Recent Advances on Magnetic Relaxation ... - ACS Publications

Subscriber access provided by UB + Fachbibliothek Chemie | (FU-Bibliothekssystem)

Review

Recent Advances on Magnetic Relaxation Switching Assay-Based Nanosensors yang zhang, Hong Yang, Zhiguo Zhou, Kai Huang, Shi-Ping Yang, and Gang Han Bioconjugate Chem., Just Accepted Manuscript • DOI: 10.1021/acs.bioconjchem.7b00059 • Publication Date (Web): 16 Feb 2017 Downloaded from http://pubs.acs.org on February 16, 2017

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a free service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are accessible to all readers and citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

Bioconjugate Chemistry is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Bioconjugate Chemistry

Recent Advances on Magnetic Relaxation Switching Assay-Based Nanosensors Yang Zhang†, Hong Yang†‡, Zhiguo Zhou†, Kai Huang‡, Shiping Yang†*, Gang Han‡* †The

Key Laboratory of Resource Chemistry of Ministry of Education, Shanghai Key Laboratory

of Rare Earth Functional Materials, and Shanghai Municipal Education Committee Key Laboratory of Molecular Imaging Probes and Sensors, Shanghai Normal University, Shanghai 200234, China. ‡Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School, Worcester, Massachusetts, 01605, the United States. Shiping Yang, 100 Guilin Rd., Department of Chemistry, Shanghai, China, 200234. Tel: +86-021-64322343, E-Mail: [email protected] Gang Han, 364 Plantation Street, LRB 806, Worcester, Massachusetts, 01605, the United States Tel: 508-856-3297, E-Mail: [email protected]

Abstract Magnetic relaxation switching assay (MRSw)-based nanosensors respond to the changes of transverse relaxation time (T2) of water molecules resulted from the analyte-induced aggregation / disaggregation of magnetic nanoparticles (MNPs). This strategy has been widely applied to the detections of various substrates from heavy metal ions to organic pollutants, proteins, nucleic acids, bacteria/viruses, and specific cells. Compared with other nanosensors, MRSw-based nanosensors not only are free from the background interferences, signal bleaching, and quenching but also overcome light scattering from samples without pre-treatments. Therefore, MRSw-based nanosensors have been developed as real-time and on-site detection platforms for

ACS Paragon Plus Environment


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

environmental protection, food safety, and risk assessment. This review summarizes the latest developments of the principles, the applicable magnetic nanoparticles and the exploited environmental/biological applications of MRSw-based nanosensors. 1. Introduction Heavy metal ions1-5 and organic pollutants such as pesticides6 and toxins7 accumulate at the top of the biological chain, threatening public health and inducing physiological defect to infants.8 On the other hand, bacteria/viruses such as Escherichia coli,9 staphylococcus aureus,10 clostridium tetani,11 human immunodeficiency virus (HIV),12 and hepatitis B virus (HBV)13 also cause severe health problems. Associated with the pathological changes of the human body, the amounts of various biomarkers also varies to abnormal levels.14 These biomarkers provide valuable information for the evaluation of the pathology of an organism, pathogenic processes and pharmacologic responses to a therapeutic intervention. Therefore, the development of a realtime and on-site strategy for the detection of these pernicious substrates and biomarkers is of essential importance for disease prevention and diagnosis. With the blossom of nanotechnology, optical and electrochemical sensors have been rapidly developed as on-site and real-time detection platforms.15-17 However, considering their susceptibility to interferences from the impurities, optical and electrochemical detections usually demand complicated sample pre-treatments. On the contrary, MRSw-based detections can be carried out in a turbid and light-impermeable media without separation and purification steps, and it is even applicable in whole tissues benefitting from the deep-penetrating ability of radiofrequency radiation.18 Furthermore, with a negligible magnetic property of the practical sample,19 MRSw-based nanosensors can realize background-free detections. Therefore, they have been widely utilized as platforms for the detection of heavy metal ions, small organic


Page 2 of 29

Page 3 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


molecules, biological macromolecules, and cells by monitoring the changes of transverse relaxation

time

(T2)

of

water

molecules

surrounding

the

analyte-induced

aggregation/disaggregation of magnetic nanoparticles (MNPs).20 During the constructing of MRSw-based nanosensors, the specificity of receptors and the magnetic property of MNPs should be considered;21 both of them significantly affect the selectivity and sensitivity of MRSw-based nanosensors. Here, we focus on MRSw-based nanosensors that have been exploited for environmental/biological applications based on three kinds of widely applied receptors, namely, proteins, oligonucleotides, and small-molecule ligands. Two types of primary detection mechanisms and types of magnetic nanoparticles for MRSw-based nanosensors were reviewed. 2. Mechanisms of MRSw-based nanosensors In the presence of a given external magnetic field (B0), a small portion of the proton nuclei aligns parallel to B0. The aligned proton nuclei start to precess with the Larmor frequency (ω0). When a resonant radio frequency (RF) pulse is perpendicularly applied to B0, the parallel nuclei absorb energy and are excited to the antiparallel state(Figure 1a).22 Upon removal of the RF pulse, the excited nuclei relax to the equilibrium distribution. There are two types of the relaxation process involved: longitudinal relaxation (T1) and transverse relaxation (T2).23 T1 is recognized as the time that starting from zero magnetization in the Z direction; the Z magnetization will grow to 63 % of its final maximum value (M0) (Figure 1b). T2 is defined as the time for the transverse magnetization to fall to 37% of its initial value (Figure 1c).



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Figure 1. (a) The transition from the parallel to the antiparallel state upon the RF pulse. Longitudinal (b) and transverse (c) relaxation22, 23.

T1 and T2 are dependent on several factors, such as resonance frequency, temperature, the experimental parameters, etc. It has been found that the addition of MNPs (contrast agents, CAs) reduces T1, T2 or both of proton nuclei in many cases because magnetic CAs induce inhomogeneity of the magnetic field and accelerate the relaxation rates18. The capabilities of MNPs to decrease T1 and T2 are defined as longitudinal (r1) and transverse (r2) relaxivities respectively. Generally, r2 value is greater than the r1 value of MNPs.20 Furthermore, the aggregation/disaggregation of T2 CAs can lead to a T2 variation24, 25. Therefore, T2 is used for the application of MRSw-based nanosensors. For MRSw-based nanosensors, changes of T2 is determined by an aggregated/disaggregated degree in the presence of analyte quantificationally. Generally, two cases have been observed:21,

26

1) T2 decreases with the aggregation, which is

called Type І system; and on the contrary, 2) T2 increases with the aggregation, which is called Type П system. The outer sphere relaxation theory gives a theoretical explanation of the different behaviors of Type І and Type П systems.20, 21, 27, 28


Page 4 of 29

Page 5 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


For a better understanding of the outer sphere relaxation theory, the parameters of tD and Dw should be introduced first. tD is the translational diffusion time of water around the sphere (tD = Ra2/D, Ra is the radius of the sphere and D is the water diffusion coefficient). Dw is the difference in angular frequency between the local field experience by a proton at the equatorial line of the sphere’s surface and in bulk (Dw = moMg/3, mo is the vacuum magnetic permeability, M is the magnetization of particles, and g is the proton gyromagnetic ratio). When the motional average condition is fulfilled as DwtD < 1, the outer sphere relaxation theory is applicable. T2 decreases as the size of aggregation increases (Figure 2a). However, the motional average condition is not fulfilled for a further aggregation of MNPs (DwtD > 1), resulting in the increase of T2 in this situation (Figure 2a). With the use of larger magnetic particles (MPs) between 300 and 5,000 nm in diameter, T2 also increases with the aggregation of MPs (Figure 2b). As a consequence, in the presence of analytes, MNPs aggregation leads to the inhomogeneity of the magnetic field which affects the proton relaxation26 and leads to a change of T2 (Figure 2). There are two kinds of processes upon the addition of analytes.29,

30

In the first process, the

aggregation of MNPs cannot overcome the thermal randomization and is in a motional averaging model (MA, DwtD < 1). The diffusional motion of water molecules is fast enough to average out the magnetic field produced by the aggregation of MNPs.26 In MA model, the transverse relaxation rate (R2), which is defined as 1/T2, is expressed as:31

µ, the transverse component of the magnetic moment of MNPs; Ng, the number of MNPs in aggregation; Ca, the concentration of aggregation; Ra, the radius of aggregation; D, water diffusion coefficient; L(X), Langevin function.



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Therefore, R2 is proportional to number of MNPs in aggregation (Ng) and concentration of aggregation (Ca). Thus, more severe the MNPs aggregate, bigger the R2 value will be (Type І)26. Once the aggregation grows bigger and overcomes the thermal randomization, the system will be analyzed in a static dephasing model (SD, DwtD > 1). It only takes a small volume of the whole sample, and the free water protons contribute majorly to T2. If the size of MPs or the aggregations of MNPs is in SD regime (DwtD > 1), their r2 value decreased along with the increasing size (Figure 2).21, 32 In SD regime, upon the addition of an analyte, a minor amount of aggregates and the vast space between them (relative to water diffusing) lead to many water protons’ failure in experiencing the inhomogeneity, resulting in the increase of T2 (Type П). 20, 21, 28, 32

Figure 2. The schematic mechanism of MRSw-based nanosensors. (a) Two types of primary detection mechanisms (Type Ⅰ and type Ⅰ) of MRSw-based nanosensors of MNPs. (b) Type Ⅰ mechanism of MRSw-based nanosensors of MPs. 3. Magnetic nanoparticles for MRSw-based nanosensors For the design of a sensor, the signal platform and receptors should be considered.33 To achieve a high sensitivity in MRSw-based nanosensors, MNPs, as the signal source, should be rationally designed with the high T2 relaxivity.


Page 6 of 29

Page 7 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


According to the outer-sphere theory, T2 relaxivity of MNPs can be given by the equation as follows:34

Where γ is the proton gyromagnetic ratio, V*, Ms, and a are the volume fraction, saturation magnetization, and the radius of MNPs, respectively, D is the diffusivity of water molecules, and L is the thickness of an impermeable surface coating. Based on this theory, a high T2 relaxivity of MNPs could be produced with an increase of their size and magnetization. For example, Young-wook Jun et al. investigated size effect of MNPs on the large T2 relaxivity experimentally. The mass magnetization value (Ms) of Fe3O4 NPs increased from 25 to 43, 80 and 101 emu/g with an increase of their size from 4 to 6, 9 to 12 nm (Figure 3a, b, c).18, 35 The higher mass magnetization of Fe3O4 NPs results in larger relaxivity coefficient value (r2). Accordingly, r2 increases from 78 to 106, 130 and to 218 mM-1s-1, respectively. Similar size effect of MnFe2O4 NPs was also observed (Figure 3d, e). 36

Figure 3. TEM images (a) and the corresponding Ms (b) of Fe3O4 NPs with different sizes. (c) r2 of Fe3O4 NPs presented in Figure 3a. (d) TEM images of MnFe2O4 NPs with different sizes. (e) r2 of MnFe2O4 (MnMEIO) presented in Figure 3d and Fe3O4 NPs (MEIO).18, 36 The other strategy to increase the magnetization is to introduce chemical dopants with a higher magnetic moment into MNPs. For example, Jinwoo Cheon et al. reported a replacement of octahedral Fe2+ in 12 nm magnetism-engineered iron oxide nanoparticles (MEIO) with other



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

dopants of Mn2+, Co2+, and Ni2+ with magnetic spin magnitude of 5, 3, and 2 µB, respectively. As a result, they systematically varied Ms to 110, 99, and 85 emu/g, respectively.36 Accordingly, r2 increased from 152 to 172, 218, and 358 mM-1 s-1 for Ni, Co, Fe, and Mn doping NPs, respectively. Furthermore, Jung-tak Jang et al. tuned the doping ratio of Zn2+ and Mn2+ in Fe2+based MNPs.37 With the Zn2+ ratio of 0.4 in (ZnxM1-x)Fe2O4 (M =Mn2+, Fe2+) NPs, a larger Ms of 175 emu/g and r2 of 676 mM-1 s-1 were achieved (Figure 4).

Figure 4. Ms (a) and r2 (b) verse Zn (Mn) doping level of Fe3O4 NPs. (c) The comparison of r2 of different nanoparticles.37 Besides the above two strategies, core/shell MNPs with high Ms of both core and shell were constructed to enhance their properties. Compared with those multi-domain structures, the spins of the single-domain structure of Fe, Co, Ni NPs will align in the same direction without the anisotropy energy terms and domain walls to move.38 Therefore, Fe, Co and Ni NPs possess stronger magnetic moment than the conventional iron oxide NPs.39 However, they are not directly applicable due to their high reactivity in an aqueous environment. With a shell of other metal or iron oxide, the large magnetic moment of the core is preserved with additionally enhanced colloid stability.40,

41

Hakho Lee et al. reported core/shell structured nanoparticles,

protecting the Fe-cores from oxidations (Figure 5).39 By changing the composition of a shell, Fe@Fe3O4, Fe@MnFe2O4 and Fe@CoFe2O4 NPs were obtained. Ms of all these core/shell NPs were larger than that of the corresponding ferrite NPs, with Fe@MnFe2O4 NPs showing the


Page 8 of 29

Page 9 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


highest Ms among them.

Figure 5. (a) TEM images of core/shell NPs with different shells. (b) r2 of various NPs as a function of saturated magnetization.39 In viewing of the strategies mentioned above, it should be noted that the heterostructured design of MNPs provides the flexibility in developing multifunctional MNPs for MRSw-based multimodal nanosensors. Dumbbell and core/shell structures are the typical formations of multifunctional MNPs. The heterodimer structure not only maintains the high magnetic moment but also expands the range of application. For example, dumbbell Au-Fe3O4 NPs is suitable for magnetic and optical detection simultaneously (Figure 6a). The decoration of gold on iron oxide surfaces provides the possibility as a magnetic and colorimetric dual-modal sensor.42 Our group reported a dual-functional nanosensor for Cd2+ detection using dumbbell Au-Fe3O4 NPs.43 Jinwoo Cheon et al. developed an MRSw-based nanosensor with neutravidins (NTV)-conjugated heterodimeric Co@Pt-Au NPs (Figure 6b) with the enhanced magnetism and high stability in aqueous media to monitor the structural evolution of amyloid β (Aβ) peptide assemblies, especially Aβ protofibrils in the early reversible stages.40



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 29

Figure 6 (a1) The schematic structure of Au-Fe3O4 NPs. (a2) TEM images of 8-20 nm Au-Fe3O4 NPs before (left) and after (after) surface modification. (a3) Magnetic hysteresis loops of AuFe3O4 NPs before and after modification. (a4) Reflection spectra of Au, Au-Fe3O4, and Fe3O4 NPs, respectively.42 (b1) The schematic synthetic route of Co@Pt-Au NPs. (b2) TEM image of Co@Pt-Au NPs. (b3) Magnetic hysteresis loops of Co@Pt-Au and Fe3O4 NPs, respectively. The magnified TEM images of Co@Pt-Au (b4) and Co@Pt NPs (b5), respectively.40 4. Receptors of MSWs-based nanosensors MRSw-based

nanosensors

conjugated

with

different

receptors

such

as

proteins,

oligonucleotides, and small-molecule ligands have been successfully applied to a wide range of targets including heavy metal ions, organic pollutants, biomarkers, pathogens, and specific cells. These works are summarized in Table 1. We will discuss the primary experimental strategy in details as follows. Table 1: MRSw-based nanosensors with different receptors Receptors

Target

MNPs

Type of mechani sm

Refere nce

Herpes simplex virus (HSV) or adenovirus (ADV)

SPIOs

Ⅰ

44

anti-Tag

tag peptide of the influenza virus hemagglutinin

Fe3O4 NPs

Ⅰ, Ⅰ

32

calcium-dependent protein (CaM, M13)

Ca2+

SPIOs

Ⅰ

45

anti-CA125 monoclonal antibodies

ovarian

SPIOs

Ⅰ

46

anti-adenovirus 5 (ADV-5) or anti-herpes simplex virus 1 (HSV-1) antibodies

Protein

carcinoma


Page 11 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


cell lines anti-S. cerevisiae antibody

FITC-avidin

Fe3O4

Ⅰ

47

antigen-OVA

bisphenol A

SPIOs

Ⅰ

48

Polyclonal antibody against Pss

pantoea stewartii subsp. Stewartii

iron oxide nanoparticles

Ⅰ

49

S. enterica monoclonal antibody

S. enterica

Magnetic nanoparticles

Ⅰ

50

goat polyclonal antibody to human KIM-1


Ⅰ

51

goat polyclonal antibody to human Cystatin C

kidney injury molecule-1, Cystatin C

Listeria monocytogenes antibody

Bacterial

Fe/Fe3O4@Si O2

Ⅰ

52

anti-BCG monoclonal antibodies

bacillus Guerin

Fe/Fe3O4

Ⅰ

41

AAAAAATAGTTAGCCGTGGCTTTCT

S. aureus


Ⅰ

53

5’-NH2-AAAAAAGTGACCATTTTTGCAGTG3’

Hg2+

Fe3O4

Ⅰ

54

Lysozyme


Ⅰ

25

Thrombin

SPIOs

Ⅰ

55

Telomerase

SPIOs

Ⅰ

56

CCGCGGTTCGCTTCGACGTGAAGACCG

Bacteria


Ⅰ

57

5’-NH2-TCACAGATGAGT-3’

Pb2+


Ⅰ

58

BamHI


Ⅰ

59

thymin-1-ylacetic acid

Hg2+

Fe3O4@SiO2

Ⅰ

60

3-(3,4-dihydroxyphenyl)propionic acid

Pb2+

Fe/Fe3O4

Ⅰ ,Ⅰ

30

Ethyl-1-(2-(3,4-dihydroxyphenyl)-2-oxoethyl)1H-1,2,3-triazole-4-carboxylate

Cd2+

(Zn, Mn)Fe3O4

Ⅰ

61

(2,4,6-trioxo-1,3,5-triazin-1-yl) acetic acid

melamine

Fe/Fe3O4

Ⅰ

62

Dextran

α1-acid glycoprotein

Fe3O4

Ⅰ

63

Ethyl-1-(2-(3,4-dihydroxyphenyl)-2-oxoethyl)-

Cd2+

Au-Fe3O4

Ⅰ

43

Calmette-

5’-CACTGCTTTTTTGGTCACAAAAAA-NH23’ 5’-BiotinTTTTTTATCAGGGCTAAAGAGTGCAGAGT TACTTAGAGA GA-3’ 5’-Biotin-TTTTTTTCTCTCTAAGTA-3’ 5′ SH-T15-GGTTGGTGTGGTTGG 3′ Oligonucleoti des

5′ SHTTTTTAGTCCGTGGTAGGGCAGGTTGGGG TGACT 3′ 5’-CCCTAACCCTAACCCTAA-3’ 5’-CCCTAACCCTAA-3’

5’-NH2-CACGAGTTGACA-3’ GAGCATCCTAGGGCGTAA TTACGCCCTAGGATCCTC

Smallmolecule ligand



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 29

1H-1,2,3-triazole-4-carboxylate (2,4,6-trioxo-1,3,5-triazin-1-yl) acetic acid

melamine

Au-Fe3O4

Ⅰ

64

2,5-dioxopyrrolidin-1-yl 5-(4-(1,2,4,5-tetrazin-3yl)benzylamino)-5-oxopentanoate

Human tumor

CLIOs

Ⅰ

65


cell

CLIOs

Ⅰ

66


protein biomarkers

CLIOs

Ⅰ

67

phosho-protein signal mediators

4.1

Protein receptors

4.1.1 Antibody receptors The antibody, one of the most popular proteins with high specificities, can interact with an antigen specifically. The antibody-antigen recognition has been the gold standard technique for the immune assay. Therefore, after the conjugation of antibodies onto the surface of MNPs, the high selectivity of MRSw-based nanosensors should be easily performed by the specific interaction between them. According to this strategy, J Manuel Perez et al.44 developed superparamagnetic iron oxide nanoparticles (SPIOs) caged with a dextran and on which antiadenovirus 5 (ADV-5) or anti-herpes simplex virus 1 (HSV-1) antibodies were attached. They applied the developed nanosensors for trace-amount-detections of adenovirus (ADV) and herpes simplex virus 1 (HSV), respectively (Figure 7). With the virus-induced nanoassembly of antibody-conjugated SPIOs, the MRSw-based nanosensor detected as sensitively as five viral particles in 10 µL of 25% protein solution without the need for PCR amplification. Through the similar principle, other antibody modified MNPs have been widely used for detections of proteins, bacteria,41, 49, 50 viruses,68 small molecules,51, 69 and mammalian tumor cells.47, 70


Page 13 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 7 (a) The typical mechanism of an MRSw-based nanosensor conjugated with anti-ADV-5 and anti-HSV-1 antibodies in the presence of specific viral particles. (b) Dose dependence of water T2 changes at 1.5 T (60 MHZ) of anti-HSV-1 conjugated MRSw-based nanosensors with decreasing amount of HSV.44 To enhance the sensitivity and reproducibility of MRSw-based nanosensors, X. Y. Jiang et al. reported an MRSw-based nanosensor with the combination of magnetic separation (MS-MRSwbased nanosensor) for one-step detection of S. enterica (Figure 8).68 A magnetic field of 0.01 T was employed to separate the antibody-conjugated magnetic beads of 250 nm in diameter (MB250) from those of 30 nm in diameter (MB30). The T2 value of the water molecules around MB30 gave out the signal readout of the immunoassay.68 The LOD of the MS-MRSw nanosensor decreased by two orders of magnitude compared with that of a conventional MRSwbased nanosensor, while the linear detection range increased by one order of magnitude. Furthermore, the stability of T2 value of water molecules around MB30 guaranteed the repeatability of an MS-MRSw-based nanosensor. Similar procedure was also applied for onestep quantitative detection of microRNA.71



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 29

Figure 8: The schematic illustration (a), the sensitivity (b), and dynamic range (c) of an MSMRSw-based nanosensor.68 The sensitivity (d) and dynamic range (e) of an MRSw-based nanosensor for detection of S. enterica in PBS solution.68 Alternatively, R. Weissleder et al. combined an MRSw-based nanosensor with microfluidics to significantly improve its sensitivity and portability.41 Anti-BCG monoclonal antibodies were conjugated to the surface of cross-linked Fe3O4 (CLIO-BCG) and Fe@Fe3O4 NPs (Fe@Fe3O4BCG), respectively. The detection limit was approximately 100 CFUs with CLIO-BCG nanosensor and 6 CFUs with Fe@Fe3O4-BCG nanosensor. Using a chip-based filter system with a membrane filter, the detection sensitivity was enhanced to ~1 CFU with Fe@Fe3O4-BCG (Figure 9), furtherly. With the capability for fast, simple and portable operation, the new detection platform could be an ideal point-of-care diagnostic tool, especially in resource-limited settings.

Figure 9. (a) A chip-based NMR-filter system with a microcoil and a membrane filter integrated with a microfluidic channel for bacterial concentration and detection. (b) Changes to T2 value


Page 15 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


with the increase of BCG bacterial counts.41 4.1.2

Other targeting protein receptors

Although the specificity of the antibody is excellent, it is sometimes difficult to find the suitable antibody for the corresponding target. Therefore, it is always interesting to exploit other targeting protein receptors. For example, Jasanoff et al. developed an MRSw-based nanosensor modified by calcium-binding protein calmodulin (CaM) for the detection of Ca2+(Figure 10).45 Firstly, CaM and the peptide with a sequence derived from rabbit skeletal muscle myosin light chain kinase (M13) were conjugated separately to SPIOs. Calcium-dependent protein–protein interactions drove the aggregation of a binary mixture of the two species and produced up to 5fold changes in T2 value. A variant based on conjugates of wild-type CaM and M13 reported the concentration changes near 1 µM Ca2+, which is suitable for detection of elevated intracellular calcium levels.45 W. Wang et al. functionalized Fe3O4 NPs with the gamma-aminobutyrate type receptor-associated proteins (GABARAP) for the detection of calreticulin (CRT) as a result of the specific interaction between GABARAP and CRT. The detection limit for CRT is 10 pg/mL at 211 µT.72



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 29

Figure 10: (a) The schematic mechanism of an MRSw-based nanosensor for Ca2+. (b) The calcium titration of an MRSw-based nanosensor constructed from mutant XCaM proteins 3X1:1M (filled circles) and 3X2:1M (open circles). (c) MRI signal intensity at calcium concentrations from 0 to 15 µM. (d) T2 values computed from the image data of c for sensor variants 3X1:1M (filled circles) and 3X2:1M (open circles).45 4.2 Oligonucleotide receptors 4.2.1 Aptamers Aptamers are functional nucleic acids, being isolated and identified to recognize a variety of chemical and biological molecules with high affinity and selectivity. They are obtained through an in vitro selection process called the systematic evolution of ligands by exponential enrichment (SELEX), against a variety of targets. They have several advantages over antibodies, such as ease of manipulation, reproducible synthesis, excellent stability against biodegradation, and nontoxicity. Therefore, aptamers as a new class of receptors are promising for environmental monitoring and medical diagnosis. On the other hand, the complementary base pairing reaction inducing the aggregation of MNPs modified with the complementary sequence can be used for the detection of specific nucleic acid sequence.73, 74 J. Manuel Perez et al.73 synthesized crosslinked superparamagnetic iron oxide nanoparticles (CLIOs) modified with two oligonucleotides


Page 17 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


to obtain two kinds of NPs (P1 and P2). In the presence of a target oligonucleotide, self-assembly of P1 and P2 occurred with the corresponding decrease of T2. The MRSw-based nanosensor had the high sensitivity and selectivity, which provided more than 10000 date points within few minutes for 1537 well plates and distinguished a single mismatch of a target oligonucleotide. Different from complementary nucleic acid-induced aggregation, another strategy is based on the disassembly of the aggregation. Firstly, oligonucleotide sequence and its complementary chain could self-hybridize with the assembly of MNPs. In the presence of target, the aggregation will switch to a dispersed state followed by the addition of endonuclease with a corresponding increase in T2. W. H Tan et al.25 reported Lys aptamer and DNA linker conjugated Fe3O4 NPs for the detection of lysozyme (Lys) by the disassembly of the clusters in the presence of Lys (Figure 11a and b). A detection limit of nanomolar was achieved in both buffer and human serum. With a similar principle, Preze et al. reported an MRSw-based nanosensor to recognize and monitor protein and DNA cleaving agents (Figure 11c, d, and e). 59

Figure 11. (a) The schematic mechanism of an MRSw-based nanosensor for Lysozyme (Lys). (b)



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 29

Changes in T2 and MRI image with the increasing concentration of Lys.25 (c) Diagram of MRSw nanoassembly (P1/P2). (d) Time-course of water T2 relaxation times of methylated MRS nanoassembly (P1/P2) treated with DpnI (●). Nonmethylated MRS nanoassembly treated with DpnI is shown as a control (○). (d) T2-weighted MR image of methylated and nonmethylated magnetic nanoassemblies incubated with various restriction endonucleases in a portion of a 384well plate: lane 1, nontreated (control); lane 2, DpnI-treated; lane 3, BamHI-treated; lane 4, MboI-treated.59 R. Weissleder et al. developed DNA modified magnetic barcodes for rapid detection and phenotyping of bacteria.53 PCR-amplified mycobacterial genes were captured on microspheres sequence-specifically and identified through MRSw-based nanosensor. The platform detected M. tuberculosis and identified drug-resistance strains from mechanically processed sputum samples within 2.5 h. The specificity of the assay was confirmed by detecting a panel of clinically relevant non-M. tuberculosis bacteria and the clinical utility was demonstrated by the measurements in M. tuberculosis-positive patient specimens. A similar work for pathogens detections was also published recently (Figure 12).57


Page 19 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 12. (a) The schematic diagram of magneto-DNA assay for the detection of bacterial 16S rRNA. (b) Hybridized probe complex observed by transmission electron microscopy (left; scale bar, 100 nm), scanning electron microscopy (center; scale bar, 300 nm), and atomic force microscopy (right; scale bar, 100 nm). (c) Sequences of universal probes targeting a conserved region of bacterial 16S rRNA. (d) The observed ⊗R2 values for the detection of thirteen different bacterial species (left) and mixtures containing different bacterial types (right) using the universal probes. (e) Probes specific for Staphylococcus for detecting S. aureus (DNA amount equivalent to 50,000 c.f.u.), and the selectivity of the probes by detecting target DNA from other bacterial species. (f) Relaxation rates for differential detection of various bacterial types. (g, h) Heat maps comparing the specificity of the magneto-DNA assay with that of qPCR.53 4.2.2 DNA enzyme DNA enzyme is a functional DNA which not only recognizes a target but also catalyzes specific



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 29

biological and chemical reaction. Metal-specific DNAzyme requires specific metal ions as cofactors. Therefore, cofactor-dependent DNAzyme has provided a novel platform for the construction of DNAzyme-based MRSw nanosensors (Figure 13). Firstly, an MRSw nanosensor was in an aggregate state due to the hybridization of nucleotide sequences. In the presence of Pb2+, the strand was cleaved by the DNA enzyme with a high specificity with the corresponding change of T2 value.58 A sensitive limit of detection (LOD) of 0.05 ng mL−1 was obtained. A similar strategy was carried out to detect Cu2+ at nanomolar level.75

Figure 13. Scheme of an MRSw based nanosensor for Pb2+ based on DNAzyme.58 4.3 Small-molecule ligands Compared to protein and oligonucleotide receptors, it is convenient to design small-molecule ligands rationally according to their specific chemical property towards a simple target. Our group focused on the development of small-molecule ligands for the detection of heavy metal ions and organic pollutants. On the one hand, MRSw-based nanosensors with high selectivity have been developed based on the specific coordination between the small-molecule ligand and heavy metal ions. For example, by use of the Cd2+-induced aggregation of a triazole derivative (ETC) conjugated (Zn, Mn)Fe2O4 NPs, an MRSw-based nanosensor for Cd2+ was obtained by


Page 21 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


measuring the corresponding change in T2 value (Figure 14 a and b).61 Inspired by the particular coordination, MRSw-based nanosensors for Hg2+60 and Pb2+30 were developed respectively. On the other hand, considering the triple hydrogen bonds between triazine and melamine, our group synthesized core/shell Fe@Fe3O4 nanoparticles modified a triazine derivative (MTT) to develop an MRSw-based nanosensor for the detection of melamine (Figure 14 c and d).62 Based on the high specificity of small-molecule ligands to its target, ETC and MTT were conjugated on the surface of gold-coated Fe3O4 nanoparticles (Fe3O4-Au NPs) endowing both optical and magnetic properties for dual-modal detections of Cd2+ and melamine, respectively.43, 64

Figure 14. The schematic mechanism of MRSw-based nanosensors for (a, b) Cd2+61 and (c, d) melamine, respectively.62 To significantly improve their detection sensitivity, R. Weissleder et al. exploited a catalyst-free and chemoselective bioorthogonal cycloaddition-based (between a 1,2,4,5-tetrazine (Tz) and a trans-cyclooctene (TCO)) MRSw-based nanosensor and developed a novel targeting nanoplatform termed bioorthogonal nanoparticle detection (BOND) (Figure 15).66 Antibodies targeting biomarkers of interest were conjugated with TCO and applied as scaffolds to couple



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 29

Tz-modified MNPs onto live cells. They found that BOND-2 consistently yielded higher nanoparticle binding efficiency to cells compared to either of the immuno-conjugates, by a factor of 15 for HER2 and approaching 10 for the other cases. The BOND-1 bound to a similar level but tended to vary across the different markers depending on the types of antibodies. Observations suggested that TCO-decorated antibodies could serve as scaffolds for subsequent nanoparticle attachment. This strategy effectively amplified the detected signal, the extent of which increases with the number of available TCO reaction sites. With the similar principle of signal amplification, BOND was successfully applied for intracellular detections of biomarkers and mediators of cell activation67 and clinical tumor cells.65

Figure 15. (a) The schematic diagram of the conjugation chemistry between antibody and nanoparticles. (b) Application of BOND for one-step and two-step targeting of nanoparticles to cells.66 5

Conclusions and future perspectives

With the development of magnetic contrast agent and MRI technology, a variety of MRSw-based nanosensors have been developed. As a novel technique, MRSw-based nanosensors provide several advantages for environmental, biological and medical detection, such as non-invasion,


Page 23 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


on-site, high detection sensitivity, and rapid measurement. More and more selective and sensitive magnetic nanoparticles have been developed, ensuring MRSw-based nanosensors to fit a broad range of targets in a complex system. Multidisciplinary developments significantly improved the application of MRSw-based nanosensors from the laboratory to the global markets, especially in the field of clinical disease diagnosis. MRSw-based nanosensors can provide the useful information on the molecular/cellular level for patients, which will greatly promote the advance of personalized medicine. Benefited from the recent progress in the electronics industry, the miniaturized electronic devices enable a possible wide spreading of their applications as a reliable, robust and tractable sensor with significant sensitivity and accuracy in real life. Acknowledgements This work was partially supported by National Natural Science Foundation of China (No. 21671135), the Ministry of Education of China (PCSIRT_IRT_16R49), and International Joint Laboratory on Resource Chemistry of Ministry of Education (IJLRC). Abbreviation explanation Definition

Abbreviation

magnetic relaxation switching assay

MRSw

transverse relaxation

T2

magnetic nanoparticles

MNPs

human immunodeficiency virus

HIV

hepatitis B virus

HBV

external magnetic field

B0

larmor frequency

ω0

resonant radio frequency

RF

longitudinal relaxation

T1

contrast agents

CAs

longitudinal relaxivities

r1

transverse relaxivities

r2



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

transverse relaxation rate

R2

motional averaging model

MA

static dephasing model

SD

mass magnetization value

Ms

magnetism-engineered iron oxide nanoparticles neutravidins

MEIO NTV

amyloid β

Aβ

superparamagnetic iron oxide nanoparticles

SPIOs

anti-adenovirus 5

ADV-5

anti-herpes simplex virus 1

HSV-1

adenovirus 5

ADV

herpes simplex virus 1

HSV

calreticulin

CRT

lysozyme

Lys

limit of detection

LOD

bioorthogonal nanoparticle detection

BOND

1,2,4,5-tetrazine

Tz

a trans-cyclooctene

TCO

Page 24 of 29

Reference [1] Zhang, B., Liu, B., Zhuang, J., and Tang, D. (2013) Cleavage of metal-ion-induced DNAzymes released from nanolabels for highly sensitive and specific immunoassay, Bioconjug Chem. 24, 678-683. [2] Yu, Y., Liu, Y., Zhen, S. J., and Huang, C. Z. (2013) A graphene oxide enhanced fluorescence anisotropy strategy for DNAzyme-based assay of metal ions, Chem. Commun. 49, 1942-1944. [3] Xiang, Y., and Lu, Y. (2013) An invasive DNA approach toward a general method for portable quantification of metal ions using a personal glucose meter, Chem. Commun. 49, 585-587. [4] Porchetta, A., Vallee-Belisle, A., Plaxco, K. W., and Ricci, F. (2013) Allosterically tunable, DNAbased switches triggered by heavy metals, J. Am. Chem. Soc. 135, 13238-13241. [5] Kalinin, S. V., and Spaldin, N. A. (2013) Materials science. Functional ion defects in transition metal oxides, Science 341, 858-859. [6] Liang, M., Fan, K., Pan, Y., Jiang, H., Wang, F., Yang, D., Lu, D., Feng, J., Zhao, J., Yang, L., et al. (2013) Fe3O4 magnetic nanoparticle peroxidase mimetic-based colorimetric assay for the rapid detection of organophosphorus pesticide and nerve agent, Anal. Chem. 85, 308-312. [7] Roch, A., Gossuin, Y., Muller, R. N., and Gillis, P. (2005) Superparamagnetic colloid suspensions: Water magnetic relaxation and clustering, J. Magn. Magn. Mater. 293, 532-539. [8] Yap, C. K., Cheng, W. H., Karami, A., and Ismail, A. (2016) Health risk assessments of heavy metal


Page 25 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


exposure via consumption of marine mussels collected from anthropogenic sites, Sci.Total Environ. 553, 285-296. [9] Guzman-Hernandez, R., Contreras-Rodriguez, A., Hernandez-Velez, R., Perez-Martinez, I., LopezMerino, A., Zaidi, M. B., and Estrada-Garcia, T. (2016) Mexican unpasteurised fresh cheeses are contaminated with Salmonella spp., non-O157 Shiga toxin producing Escherichia coli and potential uropathogenic E. coli strains: A public health risk, Int. J. Food Microbiol. 237, 10-16. [10] Vu, C. H., Kolata, J., Stentzel, S., Beyer, A., Gesell Salazar, M., Steil, L., Pané-Farré, J., Rühmling, V., Engelmann, S., Götz, F., et al. (2016) Adaptive immune response to lipoproteins of Staphylococcus aureus in healthy subjects, PROTEOMICS 16, 2667-2677. [11] Ganesh, M., Sheikh, N. K., Shah, P., Mehetre, G., Dharne, M. S., and Nagoba, B. S. (2016) Detection of Clostridium tetani in human clinical samples using tetX specific primers targeting the neurotoxin, J INFECT PUBLIC HEAL 9, 105-109. [12] Flores, D., Leblanc, N., and Barroso, J. (2016) Enroling and retaining human immunodeficiency virus (HIV) patients in their care: A metasynthesis of qualitative studies, INT J NURS STUD 62, 126-136. [13] Jung, M., Kuniholm, M. H., Ho, G. Y. F., Cotler, S., Strickler, H. D., Thyagarajan, B., Youngblood, M., Kaplan, R. C., and del Amo, J. (2016) The distribution of hepatitis B virus exposure and infection in a population-based sample of U.S. Hispanic adults, Hepatology 63, 445-452. [14] Arya, S. K., and Bhansali, S. (2011) Lung Cancer and Its Early Detection Using Biomarker-Based Biosensors, Chem. Rev. 111, 6783-6809. [15] Chinen, A. B., Guan, C. M., Ferrer, J. R., Barnaby, S. N., Merkel, T. J., and Mirkin, C. A. (2015) Nanoparticle Probes for the Detection of Cancer Biomarkers, Cells, and Tissues by Fluorescence, Chem. Rev. 115, 10530-10574. [16] Arugula, M. A., Zhang, Y., and Simonian, A. L. (2014) Biosensors as 21st Century Technology for Detecting Genetically Modified Organisms in Food and Feed, Anal. Chem. 86, 119-129. [17] Bakker, E., and Qin, Y. (2006) Electrochemical Sensors, Anal. Chem 78, 3965-3984. [18] Jun, Y.-w., Lee, J.-H., and Cheon, J. (2008) Chemical Design of Nanoparticle Probes for HighPerformance Magnetic Resonance Imaging, Angew. Chem. Int. Ed. 47, 5122-5135. [19] Webb, A. (2012) Increasing the Sensitivity of Magnetic Resonance Spectroscopy and Imaging, Anal. Chem. 84, 9-16. [20] Alcantara, D., Lopez, S., García-Martin, M. L., and Pozo, D. (2016) Iron oxide nanoparticles as magnetic relaxation switching (MRSw) sensors: Current applications in nanomedicine, Nanomedicine 12, 1253-1262. [21] Koh, I., and Josephson, L. (2009) Magnetic nanoparticle sensors, Sensors (Basel) 9, 8130-8145. [22] Na, H. B., Song, I. C., and Hyeon, T. (2009) Inorganic Nanoparticles for MRI Contrast Agents, Adv. Mater. 21, 2133-2148. [23] Lee, N., and Hyeon, T. (2012) Designed synthesis of uniformly sized iron oxide nanoparticles for efficient magnetic resonance imaging contrast agents, Chem. Rev. 41, 2575-2589. [24] Lee, H., Sun, E., Ham, D., and Weissleder, R. (2008) Chip-NMR biosensor for detection and molecular analysis of cells, Nat. Med. 14, 869-874. [25] Bamrungsap, S., Shukoor, M. I., Chen, T., Sefah, K., and Tan, W. (2011) Detection of Lysozyme Magnetic Relaxation Switches Based on Aptamer-Functionalized Superparamagnetic Nanoparticles, Anal. Chem. 83, 7795-7799. [26] Min, C., Shao, H., Liong, M., Yoon, T.-J., Weissleder, R., and Lee, H. (2012) Mechanism of Magnetic Relaxation Switching Sensing, ACS Nano 6, 6821-6828. [27] Laurent, S., Forge, D., Port, M., Roch, A., Robic, C., Vander Elst, L., and Muller, R. N. (2008) Magnetic Iron Oxide Nanoparticles: Synthesis, Stabilization, Vectorization, Physicochemical Characterizations, and Biological Applications, Chem. Rev. 108, 2064-2110. [28] Hong, R., Cima, M. J., Weissleder, R., and Josephson, L. (2008) Magnetic microparticle aggregation for viscosity determination by MR, Magn. Reson. Med. 59, 515-520. [29] Cha, J., Kwon, Y.-S., Yoon, T.-J., and Lee, J.-K. (2013) Relaxivity control of magnetic nanoclusters



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 29

for efficient magnetic relaxation switching assay, Chem. Commun. 49, 457-459. [30] Yang, Y., Zhang, Y., Shen, J.-C., Yang, H., Zhou, Z.-G., and Yang, S.-P. (2016) A highly selective magnetic sensor with functionalized Fe/Fe3O4 nanoparticles for detection of Pb2+, Chin. Chem. Lett. 27, 891-895. [31] Cheon, J., and Lee, J.-H. (2008) Synergistically Integrated Nanoparticles as Multimodal Probes for Nanobiotechnology, Acc. Chem. Res. 41, 1630-1640. [32] Koh, I., Hong, R., Weissleder, R., and Josephson, L. (2009) Nanoparticle−Target Interactions Parallel Antibody−Protein Interactions, Anal. Chem. 81, 3618-3622. [33] Aragay, G., Pons, J., and Merkoci, A. (2011) Recent trends in macro-, micro-, and nanomaterialbased tools and strategies for heavy-metal detection, Chem. Rev. 111, 3433-3458. [34] Tong, S., Hou, S., Zheng, Z., Zhou, J., and Bao, G. (2010) Coating Optimization of Superparamagnetic Iron Oxide Nanoparticles for High T2 Relaxivity, Nano Lett. 10, 4607-4613. [35] Jun, Y.-w., Huh, Y.-M., Choi, J.-s., Lee, J.-H., Song, H.-T., KimKim, Yoon, S., Kim, K.-S., Shin, J.S., et al. (2005) Nanoscale Size Effect of Magnetic Nanocrystals and Their Utilization for Cancer Diagnosis via Magnetic Resonance Imaging, J. Am. Chem. Soc. 127, 5732-5733. [36] Lee, J.-H., Huh, Y.-M., Jun, Y.-w., Seo, J.-w., Jang, J.-t., Song, H.-T., Kim, S., Cho, E.-J., Yoon, H.G., Suh, J.-S., et al. (2007) Artificially engineered magnetic nanoparticles for ultra-sensitive molecular imaging, Nat. Med. 13, 95-99. [37] Jang, J.-t., Nah, H., Lee, J.-H., Moon, S. H., Kim, M. G., and Cheon, J. (2009) Critical Enhancements of MRI Contrast and Hyperthermic Effects by Dopant-Controlled Magnetic Nanoparticles, Angew. Chem. Int. Ed. 48, 1234-1238. [38] Lu, A.-H., Salabas, E. L., and Schüth, F. (2007) Magnetic Nanoparticles: Synthesis, Protection, Functionalization, and Application, Angew. Chem. Int. Ed. 46, 1222-1244. [39] Yoon, T.-J., Lee, H., Shao, H., and Weissleder, R. (2011) Highly Magnetic Core–Shell Nanoparticles with a Unique Magnetization Mechanism, Angew. Chem. Int. Ed. 50, 4663-4666. [40] Choi, J.-s., Choi, H. J., Jung, D. C., Lee, J.-H., and Cheon, J. (2008) Nanoparticle assisted magnetic resonance imaging of the early reversible stages of amyloid β self-assembly, Chem. Commun., 2197-2199. [41] Lee, H., Yoon, T.-J., and Weissleder, R. (2009) Ultrasensitive Detection of Bacteria Using Core– Shell Nanoparticles and an NMR-Filter System, Angew. Chem. Int. Ed. 48, 5657-5660. [42] Xu, C., Xie, J., Ho, D., Wang, C., Kohler, N., Walsh, E. G., Morgan, J. R., Chin, Y. E., and Sun, S. (2008) Au–Fe3O4 Dumbbell Nanoparticles as Dual-Functional Probes, Angew. Chem. Int. Ed. 47, 173-176. [43] Zhang, Y., Zhao, Y., Yang, Y., Shen, J., Yang, H., Zhou, Z., and Yang, S. (2015) A bifunctional sensor based on Au-Fe3O4 nanoparticle for the detection of Cd2+, Sens. Actuators B: Chem. 220, 622-626. [44] Perez, J. M., Simeone, F. J., Saeki, Y., Josephson, L., and Weissleder, R. (2003) Viral-Induced SelfAssembly of Magnetic Nanoparticles Allows the Detection of Viral Particles in Biological Media, J. Am. Chem. Soc. 125, 10192-10193. [45] Atanasijevic, T., Shusteff, M., Fam, P., and Jasanoff, A. (2006) Calcium-sensitive MRI contrast agents based on superparamagnetic iron oxide nanoparticles and calmodulin, Proc. Natl. Acad. Sci. USA 103, 14707-14712. [46] Larsen, B. A., Haag, M. A., Serkova, N. J., Shroyer, K. R., and Stoldt, C. R. (2008) Controlled aggregation of superparamagnetic iron oxide nanoparticles for the development of molecular magnetic resonance imaging probes, Nanotechnology 19, 265102. [47] Rümenapp, C., Gleich, B., Mannherz, H. G., and Haase, A. (2015) Detection of molecules and cells using nuclear magnetic resonance with magnetic nanoparticles, J. Magn. Magn. Mater. 380, 271275. [48] Xu, Z., Kuang, H., Yan, W., Hao, C., Xing, C., Wu, X., Wang, L., and Xu, C. (2012) Facile and


Page 27 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


rapid magnetic relaxation switch immunosensor for endocrine-disrupting chemicals, Biosens. Bioelectron. 32, 183-187. [49] Chen, Y., Zou, M., Wang da, N., Li, Y., Xue, Q., Xie, M., and Qi, C. (2013) An immunosensor based on magnetic relaxation switch and polystyrene microparticle-induced immune multivalency enrichment system for the detection of Pantoea stewartii subsp. Stewartii, Biosens. Bioelectron. 43, 6-11. [50] Wang, S., Zhang, Y., An, W., Wei, Y., Liu, N., Chen, Y., and Shuang, S. (2015) Magnetic relaxation switch immunosensor for the rapid detection of the foodborne pathogen Salmonella enterica in milk samples, Food Control 55, 43-48. [51] Chung, H. J., Pellegrini, K. L., Chung, J., Wanigasuriya, K., Jayawardene, I., Lee, K., Lee, H., Vaidya, V. S., et al. (2015) Nanoparticle Detection of Urinary Markers for Point-of-Care Diagnosis of Kidney Injury, PLoS One 10, e0133417. [52] Zhao, Y., Li, Y., Jiang, K., Wang, J., White, W. L., Yang, S., and Lu, J. (2017) Rapid detection of Listeria monocytogenes in food by biofunctionalized magnetic nanoparticle based on nuclear magnetic resonance, Food Control 71, 110-116. [53] Chung, H. J., Castro, C. M., Im, H., Lee, H., and Weissleder, R. (2013) A magneto-DNA nanoparticle system for rapid detection and phenotyping of bacteria, Nat. Nanotechnol. 8, 369375. [54] Ma, W., Hao, C., Ma, W., Xing, C., Yan, W., Kuang, H., Wang, L., and Xu, C. (2011) Wash-free magnetic oligonucleotide probes-based NMR sensor for detecting the Hg ion, Chem. Commun. 47, 12503-12505. [55] Yigit, M. V., Mazumdar, D., and Lu, Y. (2008) MRI Detection of Thrombin with Aptamer Functionalized Superparamagnetic Iron Oxide Nanoparticles, Bioconjugate Chem. 19, 412-417. [56] Grimm, J., Perez, J. M., Josephson, L., and Weissleder, R. (2004) Novel Nanosensors for Rapid Analysis of Telomerase Activity, Cancer Res. 64, 639-643. [57] Liong, M., Hoang, A. N., Chung, J., Gural, N., Ford, C. B., Min, C., Shah, R. R., Ahmad, R., Fernandez-Suarez, M., Fortune, S. M., et al. (2013) Magnetic barcode assay for genetic detection of pathogens, Nat. Commun. 4, 1752. [58] Xu, L., Yin, H., Ma, W., Wang, L., Kuang, H., and Xu, C. (2013) MRI Biosensor for Lead Detection Based on the DNAzyme-Induced Catalytic Reaction, J. Phys. Chem. B 117, 14367-14371. [59] Perez, J. M., O'Loughin, T., Simeone, F. J., Weissleder, R., and Josephson, L. (2002) DNA-Based Magnetic Nanoparticle Assembly Acts as a Magnetic Relaxation Nanoswitch Allowing Screening of DNA-Cleaving Agents, J. Am. Chem. Soc. 124, 2856-2857. [60] Yang, H., Tian, Z., Wang, J., and Yang, S. (2012) A magnetic resonance imaging nanosensor for Hg (II) based on thymidine-functionalized supermagnetic iron oxide nanoparticles, Sens. Actuators B: Chem. 161, 429-433. [61] Zhang, Y., Shen, J., Yang, H., Yang, Y., Zhou, Z., and Yang, S. (2015) A highly selective magnetic sensor for Cd2+ in living cells with (Zn, Mn)-doped iron oxide nanoparticles, Sens. Actuators B: Chem. 207, Part A, 887-892. [62] Shen, J., Zhang, Y., Yang, H., Yang, Y., Zhou, Z., and Yang, S. (2014) Detection of melamine by a magnetic relaxation switch assay with functionalized Fe/Fe3O4 nanoparticles, Sens. Actuators B: Chem. 203, 477-482. [63] Cai, S., Liang, G., Zhang, P., Chen, H., Zhang, S., Liu, B., and Kong, J. (2011) Rational strategy of magnetic relaxation switches for glycoprotein sensing, Analyst 136, 201-204. [64] Shen, J., Yang, Y., Zhang, Y., Yang, H., Zhou, Z., and Yang, S. (2016) Functionalized Au-Fe3O4 nanocomposites as a magnetic and colorimetric bimodal sensor for melamine, Sens. Actuators B: Chem. 226, 512-517. [65] Haun, J. B., Castro, C. M., Wang, R., Peterson, V. M., Marinelli, B. S., Lee, H., and Weissleder, R. (2011) Micro-NMR for Rapid Molecular Analysis of Human Tumor Samples, Sci. Transl. Med. 3, 71ra16-71ra16. [66] Haun, J. B., Devaraj, N. K., Hilderbrand, S. A., Lee, H., and Weissleder, R. (2010) Bioorthogonal



1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 29

chemistry amplifies nanoparticle binding and enhances the sensitivity of cell detection, Nat. Nanotechnol. 5, 660-665. [67] Haun, J. B., Devaraj, N. K., Marinelli, B. S., Lee, H., and Weissleder, R. (2011) Probing Intracellular Biomarkers and Mediators of Cell Activation Using Nanosensors and Bioorthogonal Chemistry, ACS Nano. 5, 3204-3213. [68] Chen, Y., Xianyu, Y., Wang, Y., Zhang, X., Cha, R., Sun, J., and Jiang, X. (2015) One-Step Detection of Pathogens and Viruses: Combining Magnetic Relaxation Switching and Magnetic Separation, ACS Nano. 9, 3184-3191. [69] Aurich, K., Nagel, S., Glöckl, G., and Weitschies, W. (2007) Determination of the Magneto-Optical Relaxation of Magnetic Nanoparticles as a Homogeneous Immunoassay, Anal. Chem. 79, 580586. [70] Lee, J. H., Huh, Y. M., Jun, Y. W., Seo, J. W., Jang, J. T., Song, H. T., Kim, S., Cho, E. J., Yoon, H. G., Suh, J. S., et al. (2007) Artificially engineered magnetic nanoparticles for ultra-sensitive molecular imaging, Nat. Med. 13, 95-99. [71] Lu, W., Chen, Y., Liu, Z., Tang, W., Feng, Q., Sun, J., and Jiang, X. (2016) Quantitative Detection of MicroRNA in One Step via Next Generation Magnetic Relaxation Switch Sensing, ACS Nano. 10, 6685-6692. [72] Wang, W., Ma, P., Dong, H., Krause, H. J., Zhang, Y., Willbold, D., Offenhaeusser, A., and Gu, Z. (2016) A magnetic nanoparticles relaxation sensor for protein-protein interaction detection at ultra-low magnetic field, Biosens Bioelectron. 80, 661-665. [73] Perez, J. M., Josephson, L., O'Loughlin, T., Hogemann, D., and Weissleder, R. (2002) Magnetic relaxation switches capable of sensing molecular interactions, Nat. Biotechnol. 20, 816-820. [74] Josephson, L., Perez, J. M., and Weissleder, R. (2001) Magnetic Nanosensors for the Detection of Oligonucleotide Sequences, Angew. Chem. Int. Ed 40, 3204-3206. [75] Yin, H., Kuang, H., Liu, L., Xu, L., Ma, W., Wang, L., and Xu, C. (2014) A Ligation DnazymeInduced Magnetic Nanoparticles Assembly for Ultrasensitive Detection of Copper Ions, ACS Appl. Mater. Interfaces 6, 4752-4757.


Page 29 of 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC Graphic


Recent Advances on Magnetic Relaxation ... - ACS Publications

Recommend Documents