucleosideadducts are labeled to indicate the absolute stereochemistry at c14 of the hydrocarbon residue (R or S ) , the deoxyribonucleoside attached through its amino group to C14 [i.e., deoxyguanosine (G) or deoxyadenosine (A)], and the relationship between the purine nucleoside and the hydroxyl group on
* Abbreviations: COSY, correlated spectroscopy; NOESY, nuclear Overhauser enhancement spectroscopy; ROESY,rotating frame Overhauser enhancement spectroscopy.
Scheme 1. Structures of the Enantiomeric Pair of syn-Benzo[g]chrysene 11,12-Dihydrodiol 13,14-Epoxides ( l a and lb) and the Purine Deoxyribonucleoside Adducts Expected To Be Formed from Them by Cis or Trans Opening of the Epoxide at C14 by the Amino Group of Deoxyguanosine (dG) or Deoxyadenosine (dA) 3 2
OH
A
4
2. Enzymatic Hydrolysis
&o 1. DNA or Nucleotide
HO'" OH lb
"* no"'
w 2. Enzymatic Hydrolysis
OH
(SPc
HO"'
OH
(sP
c
C13 [Le., cis (c) or trans (t)]. Although the justification for assignment of specific labels to products appears later on, these labels are used throughout to aid clarity. Reaction of the racemic 1 with DNA led, after enzymic conversion to deoxyribonucleoside adducts and chromatography, to the profile shown in Figure 1A. Comparison of this profile with those obtained from reactions of 1with the four deoxyribonucleotide constituents of DNA indicated that products formed in reactions with deoxyadenylic (Figure 1B)and deoxyguanylic acids (Figure 1C) were the principal components of the DNA reaction products. Reaction with deoxycytidylic and thymidylic acids did not lead to any substantial product formation. After measurement of ultraviolet absorbance (Figure 2) and CD spectra, it seemed clear that the four hatched peaks in Figure 1A,B were the four anticipated deoxyadenosine adducts (Scheme 11, but only two minor deoxyguanosine adducts (R)Gc and (S)Gc (solid black in Figure 1A,C)were apparent. The large peak in Figure 1C had an appropriate absorbance spectrum for an adduct but was devoid of the anticipated CD signal. However, when chromatographic conditions were changed (Figure 31, it was clear that the large peak in Figure 1C resulted from the coelution of two adducts with individual CD spectra that essentially canceled out one another. The CD spectra of the four deoxyadenosine and the four deoxyguanosine adducts are illustrated in Figure 4. As anticipated (13,14),the CD spectra consisted of pairs of spectra that were mirror images of one another; the pair of adducts were enantiomers in the hydrocarbon portion of the molecule. One pair of spectra results from cis opening and the second pair results from trans opening of the epoxide ring for each nucleoside (14). The CD spectra do not indicate which pair of adducts have the cis or trans configuration, but this information was derived
Chem. Res. Toxicol., Vol. 7, No.3, 1994
Szeliga et al.
A. DNA
0. dAMP
125 60
40
100
80
120
/
175
200
Time (min)
Time (min)
Figure 1. HPLC separation of benzo[g]chrysene-deoxyribonucleoside adducts obtained from reactions with D N A (A), deoxyadenylic acid (B), and deoxyguanylic acid (C). Chromatography on a Beckman Ultrasphere ODS column involved isocraticelutionwith 24% acetonitrileat room temperature. The abbreviations used to mark individual peaks were defined in Scheme 1.
150
Figure 3. HPLC separation of benzoblchrysene-deoxyrib nucleoside adducts obtained from reaction with D N A (A)or deoxyguanylic acid (B). Elution was isocratic at 40 O C with 12% tetrahydrofuran.
A. dQuo
-cis ---trans
-30-
j
30r------
- - - trans
I 220
240
-
260 280 300 Wavelength (nm)
320
340
Figure 2. UV absorption spectra for deoxyguanosine adducts (A), deoxyadenosine adducts (B), and tetraols (C) derived from syn-benzo[g]chrysenedihydrodiolepoxide in which the epoxide has been opened cis (-) or trans (- - -) by nucleophilic attack at Cl4.
from NMR studies of these various adducts after acetylation to yield peracetates. All eight adducts separated by reverse-phase chromatography were acetylated and then purified on normalphase chromatography. Unfortunately, the amounts of adducts (S)Ac and (R)Ac recovered were insufficient to allow useful NMR data to be obtained. However, NMR spectra were obtained for the other six adducts. In these cases, assignments were made on the basis of examination of vicinal J coupling connectivities as revealed in the 1D
-
200
3
0
1 350
'
'
'
200
'
'
'
'
'
'
'
' ' '
'
I
350
Wavelength (nm)
Figure 4. CD spectra of deoxyribonucleoside adducts derived from syn-benzo[g]chrysene dihydrodiolepoxide. The labels are defied in Scheme 1. and 2D (COSY) spectra. Confirmation of these assignments was provided by observation of Overhauser connectivities between the protons on CI and CU and by observation of long-range J coupling between the protons on C11 and CIOin the tetraols and several of the adducts. The results were very similar to those described earlier for analogous benzo[cl phenanthrene dihydrodiol epoxidederived adducts (141, and assignments of cis or trans configurations were clear from the coupling constants and the chemical shift of the proton on CU (Table 1). A large coupling for Jl1,12 indicated trans stereochemistry whereas a large coupling for J12,13 indicated cis stereochemistry of epoxide opening. Additionally, the observation that the chemical shift for the c14 proton was further downfield in products assigned cis stereochemistry than in those assigned trans stereochemistry was also consistent with
Chem. Res. Toxicol., Vol. 7, No. 3, 1994 423
DNA Reactions of Benzo[g]chrysene Diol Epoxide
Table 1. 1H NMR Data for Acetates of Deoxyribonucleoside Adducts and of Tetraols from 1 compound (S)Ata (R)Ata trans-tetraol (R)Gt (S)Gt cis-tetraol
WGc (S)Gc a NMR run at -20 OC.
Table 2. Adduct Distributions (%) in Reactions of syn-Benzo[g]chrysene ll,l2-Dihydrodiol 13,14-Epoxidewith DNA and Nucleotides DNA nucleotides dihydrodiol dGuo dAdo epoxide trans cis trans cis 17 1 13 2 R,S,R,S s,R,s,R 10 3 51 2 B.
dGuo dAdo trans cis trans cis 37 10.5 39 4 37.5 15 51 6
X
11 1"
I
76
74
7.2
7.0
6.8
6.6
6.4
6.2
6.0
5.6
5.6
5.4
5.2
5.0
6 (ppm)
Figure 5. Downfield region of the NMR spectrum of acetylated (R)At (Scheme 1)recorded in acetone-& at -20 O C (A) or at 27 O C (B). Hydrocarbon protons are numbered according to Scheme 1. The 1" and 3" protons are sugar protons. X indicates signals from impurities in the samples.
previous assignments (9,13,14,25-28). Examination of the Overhauser (NOESY and ROESY) spectra provided independent support for the cis and trans assignments. The attachment of the hydrocarbon residue to the amino group of the purine nucleoside was evident from the coupling between the NH proton on the purine and the C14 proton as seen in either or, in some cases, both the 1D and the COSY spectra. An interesting aspect of the NMR studies was that several protons (one of the adenine protons, and the protons on CI, CZ,(213, and C14 of the hydrocarbon) in the trans-deoxyadenosine adducts, i.e., @)At and (R)At,were considerably broadened in the spectra recorded a t 27 "C. The resolution for these protons, as can be seen in Figure 5 for those at C14-H and Cz-H,improved considerably when the temperature was lowered to -20 "C. The 2D spectra for these deoxyadenosine adducts were measured, therefore, at reduced temperatures. The broadening of the proton signals seen in Figure 5B is probably caused by a slow rotation about the C14-N bond resulting from the severe steric hindrance in the bay region. Our previous work with benzo[clphenanthrene adducts (14) showed similar broadening of the signals for analogous protons. Once the cis and trans assignments were made, it was possible to reexamine the CD spectra (Figure 4) and compare them with the spectra obtained from optically active benzo[cl phenanthrene dihydrodiol epoxides. The spectra for the benzo[glchrysene and benzo[clphenanthrene derivatives were sufficiently similar to allow confident assignment of the absolute stereochemistries to the benzoklchrysene adducts, as indicated throughout this paper.
The contribution of each enantiomer of the benzo[glchrysene dihydrodiol epoxide could then be estimated for the DNA and nucleotide reactions, as summarized in Table 2. It can be seen that the major product formed in DNA (-50% of total product) was @)At, i.e., the trans-opened product from reaction of the ll(S),12(R)-dihydrodiol13(S),14(R)-epoxidewith deoxyadenosine. This latter epoxide was responsible for about twice as much reaction with DNA as was its enantiomer. With nucleotides, each enantiomer contributed more equally to total reaction than was the case with DNA, and trans opening was greatly preferred over cis opening of the epoxide for both enantiomers in reactions with each nucleotide. In this regard, the benzoklchrysene data differ from data obtained for benzo[clphenanthrene dihydrodiol epoxide reactions with nucleotides in which cis products predominated over trans products. syn-Benzo[gl chrysene dihydrodiol epoxide is a known mutagen in mammalian and bacterial cells (18, 19), but the specific types of mutations generated were not determined in these studies. Using the supF gene in the pSP189 shuttle vector as a target, we isolated mutants and sequenced them to determine the specific nucleotide changes involved in the mutational events. Although, the vector was exposed to several concentrations of the dihydrodiol epoxide, mutants were only obtained from the lowest concentration used (10 nglrg of DNA) because the higher doses were toxic. The mutation frequency obtained was 34 X 10-4, i.e., -300-fold higher than background, and a total of 106 mutants were sequenced. Two contained large deletions and 104 contained point mutations in the supF gene. Of these 104 mutants, 99 had single base changes and 5 had two mutations each in the supF gene, yielding a total of 109 point mutations. In order of decreasing abundance, the mutations identified were as follows: A T -,T A (45, i.e., 41 % ) > GC TA (30, i.e., 28%) > GC CG (13, i.e., 12%) =GC-,AT(13,i.e., 12%)>AT-CG(5,i.e.,5%) > AT GC (3, i.e., 3%). Thus, as we found with benzo[clphenanthrene dihydrodiol epoxides (22),both A T and GC pairs are targets for mutation, in agreement with the chemical specificity of this agent described here. The distribution of these mutations through the supF structural gene is shown in Figure 6. Mutations were found
-
-
-
Szeliga et al.
424 Chem. Res. Toxicol., Vol. 7, No.3,1994
5'
100
110
120
130
140
150
160
170
180
I
I
I
I
I
I
I
I
I
GTGGGGTTCCCGAGCGGCCAAAGGGAGCAGACTCTAAATCTGCCGTCATCGACTTCGAAGGTTCGAATCCTTCCCCCACCACCACG TT A C GT A A TT T TTT G TT A AAT T A GCTTTTAAAATGGGAAAAATGGTAA AATA T
--
C T
T G
T T T T T T T T
G A
T T T T T T T
C
AGT A T A A A A A A A T
T
G TT
A TGG G
A
3'
A GA A A A A G
Figure 6. Distribution of point mutations induced by 1 through the coding sequence of the supF gene. A T A change at site 87 and A T changesat sites 91 and 93 were also observed.The 10 mutationsfound in mutants containingtwo mutationswere as follows: 129 G T plus 164 G A; 102 G T plus 103 G T; 146 C T plus 166 A G; 173 C A plus 176 C A; and 173 C A plus 184 C A. Only 1 mutation was identified as a sibling and excluded from our analyses (large deletion of 144-186).
-
-
-
-
throughout most of the sequence although statistical analysis indicated that three sites (128,136, and 144)were mutation hotspots (defined as sites where the observed number of mutagenicevents exceeds the expected number by a factor of 5 or more). Two of these sites were at AT pairs, and the mutations were, with one exception, all AT TA changes. The other hotspot was at a GC pair, and here, GC AT changes predominated even though this was not the most common GC mutational change overall. Interestingly, none of these sites were mutation hotspots in published studies with benzo[c] phenanthrene or other hydrocarbon dihydrodiol epoxides (22,29-32)although we have found a mutation hotspot at site 144 with 7-(bromomethyl)benz [a] ant h r a ~ e n e . ~ In the present work, we also used a polymerase arrest assay (21) to investigate the distribution of adduct formation through the supF structural gene. Figure 7 illustrates some of the data obtained on the pSP189 DNA treated at 50 ng of dihydrodiol epoxide/pg of DNA. With the 10-ng dose from which mutations were obtained, the findings were similar except that the radioactive bands, arising from the arrest of polymerase progress by adducts in the template strand, were less intense throughout. Examination of Figure 7 indicates that polymerase arrest was seen only very infrequently where the template contained runs of pyrimidines and that the arrest bands were mostly one nucleotide shorter than bands in the sequencing lanes, indicatingthe presence of purines. This would be expected if the polymerase were arrested at the nucleotide 3' to a purine adduct. A more detailed analysis of arrest data for both strands of the supF structural gene showed that over 70% of the arrest bands were opposite a nucleotide 3' to an adenine or guanine nucleotide. In Figure 8, the distribution and relative intensity of the polymerase arrest bands through the supF sequence are illustrated. The sites of the mutation hotspots are also indicated, and though the polymerase arrest data indicate that adducts were generated at or near to these mutation hotspots, the mutation hotspots could not have been predicted from this polymerase arrest data.
- -
Discussion syn-Benzo[g]chrysene 11,12-dihydrodiol13,14-epoxide is structurally very similar to the syn-dihydrodiolepoxide of benzo[c]phenanthrene. The epoxide ring in both cases is in a fjord region, and the only difference in structure is that the benzo[g]chrysene derivative has an extra benzene ring, Le., it is a dibenzo[c,Z]phenanthrene. As might be anticipated, therefore, there was a large degree of similarity between the chemical reactions of the benzo[g]chrysene dihydrodiol epoxide with DNA and nucle-
* Page et d.,in preparation.
-
-
-
-
+
-.
110120 -
130 140 -
150 -
160 -
170 -
180 -
190 Figure 7. Autoradiograph of gel from polymerase arrest assay on pSP189 DNA exposed to 1 at 50 ng/pg of DNA (B[g]C). The other lanes are sequencing lanes from incubationswith the four dideoxynucleotide triphosphates (ddG, ddA, ddT, and ddC indicate the lanes from the reactions with dideoxynucleotides derived from guanine, adenine, thymine, and cytosine, respectively).
otides and those we reported earlier for the analogous benzo[c] phenanthrenedihydrodiol epoxide (12,14). Thus, in both cases, adenine residues were major sites of reaction in DNA, and adducts in which theepoxide ring had opened trans were formed in DNA to a much larger extent than were cis-opened adducts. These general properties are not restricted to hydrocarbons containing a fjord region but apply also to hydrocarbons with substituents in the bay region that cause substantial deviationsfrom planarity. Thus, the extensive reaction of a syn-dihydrodiolepoxide with deoxyadenosine
Chem. Res. Toxicol., Vol. 7, No. 3, 1994 425
DNA Reactions of Benzo[g]chrysene Diol Epoxide
dGMP
I00
110
120
1
0
t
140
t
150
160
170
180
Figure 8. Histogram showing the sites and relative intensities of polymerase arrest on either strand of the supF gene. The purines at which mutation hotspota were detected (see Figure 6) are indicated by the three arrows.
1
(s,R)-dihydrodiol-
.
(R,S)-dihydrodlol-
I
(R,S)-epoxide
TI
-
m 4-
50401
(S)Gt (R)Gc @)At (R)Ac
(R)Gt (S)Gc (R)At (S)Ac
Figure 9. Comparison of relative adduct distributions in DNA for each enantiomer of the syn-dihydrodiolepoxides of benzo-
[clphenanthrene (hatched bars) and benzo[glchrysene (filled bars).The absolute stereochemistriesof the enantiomers are listed in sequence from the benzylic hydroxyl group.
residues in DNA was first described for 7,12-dimethylbenz[alanthracene (10, 11) in which the 12-methyl group in the bay region leads to substantial distortion from planarity (33). Although 5-methylchrysene also has a methyl group in the bay region, little distortion from planarity is associated with this (34), and the bay-region syn-dihydrodiol epoxide reacts principally with deoxyguanosine residues in DNA (28). Despite the broad similarities between benzo[gl chrysene and benzo[c]phenanthrene syn-dihydrodiol epoxide chemistry noted above, some substantial differences were also noted. Although approximately 60 5% of each enantiomeric syn-dihydrodiol epoxide of benzo [cl phenanthrene was trapped by DNA (35), only about 13% of the benzo[glchrysene derivative was similarly trapped. Also, examination of the distribution of DNA adducts for the two hydrocarbon derivatives (Figure 9) indicates that the benzo[glchrysene derivative exhibits a greater preference for the formation of trans products than does the analogous benzo[clphenanthrene derivative. This preference for trans adduct formation was most notable in the reactions with nucleotides. In Figures 1and 3, it is clear that trans adduct formation is greatly in excess of cis adduct formation for both deoxyadenylic acid and deoxyguanylic acid reactions. In contrast, the benzo[clphenanthrene derivatives predominantly gave cis adducts with each of these nucleotides (14), as illustrated in Figure 10.
Figure 10. Comparison of relative adduct distributions in reactions with deoxyadenylic acid (dAMP) and deoxyguanylic acid (dGMP)for the racemic syn-dihydrodiolepoxides of benzo[clphenanthrene (hatched bars) and benzo[glchrysene (filled bars).
Overall, the additional benzene ring in benzo[gl chrysene did not change substantially the selectivity for deoxyguanosine and deoxyadenosine residues in DNA that was exhibited by benzo[cl phenanthrene syn-dihydrodiol epoxides. However, it reduced the effectiveness with which DNA competes with water to capture the reactive epoxide, and it changed the preferential cis opening of the epoxide to a preferential trans opening. The chemical basis for these differences is not obvious, but since the additional benzene ring is not near the reactive epoxide function, steric factors may not be important. The addition of an extra benzene ring should stabilize any developing charge resulting from the ionization of the epoxide and therefore promote such ionization. Solvolysis rates are increased by increasing the size of the aromatic system in arylmethyl compounds (36),and this may well allow water to compete more effectively with DNA (5),accounting for the reduced fraction of dihydrodiol epoxide captured by DNA in the benzo[g]chrysene case. The reason for the change in trans versus cis opening is not clear, but it seems unlikely to be the result of steric factors given that the additional benzene ring is well-removed from the epoxide. Perhaps this too is associated with electronic factors, therefore. The conformation of the partially saturated ring in the benzo[glchrysene adducts described here is similar to that found for the corresponding benzo[clphenanthrene adducts, since the NMR coupling constants for the protons in that ring are very similar. In previous studies with a benzo[a]pyrene tetraol (91, we showed that acetylation did not drastically affect conformation. Coupling constants for acetylated (25)and unacetylated (37) nucleoside adducts have also been shown to be similar. Although the do not syn-5-methylchrysene 1,2-dihydrodi013,4-epoxides show the same preference for reaction with adenine residues shown by the fjord-region compounds, the conformations of the adducts are similar in all these cases based on NMR data and are different from conformations exhibited by adducts from hydrocarbons with nonsterically hindered bay regions, as illustrated by the adduct coupling constants for hydrogens at the site of the original dihydrodiol in Figure 11. At 10 nglpg of DNA for the benzo[gl chrysene derivative we found a similar mutation frequency to that found for the benzo[clphenanthrene derivatives at 3 nglpg of DNA. This is somewhat different from findings in a V79 cell assay (18) but is consistent with our chemical data that
Chem. Res. Toricol., Vol. 7,No. 3, 1994
426
g
l
Szeliga et al.
o
BA
DB[a,)JA
5-MeC
g
B[c]P
B[g]C
Figure 11. Variation in coupling constants for protons at the dihydrodiol function in deoxyadenosine adducts (circles) or deoxyguanosine adducts (squares)formed by cis (open symbols) or trans (closed symbols) opening of the epoxide for (5'8)dihydrodiol (5'8)-epoxides of benz[alanthracene (BA) (26), dibenz[aj]anthracene (DB[aj]A)(%),5methylchrysene (5MeC) (28),benzo[c]phenanthrene(B[c]P)(141,and benzo[g]chrysene (BkIC).
showed only about one-fifth as much of the benzoklchrysene derivative was trapped by DNA. Additionally, the principal types of mutation generated by the two hydrocarbon derivatives were similar; i.e., A T and G T changes predominated. However, despite the structural similarities none of the three hotspots of mutation generated by the benzo[glchrysene derivative were common to either enantiomer of the syn-benzo[clphenanthrene dihydrodiol epoxide (22). The hotspots of mutation were not predictable from the relative distribution of adducts through the sequence as reflected in the sites and intensities of polymerase arrest, as found earlier in similar studies (21). Excision repair may account for this discrepancy since Brash et al. (38)showed that a mutation hotspot corresponded to a slow-spot for repair in UV mutation studies. In summary, the annelation of another benzene ring to the syn-benzo[clphenanthrenedihydrodiol epoxide system did not change substantially the chemical and mutagenic selectivity for adenine and guanine bases in DNA, but it did affect extents of reaction with DNA, cis versus trans opening of the epoxide in reactions with nucleotides, and the distribution of mutations and mutation hotspots in the supF target gene. These differences and other observations on other hydrocarbon dihydrodiol epoxides (reviewed in ref 6) are beginning to allow the various roles of steric and electronic effects in mediating hydrocarbon carcinogen-DNA interactions to become clarified.
-
-
Acknowledgment. Research sponsored in part by the National Cancer Institute, DHHS, under Contracts N01CO-74101 with ABL and N01-CO-74102 with PRI, and by National Institute for Environmental Health Sciences Grant ES-04732 and American Cancer Society CN-22 to R.G.H. The contents of this publication do not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercialproducts, or organizations imply endorsement by the US. Government.
References Cook, J. W., Hewett, C. L., and Hieger, I. (1933) The isolation of a cancer-producing hydrocarbon from coal tar.Parts I, 11, and 111.J. Chem. Soc., 395-405. Sims, P., Grover, P. L., Swaisland, A., Pal, K., and Hewer, A. (1974) Metabolic activation of benzo[alpyrene proceeds by a diol-epoxide. Nature 262, 326-328. Jerina, D. M., and Daly, J. W. (1976) Oxidation of carbon. In Drug Metabolism-from Microbe to Man (Parke, D. V. and Smith, R. L., Eds.) pp 13-32, Taylor & Francis, London. Jerina, D. M., Chadha, A., Cheh, A. M., Schurdak, M. E., Wood,A. W., and Sayer, J. M. (1990) Covalent bonding of bay-region diol epoxides to nucleic acids. Adu. Exp. Med. Biol. 283,533-553. Dipple, A., Peltonen, K., Cheng, S. C., and Hilton, B. D. (1993) Chemistry of DNA adduct formation by dihydrodiol epoxides of polycyclic aromatic hydrocarbons. In Polycyclic Aromatic Compounds: Synthesis, Properties, Analytical Measurements, Occurrence and BiologicalEffects (Garrigues, P., and Lamotte, M., Eds.) pp 811-820, Gordon and Breach, Philadelphia. Dipple, A. (1993) Reactions of polycyclic aromatic hydrocarbons with DNA. In Proceedings of the Meeting on DNA Adducts of Carcinogenic and Mutagenic Agents, Stockholm, Sweden (Hemminki, K., Dipple, A,, Segerbhck, D., Kadlubar, F. F., Shuker, D., and Bartsch, H., Eds.) IARC Scientific Publications, Lyon. Harvey,R. G. (1991)PolycyclicAromaticHydrocarbom: Chemistry and Carcinogenicity, Cambridge University Press, Cambridge, England. Dipple,A., Brookes,P., Mackintosh,D. S.,andRayman, M. P. (1971) Reaction of 7-bromomethylbenz[a]anthracenewith nucleic acids, polynucleotides, and nucleosides. Biochemistry 10, 4323-4330. Cheng, S. C., Hilton, B. D., Roman, J. M., and Dipple, A. (1989) DNA adducts from carcinogenic and noncarcinogenic enantiomers of benzo[alpyrene dihydrodiol epoxide. Chem. Res. Toxicol.2,334340. Dipple, A., Sawicki,J. T., Moschel,R. C., and Bigger, C. A. H. (1983) 7,12-Dimethylbenz[a]anthracene-DNAinteractions in mouse embryocellculturesandmouseskin. InExtrahepatic DrugMetabolism and Chemical Carcinogenesis (Rydstrom, J., Montelius, J., and Bengsson, M., Eds.) pp 439-448, Elsevier, Amsterdam. Bigger, C. A. H., Sawicki, J. T., Blake, D. M., Raymond, L. G., and Dipple, A. (1983) Products of binding of 7,12-dimethylbenz[a]anthracene to DNA in mouse skin. Cancer Res. 43, 5647-5651. Dipple, A., Pigott, M. A,, Agarwal, S. K., Yagi, H., Sayer, J. M., and Jerina, D. M. (1987) Optically active benzo[c]phenanthrene diol epoxides bind extensively to adenine in DNA. Nature 327,535-536. Peltonen, K., Cheng, S. C., Hilton,B. D.,Lee, H., Cortez, C.,Harvey, R. G., and Dipple, A. (1991) Effect of bay region methyl group on reactions of anti-benz[alanthracene 3,4-dihydrodiol 1,2-epoxides with DNA. J. Org. Chem. 56,4181-4188. Agarwal, S. K., Sayer, J. M., Yeh, H. J. C., Pannell, L. K., Hilton, B. D., Pigott, M. A., Dipple, A., Yagi, H., and Jerina, D. M. (1987) Chemical characterization of DNA adducts derived from the configurationally isomeric benzo[cI~henanthrene-3,4-diol 1.2-e~. oxides. J.Am. &em. S O ~109, . 249f-2504. (15) Cheng, S. C., Prakash, A. S., Pigott, M. A., Hilton, B. D., Lee, H., Harvey, R. G., and Dipple, A. (1988)A metabolite of the carcinogen 7,12-dimethylbenz[alanthracenethat reacts predominantly with adenine residues in DNA. Carcinogenesis 9, 1721-1723. (16) Levin, W., Chang, R. L., Wood,A., Thakker, D. R., Yagi, H., Jerina, D. M., and Conney, A. H. (1986) Tumorigenicity of optical isomers of the diastereomeric bay region 3,4-diol epoxides of benzo[clphenanthrene 3,4-diol-1,2-epoxides. Cancer Res. 46, 2257-2261. (17) Utermoehlen, C. M., Singh, M., and Lehr, R. E. (1987) Fjord region 3,4-dioll,2-epoxides and other derivatives in the 1,2,3,4-and 5,6,7,8benzo rings of the carcinogen benzo[glchrysene. J. Org. Chem. 62, 5574-5582. (18) Glatt, H., Piee, A., Pauly, K., Steinbrecher, T., Schrode, R., Oesch, R., and Seidel, A. (1991) Fjord- and bay-region diol-epoxides investigated for stability, SOS induction in Escherichia coli, and mutagenicity in Salmonella typhimurium and mammalian cells. Cancer Res. 61, 1659-1667. (19) Phillips, D. H., Hewer, A., Seidel, A., Steinbrecher, T., Schrode, R., Oesch, F., and Glatt, H. (1991)Relationship between mutagenicity and DNA adduct formation in mammalian cells for fjord- and bayregion diol-epoxides of polycyclic aromatic hydrocarbons. Chem.Biol. Interact. 80,177-186. (20) Hwang, T.-L., and Shaka, A. J. (1992) Cross relaxation without TOCSY Transverse rotating-frame Overhausereffect spectroacopy. J. Am. Chem. SOC.114, 3157-3159. (21) Ross, H., Bigger, C. A. H., Yagi, H., Jerina, D. M., and Dipple, A. (1993) Sequence specificity in the interaction of the four stereoisomeric benzo[c]phenanthrene dihydrodiol epoxides with the supF gene. Cancer Res. 63, 1273-1277.
DNA Reactions of Benzo[glchrysene Diol Epoxide (22) Bigger, C. A. H., St. John, J., Yagi, H., Jerina, D. M., and Dipple, A. (1992) Mutagenic specificities of four stereoisomeric benzo[clphenanthrene dihydrodiol epoxides. Roc. Natl. Acad. Sei. U.S.A. 89, 368-372. (23) Parris, C. N., and Seidman, M. M. (1992) A signature element distinguishes sibling and independent mutations in a shuttle vector plasmid. Gene 117,l-5. (24) Routledge, M. N., Wink, D. A., Keefer, L. K., and Dipple, A. (1993) Mutations induced by saturated aqueous nitric oxide in the pSP189 supF gene in human Ad293 and E. coli MBM7070 cella. Carcinogenesis 14, 1251-1254. (26) Chadha,A.,Sayer, J. M.,Yeh,H. J. C., Yagi,H., Cheh, A. M.,Pannell, L. K., and Jerina, D. M. (1989) Structures of covalent nucleoside adducts formed from adenine, guanine, and cytosine bases in DNA and the optically active bay-region 3,4-diol1,2-epoxides of dibenz[ojlanthracene. J. Am. Chem. SOC. 111,5456-5463. (26) Cheh, A. M.,Chadha,A.,Sayer, J. M.,Yeh,H. J. C.,Yagi,H.,Pannell, L. K., and Jerina, D. M. (1993) Structures of covalent nucleoside adducts formed from adenine, guanine, and cytosine bases of DNA and the optically active bay-region 3,4diol 1,2-epoxides of benz[alanthracene. J. Org. Chem. 58, 4013-4022. (27) Reardon, D. B., Prakash, A. S., Hilton, B. D., Roman, J. M., Pataki, J., Harvey, R. G., and Dipple, A. (1987) Characterization of 6-methylchrysene-1,2-dihydrodiol-3,4-epoxide-DNA adducts. Carcinogenesis 8, 1317-1322. (28) Peltonen, K., Hilton, B. D., Pataki, J., Lee, H., Harvey, R. G.,and Dipple, A. (1991) SDectroscopic characterization of sun-Cmethvlchryeene 1,2-dihydrbdio13,4-~poxide-deoxyribonucle&ide adducts. Chem. Res. Toxicol. 4, 305-310. (29) . . Binaer, C. A. H., F l i c k e r . D. J.. Strandberg, J., Pataki. J., Harvey. R.G., k d Dipple, A. (l% Mutational $ sp&ificity of the'anti l,2: dihydrodiol 3,eepoxide of 6-methylchrysene. Carcinogenesis 11, 2263-2266. (30) Bigger, C. A. H., Strandberg, J., Yagi, H., Jerina, D. M., and Dipple, A. (1989) Mutagenic specificity of a potent carcinogen, benzo[clphenanthrene (4R,3S)-dihydrodiol (PS,lR)-epoxide, which reacts with adenine and guanine in DNA. Roc. Natl. Acad. Sci. U.S.A. 86, 2291-2295.
Chem. Res. Toxicol., Vol. 7, No. 3,1994 427 (31) Bigger, C. A. H., Flickinger, D. J., St. John, J., Harvey, R. G.,and Dipple, A. (1991)Preferential mutagenesis at GGC base paira by the anti 3,4-dihydrodiol1,2-epoxideof7-methylbenz[alanthra~ne.Mol. Carcinog. 4, 176-179. (32) Yaw, J.-L., Maher, V. M., and McCormick, J. J. (1987) Kin& of mutation formed when a shuttle vector con-adducts of (&)7 ~ , ~ ~ ~ - v - s a , l o 7 , 8 , 9 , l ~pyrene t e rep~ ~ ~ [ a l licates in human cells. Roc. Natl. Acad. Sci. U.S.A. 84,3787-3791. Klein, C. L., Stevens, E. D., Zacharias, D. E., and Glusker, J. P. (1987)7,12-Dimethylbenz(a)anthracene: refined structure, electron density distribution and endo-peroxide structure. Carcinogenesis 8, 5-18. Zacharias, D. E., Kashino, S., Glusker, J. P., Harvey, R. G.,Amin, S., and Hecht, S. S. (1984)The bay-regiongeometryof some 5-methylchryaenes: steric effecta in 5,6- and 5,12-dmethylchrysenes. Carcinogenesis 5, 1421-1430. Jerina, D. M., Sayer, J. M., Agarwal, S. K.,Yagi, H., Levin, W., Wood,A. W.,Conney, A. H., Pruees-Schwartz, D., Baird, W. M., Pigott, M. A., and Dipple, A. (1988) Reactivity and tumorigenicity of bay-region diol epoxides derived from polycyclic aromatic hydrocarbons. In Biological Reactive Intermediates ZIZ (Koceis, J. J., Jollow, D. J., Witmer, C. M., Nelson, J. O., and Snyder, R., Eds.) pp 11-30, Plenum Prees, New York. Bentley, M. D., and Dewar, M. J. S. (1970) The solvolysis of arylmethyl halides and p-tolueneeulfonates. J. Am. Chem. SOC. 92, 3991-3996. Nair, R. V., Gill,R. D., Cortez, C., Harvey, R. G.and DiGiovanni, J. (1989) Characterization of DNA adducts derived from (+)-trans3,4-dihydroxy-onti-l,2-epoxy-1,2,3,4-tetrahydrodibenz[a,j]anthracene and (f)-7-methyl-trans-3,4-dihydroxy-anti-1,2-epoxy1,2,3,4-tetrahydrodibenz[aJlanthracene.Chem.Res. Toxicol. 2,341348. Kunala, S., and Brash, D. E. (1992) Excision repair at individual bases of the Escherichia coli lacZ gene: relation to mutation hot spots and transcription coupling activity. Roc. Natl. Acad. Sci. U.S.A. 89,11031-11035.
