Regulatory Sequences for Use in Promoter E - ACS Publications

Subscriber access provided by Kaohsiung Medical University

Article

Library of synthetic Streptomyces regulatory sequences for use in promoter engineering of natural product biosynthetic gene clusters Chang-Hun Ji, Jong-Pyung Kim, and Hahk-Soo Kang ACS Synth. Biol., Just Accepted Manuscript • DOI: 10.1021/acssynbio.8b00175 • Publication Date (Web): 02 Jul 2018 Downloaded from http://pubs.acs.org on July 3, 2018

Just Accepted “Just Accepted” manuscripts have been peer-reviewed and accepted for publication. They are posted online prior to technical editing, formatting for publication and author proofing. The American Chemical Society provides “Just Accepted” as a service to the research community to expedite the dissemination of scientific material as soon as possible after acceptance. “Just Accepted” manuscripts appear in full in PDF format accompanied by an HTML abstract. “Just Accepted” manuscripts have been fully peer reviewed, but should not be considered the official version of record. They are citable by the Digital Object Identifier (DOI®). “Just Accepted” is an optional service offered to authors. Therefore, the “Just Accepted” Web site may not include all articles that will be published in the journal. After a manuscript is technically edited and formatted, it will be removed from the “Just Accepted” Web site and published as an ASAP article. Note that technical editing may introduce minor changes to the manuscript text and/or graphics which could affect content, and all legal disclaimers and ethical guidelines that apply to the journal pertain. ACS cannot be held responsible for errors or consequences arising from the use of information contained in these “Just Accepted” manuscripts.

is published by the American Chemical Society. 1155 Sixteenth Street N.W., Washington, DC 20036 Published by American Chemical Society. Copyright © American Chemical Society. However, no copyright claim is made to original U.S. Government works, or works produced by employees of any Commonwealth realm Crown government in the course of their duties.

Page 1 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

ACS Synthetic Biology

Library of synthetic Streptomyces regulatory sequences for use in promoter engineering of natural product biosynthetic gene clusters Chang-Hun Ji,† Jong-Pyung Kim,‡ and Hahk-Soo Kang*,† †

Department of Biomedical Science and Engineering, Konkuk University, Seoul 05029, Korea Korea Research Institute of Bioscience and Biotechnology (KRIBB), Cheongju, Chungbuk 28116, Korea

‡

*Corresponding Author: Prof. Hahk-Soo Kang, Department of Biomedical Science and Engineering, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 05029, Korea; Telephone: +82-2-450-4136; E-mail: [email protected]

ACS Paragon Plus Environment

ACS Synthetic Biology 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 25

Abstract: Promoter engineering has emerged as a powerful tool to activate transcriptionally silent natural product biosynthetic gene clusters found in bacterial genomes. Since biosynthetic gene clusters are composed of multiple operons, their promoter engineering requires the use of a set of regulatory sequences with a similar level of activities. Although several successful examples of promoter engineering have been reported, its widespread use has been limited due to the lack of a library of regulatory sequences suitable four use in promoter engineering of large, multiple operon-containing biosynthetic gene clusters. Here, we present the construction of a library of constitutively active, synthetic Streptomyces regulatory sequences. The promoter assay system has been developed using a single module non-ribosomal peptide synthetase that produce the peptide blue pigment indigoidine allowing for the rapid screening of a large pool of regulatory sequences. The highly randomized regulatory sequences in both promoter and ribosome binding site regions were screened for their ability to produce the blue pigment, and classified into the strong, medium and weak regulatory sequences based on the strength of a blue color. We demonstrated the utility of our synthetic regulatory sequences for promoter engineering of natural product biosynthetic gene clusters using the actinorhodin gene cluster as a model cluster. We believe that the set of Streptomyces regulatory sequences we report here will facilitate the discovery of new natural products from silent, cryptic biosynthetic gene clusters found in sequenced Streptomyces genomes. Keywords: Streptomyces, promoter engineering, regulatory sequences, biosynthetic gene clusters


Page 3 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Genome mining has emerged as a new paradigm for discovering new natural products from microorganisms.1,2 Although the bioinformatics analysis of sequenced microbial genomes has revealed the presence of a large number of cryptic biosynthetic gene clusters,3,4 the systematic use of genome mining as a platform to generate an array of new metabolites has been limited due to the difficulty of awakening biosynthetic gene clusters silent under normal laboratory culture conditions. Tools that enable the systematic activation of silent biosynthetic gene clusters are therefore in urgent need in order to exploit a large number of cryptic biosynthetic gene clusters present in microbial genomes as a resource for the discovery of new biologically active natural products.5 The rapid development of synthetic biology tools shed a light on addressing this issue. The fundamental difficulty of activating silent biosynthetic gene clusters arises from the complexity of their regulation, which is mostly at the level of transcription.6,7 Synthetic biology tools allow us to re-factor biosynthetic gene clusters in a way to disrupt native transcriptional regulation systems and thus, induce the expression of biosynthetic genes.8 The representative example is promoter engineering in which native regulatory sequences (RSs) that undergo tight regulations by pathway-specific and pleiotropic regulators are replaced with well-characterized RSs.9-13 Therefore, promoter engineering has a potential to become an universal tool for systematic activation of silent biosynthetic gene clusters. Biosynthetic gene clusters are composed of multiple operons, and thus their activation requires the replacement of a number of RSs in a single gene cluster, making promoter engineering a highly timeconsuming process. To address this issue, the yeast-based promoter engineering platform, mCRISTAR, has been recently reported.9 mCRISTAR combines the yeast recombination and the CRISPR/Cas9 system to enable simultaneous replacement of multiple RSs in a single transformation step. However, its widespread use has been limited due to the lack of a robust set of orthogonal regulatory sequences that could effectively induce the high level expression of silent biosynthetic genes. For promoter engineering to be successful, it is very critical to use the set of well-characterized orthogonal RSs. RSs inserted into a single biosynthetic gene cluster should have a balanced level of transcriptional and translational activities to allow for the ideal production of metabolites without causing a significant metabolic load. The additional requirement is that the RSs inserted into a single gene cluster should have a high degree of sequence divergence to avoid the detrimental cross-recombination between RSs that could result in the truncation of a gene cluster. Several examples of constructing libraries of synthetic or natural RSs have been previously reported.14-18 However, all of the synthetic libraries reported so far have been generated by partial randomization of promoter sequences mainly in the spacer region between -10 and -35 regions. Since these libraries are not suited for use in promoter engineering of natural product biosynthetic gene clusters containing multiple promoter regions, we set out to construct a library of constitutively active, synthetic Streptomyces RSs with the highest sequence divergence by simultaneously randomizing both promoter and RBS (ribosome binding site) regions. Here, we report the construction of a library of constitutively active, synthetic Streptomyces RSs that are ideal for promoter engineering of multiple operon-containing natural product biosynthetic gene clusters. The library was constructed by complete randomization of regulatory sequences including both promoter and RBS ACS Paragon Plus Environment


Page 4 of 25

regions. Only conserved sequences are the -10 and -35 consensus sequences recognized by the housekeeping sigma factor HrdB as well as the 6bp Shine-Dalgarno (SD) sequence. The pool of randomized RSs was screened using the single module non-ribosomal peptide synthetase (NRPS) enzyme as a reporter that produces the blue pigment indigoidine. Based on the amount of indigoidine produced, RSs were grouped into strong, medium and weak RSs. Lastly, we demonstrated the utility of our RS library for promoter engineering using the actinorhodin (ACT) biosynthetic gene cluster as a model cluster. Results and Discussions

Construction of the RS assay system: As a first step, we developed an assay system to measure the RS activity using the indigoidine synthetase as a reporter (Figure 1). We envisioned that using a biosynthetic enzyme as a reporter would offer an advantage over other proteins such as GFP (green fluorescence protein) or GUS (β-glucuronidase) when constructing the RS library intended to be used for re-factoring of natural product biosynthetic gene clusters. Although the production level of end products would depend on many factors, the level of RS activity observed in the assay system could be used as a initial indicator to predict their performances in metabolite production, because promoters that are highly active in GFP and GUS assay systems often failed to produce metabolites when inserted in front of biosynthetic genes. The indigoidine synthetase (IndC) is a single module NRPS enzyme that is responsible for the biosynthesis of a blue pigment indigoidine.19,20 Since one single enzyme is responsible for the production of an end product, the strength of a RS inserted in front of the reporter gene would be directly proportional to the amount of indigoidine produced as long as it does not affect the cell growth, and the level of indigoidine production can be measured simply by recording OD600 of the culture supernatant. The RS assay plasmid was constructed on the basis of the Streptomyces vector pIJ10257 that harbors the ϕBT1 integrase, the hygromycin resistance gene (HygR) and the origin of transfer (OriT) sequence (Figure 1).21 First, the two transcriptional terminators, lambda phage T0 and E. coli phage fd,22,23 were placed upstream of the ermE* promoter to avoid any leaky transcription from other indigenous promoters. Then, the yeast element including the CEN/ARS replication origin and the URA3 selectable marker was added between the ermE* and OriT to allow a marker-less modification of the plasmid using yeast recombination.24 Lastly, the indC homolog gene was amplified from the S. albus J1074 genome12 and cloned under the ermE* promoter. The pIJ10257/indC construct was transferred to S. albus J1074, and transformants displayed a blue phenotype, indicating that the indC gene was successfully cloned. To create the RS assay plasmid, the ermE* promoter sequence was completely removed from the pIJ10257/indC, and three restriction enzyme recognition sites including BsrGI, HpaI and HindIII were placed upstream of the RBS region to create a promoter cloning site. This final promoter assay plasmid was designated pIJPT1, and used for all RS assay experiments. Validation of the RS assay system: To test the functionality of our RS assay system, we cloned the four most well-characterized strong Streptomyces constitutive promoters including kasO*p,25 otrBp,26 SF14p,27 and ermE*p28 and compared their promoter strengths (Figure 2a). Only core promoter sequences from the ACS Paragon Plus Environment

Page 5 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


transcription start site to the 10 bp upstream of the -35 region were synthesized as double-stranded DNA fragments, and cloned immediately upstream of the RBS sequence in pIJPT1 using a marker-less recombination in yeast. The four promoter constructs, pIJPT1/kasO*p, pIJPT1/otrBp, pIJPT1/SF14p, and pIJPT1/ermE*p, were isolated from yeast, and transferred to S. albus J1074 to measure the levels of indigoidine production. Since the same RBS sequence was used for all four promoters tested, the difference in the amount of indigoidine production should only correlate with the difference in the promoter strength. The strength of each promoter was evaluated by quantifying the amount of indigoidine accumulated over five days of the culture as the indigoidine production reaches the maximum level in 4 ~ 5 days after inoculation (Figure 2b). Among the four promoters tested, kasO*p showed the strongest promoter activity while the weakest promoter was ermE*p (Figure 2b). In our assay, kasO*p produced an approximately three times larger amount of indigoidine than did ermE*p. The activity of otrBp was slightly lower than that of kasO*p, and SF14p showed twice as much activity as ermE*p, but the weaker activity than otrBp. This result is in agreement with the previous results reported using different promoter assay systems,18,25,26,29 and also indicates that the difference observed in their RS activities is mainly due to the difference in the transcription activities rather than the translation activities. Therefore, the promoter activity is likely to be the major contributing factor that determines the overall expression level of genes. However, the difference in the promoter activity between kasO*p and ermE*p was not as big as the difference observed in the other assay system that used GFP (green fluorescence protein) as a reporter.26 To see if the smaller difference observed in our assay is due to the growth inhibition, we monitored the growth rate and indigoidine production simultaneously for seven days (Figures 2c and 2d). The result showed that the maximum cell density in the stationary phase decreased in order of the increasing promoter strength suggesting that the strongest promoter activity would not always led to the maximum production of metabolites due to the possibility that the high expression of biosynthetic enzymes can cause a metabolic burden to their heterologous hosts. Design of degenerate Streptomyces RSs: Biosynthesis of natural products requires a concerted expression of biosynthetic genes that make up a multiple operon-containing gene cluster in a bacterial genome. For this reason, promoter engineering of biosynthetic gene clusters involves the replacement of a series of native promoter regions with the set of well-characterized synthetic RSs. Another important factor to consider is that synthetic RSs inserted into a single biosynthetic gene cluster should not have an identical sequence of more than 10 consecutive base pairs, as it could cause the detrimental cross-recombination between RSs when replacing multiple RSs simultaneously in yeast, resulting in the truncation of a gene cluster.30 Here, we aimed to construct the library of synthetic, constitutively active RSs that meet these design and are thus optimal for use in promoter engineering of natural product biosynthetic gene clusters (Figure 3). To construct the library of RSs, we analyzed the common features found in promoter regions of the two known strongest Streptomyces promoters, kasO*p and otrBp. The -35 regions were nearly identical with only one bp variation (kasO*p: TTGACA and otrBp: TTGTCA) whereas a higher sequence divergence, three base pair variations (kasO*p: TAAAGT and otrBp: TACGCT), was observed for the -10 region. These consensus ACS Paragon Plus Environment


Page 6 of 25

sequences are likely to be recognized by the Streptomyces housekeeping sigma factor HrdB. The small difference in the spacer length between the -35 and -10 regions was found with the 18 bp and 17 bp spacer lengths for kasO*p and otrBp, respectively. To construct the library of strong, constitutively active RSs, the total 70 bp degenerate RS was designed to include the randomized sequences in both the core promoter and RBS regions (Figure 3a). The 50 bp core promoter region contains the -35 (TTGNCN) and -10 (TANNNT) consensus sequences with the completely randomized 18 bp spacer sequence in the middle and 10 bp flanking sequences on both sides. The 20 bp RBS region is composed of the conserved AGGAGG SD sequence, which was known to drive the strong translation, flanked by the randomized 8 bp upstream and 6 bp downstream sequences. The spacer sequence between the SD sequence and the start codon was kept at 6 bp, as it has been previously known to be an optimal distance for a Actinobacteria translation system.31 The designed degenerate promoter sequence was synthesized as a reverse primer that also include the first 40 bp sequence of the indC gene (homology arm) in pIJPT1 and 20 bp primer sequence to amplify the TRP1 selectable marker (ProRanTRP_RV in table S1). The forward primer was designed to amplify the TRP1 selectable marker with the 40 bp homology sequence to pIJPT1 (ProRanTRP_FW in table S1).

Construction of the library of synthetic Streptomyces RSs: Conventionally, generation of a large pool of degenerate RSs was a challenging task due to the inefficiency of the ligation step for an enzyme-based cloning. To overcome this issue, we used a highly efficient ligation-independent cloning method that utilize a double-strand break-induced recombination in yeast. The TRP1 marker was amplified using the designed set of degenerate primers and cloned into the HpaI-linearized pIJPT1 plasmid in yeast, which yielded approximately 5,000 colonies per plate. The resulting pIJPT1/RanPro constructs were isolated from the two separate yeast plates as a mixture of approximately 10,000 colonies. The isolated construct mixture was transformed into E. coli S17 and transferred to S. albus J1074 via intergenic conjugation. Nearly 10,000 S. albus colonies each harboring unique RS were visually screened, and among the colonies screened approximately 200 colonies displayed a blue phenotype. These hits were re-streaked on the R5A agar plates, and roughly classified into three groups (A, B and C) based on the intensity of a blue color evaluated by visual inspection. Then, the activity of each RS was quantitatively compared by measuring OD600 of the supernatants of the R5A liquid cultures that represents the amount of indigoidine produced. Based on the OD600 values, RSs were re-classified into strong, medium and weak RSs: RSs that displayed OD600 similar to those of kasO*p and otrBp were classified as strong RSs (OD600 1.0 – 1.5), RSs similar to SF14p as medium RSs (OD600 0.7 – 1.0), and RSs similar to ermE*p as weak RSs (OD600 0.4 – 0.7) (Figure 3b). To recover the sequence of each RS, the RS region in the pIJPT1/RanPro plasmid was amplified from the S. albus genomic DNA using an appropriate primer pair, and then Sanger-sequenced. The duplicated RSs and the RSs that showed OD600 below 0.4 were discarded from the library. As a result of screening, the RS library that include total 15 strong RSs, 19 medium RSs, and 21 weak RSs was created (Figure 3c). Among RSs in the library, the RS designated A26 appeared to be the strongest one, which was slightly stronger than the known strongest promoter kasO*p. Interestingly, one base pair deletion in the RBS region was observed for A26, resulting in the 5 bp spacer between SD and the start codon. To verify that this deletion is not an sequencing error, the RS ACS Paragon Plus Environment

Page 7 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


A26 was re-synthesized as a double-stranded DNA fragment and cloned into the empty pIJPT1 RS assay plasmid. The resulting construct still showed a higher promoter activity than kasO*p, suggesting that the deletion mutant was likely to be introduced during the synthesis of the degenerate primer. Although more evidences are needed to define the optimal distance between the SD sequence and start codon, the fact that the deletion mutant created by chance demonstrated the strongest RS activity over other RSs in the library suggests that the 5 bp distance could be optimal for translation initiation at least in Streptomyces albus. To identify predictable features that determine the level of RS activities in the library, we compared the GC contents and translation initiation rates among the strong, medium and weak RS groups (Figure 4). The GC content of RSs in the library varied in the range from 45% to 65%, and the average GC contents slightly increased in order of the increasing RS activities. However, no significant difference was found, suggesting that the GC content is not likely to be a major contributing factor governing the RS activity in the library. It has been previously reported that the translation initiation rates could be predicted with a high degree of confidence from the sequence of 5’-untranslated regions using the RBS calculator.32 Using this tool, we compared the predicted translation initiation rates between the strong, medium and weak RS groups. Although the translation initiation rates differed between the RSs, no significant difference was observed for the average rates between the strong, medium and weak RS groups. It has been previously reported that higher transcriptional activity was associated with higher gene expression levels, although translation rates varies widely.33 Our observation together with the previously published result suggests that the translation initiation rate would not strongly affect the overall RS activity, and the promoter strength governing the transcription rate is likely to be the major contributing factor that determines the overall gene expression level. Construction of synthetic Streptomyces RS cassettes: Potential RSs in biosynthetic gene clusters are the regions from which two genes are divergently transcribed (bidirectional), or where there is a large sequence gap (> 50bp) between two consecutive genes transcribed in the same direction (unidirectional). To enable the use of our RS library for engineering of natural product biosynthetic gene clusters, we designed the set of RS cassettes, each composed of two synthetic RSs placed in opposite directions with a selectable marker or a 360 bp random spacer sequence in the middle (Figure 5a). The overall GC content for each RS cassette was adjusted to the range of 65 – 70%, and the absence of inverted repeat sequences, which could contribute to the formation of secondary structures, was confirmed using the web-based tool, EMBOSS palindrome. Bidirectional or unidirectional RS cassettes could be amplified using 60 bp long cluster-specific primers that contain 40 bp homology sequences to biosynthetic gene clusters and 20 bp primer sequences to the cassettes. Total 26 promoter cassettes were created that include 8 strong, 8 medium and 10 weak RS cassettes. These RS cassettes were synthesized as double-stranded DNA fragments, and used as templates for PCR amplification.

Re-factoring of the ACT gene cluster using synthetic RS cassettes: To demonstrate the utility of our synthetic RS cassettes in engineering natural product biosynthetic gene clusters, we used the actinorhodin (ACT) biosynthetic gene cluster as a model gene cluster, which was cloned from Streptomyces coelicolor ACS Paragon Plus Environment


Page 8 of 25

(Method S1). The transcriptome analysis of S. coelicolor has been previously reported,34 and showed that the ACT cluster harbors total nine promoters (P1 ~ P9). Among these, six promoters (P1 ~ P6) comprise three bidirectional promoter regions, and other four promoters (P7 ~ P10) are unidirectional (Figure 5b). Since the promoter P8 only transcribes the pathway-specific activator gene (actII-ORF4), this promoter was excluded from the re-factoring experiment. The promoters P9 an P10 were also left out as these promoters are located in the middle of biosynthetic genes. First, to see if we can tune the level of the ACT production by controlling the expression of minimal PKS genes, the native bidirectional promoter region (P1 & P2) that transcribes the miniPKS-containing operon was replaced with the RS cassettes with different levels of RS activities (strong: S1, medium: M1, and weak: W1) using yeast recombination and the HIS3 selectable marker (Figure 5b). The ACT cluster inserted with the HIS3 selectable marker without RS was used as a negative control. The four engineered ACT clusters were transformed into S. albus J1074 via intergenic conjugation and integrated into its genome. The three RSengineered ACT gene clusters all produced ACT except for the negative control, but no significant difference in the production level was observed from the HPLC analysis. HPLC analysis of the acid extracts however showed the large production of shunt products, DMAC and aloesponarin II,35 for the ACT cluster engineered with the strong RS cassette (S1), which were not observed for the native ACT cluster and the ACT cluster with the weak RS cassette (W1), and weakly observed for the ACT cluster with the medium RS cassette (M1) (Figures 5b and 5c). This result suggested that the tailoring genes were likely to be expressed in a relatively low level compared to the minimal PKS genes for the engineered ACT cluster with the strong RS cassette (S1). Next, to see if we can convert shunt products to ACT, other promoter regions that drive the transcription of tailoring genes were also replaced with our strong RS cassettes. Total seven promoter regions (P1 ~ P7) in the ACT cluster including three bidirectional (P1 ~ P6) and one unidirectional (P7) promoter regions were replaced with strong RS cassettes simultaneously using the mCRISTAR platform (Figure 6). The CRISPR array that contain the four target cleavage sites was synthesized as a double strand DNA fragment, and cloned into the pCRCT vector. The resulting pCRCT/ACTarray construct was transformed into yeast, and then the four strong RS cassettes harboring the 40 bp homology arms to the ACT cluster were co-transformed with the ACT cluster into yeast expressing the CRISPR components. The transformants were selected on the appropriate drop out agar plate, and the correct insertion of all four RS cassettes were confirmed by PCR-based genotyping and Sanger sequencing. The engineered ACT cluster was lastly transferred to S. albus J1074 for the heterologous expression study. While the native ACT cluster was completely silent in minimal media (Figure 6a), S. albus harboring the ACT cluster engineered with the four strong RS cassettes showed the ACT production indicating that all the genes required for the ACT biosynthesis was successfully activated in a minimal media (Figure 6b). However, S. albus harboring the engineered ACT cluster failed to grow in a rich media. Since ACT has been known to possess a weak antibacterial activity against Gram-positive bacteria,36 it is likely that the significant growth inhibition observed in a rich media is probably due to the high level of ACT production that led to the accumulation of ACT inside cell exceeding the minimum inhibitory concentration. ACS Paragon Plus Environment

Page 9 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Conclusions

With increasing evidences of the presence of a large number of cryptic, silent biosynthetic gene clusters in bacterial genomes, discovering new biologically active natural products from these untapped resources has gained a significant amount of interests. If biosynthetic gene clusters are silent due to native RSs that undergo tight regulations by native transcription factors, promoter engineering could provide a potential solution to overcome native regulation systems, and thus induce the transcription of silent biosynthetic gene clusters. Since most of biosynthetic gene clusters are composed of multiple operons, the success of promoter engineering relies on the use of a set of well-characterized RSs with a balanced level of transcriptional activities but a high sequence divergence. Although a number of RS libraries have been previously reported, these libraries are not suited for engineering biosynthetic gene clusters, as they have been created by partial randomization of the promoter region, and thus still share the significant number of identical sequences. Also, in case the promoter and RBS libraries were constructed separately, it is difficult to predict the overall activity of RSs that are created by random combination of promoter and RBS sequences due to the possibility of the unexpected creation of secondary structures. To overcome this issue, we constructed the RS library by randomizing both promoter and RBS regions simultaneously with the minimum consensus sequences including the -10 and -35 regions in the core promoter region as well as the SD sequence in the RBS region. The use of a NRPS gene as a reporter allowed the selection of RSs that demonstrate the stable production of metabolites without causing a significant metabolic burden to the heterologous host. Using this screening system, we generated the libraries of strong, medium and weak RSs that are similar in their activities to those of kasO*p, SF14p and ermE*p, respectively. As we demonstrated using the ACT cluster, the RS cassettes described here could be used in conjunction with the previously reported mCRISTAR platform to enable multiplex promoter engineering of multiple operoncontaining natural product biosynthetic gene clusters in yeast. The collection of constitutively active Streptomyces RSs we report here could be useful not only in activating silent biosynthetic gene clusters identified from microbial genome sequencing, but also will have an application to engineering previously characterized biosynthetic gene clusters that produce clinically useful natural products in order to improve the production yield. Taken together, we believe that the library of synthetic Streptomyces RSs we report here would be able to be utilized as an useful tool in an effort to boost natural products research in the post-genomic era.



Page 10 of 25

Materials and methods: Bacterial strains and culture conditions. A yeast strain of S. cerevisiae BY472737 with the genotype of MATα his3∆200::leu2∆0::lys2∆0::met15∆0::trp1∆63::ura3∆0 (ATCC No. 200889) was used for all cloning and promoter engineering experiments. The yeast strain was maintained on YPD agar plates and grown overnight at 30 °C (2000 rpm) prior to transformation. The LiAc/ss carrier DNA/PEG yeast transformation protocol was used for all yeast transformation experiments.38 The positive selection of any genetic modification was made on the appropriate amino acid dropout SC (Synthetic Composite) media (Sigma). Escherichia coli S17 was used to transfer DNA to Streptomyces via intergenic conjugation. Streptomyces albus J1074, which was used to host the promoter library, was maintained on the ISP4 agar plates and cultured in the R5A liquid media for the metabolite production. Construction of the indigoidine synthetase gene-based RS assay vector. The 3.8 kb indC homolog gene was amplified from the S. albus J1074 genomic DNA using the forward and reverse primers (SAIS_HR_FW and SAIS_HR_RV in the table S1) containing the 40 bp homology sequences to the pIJ1057 vector and the 40 bp overlapping sequence to the yeast element, respectively. The 1.8 kb yeast element that includes the CEN (centromere sequence) and URA3 sequences were amplified from the pTARa vector39 using the forward primer (ARSURA_HR_FW) containing the 40 bp overlapping sequence to the indC homolog gene and the reverse primer (ARSURA_HR_RV) containing the 40 bp homology sequence to the pIJ10257 (Table S1). The same PCR condition was used for both reactions. Briefly, the total volume of 50 µL included 10 µl of the 5X Q5 buffer, 4 µL of dNTPs (2.5 mM), 2.5 µL of each primer (10 µM), 0.5 µl of Q5 High-Fidelity DNA polymerase (NEB), 1 µL of template, 10 µL of 5X Q5 enhance and 19.5 µL of water. The PCR reaction was performed using a thermocycler as follows: initial denaturation (98 °C, 30 sec), 30 cycles of denaturation (98 °C, 10 s), annealing (60 °C, 15 s) and extension (72 °C, 2 min), and a final extension (72 °C, 10 min). The resulting PCR products were column-purified and diluted in TE buffer to a concentration of 100 ng/µl prior to transformation. One microgram of pIJ10257 was digested with PacI for 4 hrs. Then, the digested pIJ10257 and the two PCR products were transformed into yeast for the assembly, and transformants were selected on the URA dropout SC agar plate. The resulting plasmid designated pIJIS1 was isolated from yeast using a zymolyase protocol, and transferred to S. albus J1074. Production of a blue pigment by S. albus J1074 harboring pIJIS1 confirmed that the indigoidine synthetase gene was successfully cloned. To create the promoter assay plasmid, the DNA fragment containing the two terminators (fd and phage T0), three enzyme sites (BsrGI, HpaI and HindIII) and two 40 bp homology arms on both ends, which were designed to remove the ermE* promoter region in pIJIS1, was synthesized as a gBlock fragment from IDT (integrated DNA technologies). The synthesized DNA (100 ng) was transformed into yeast along with the KpnI-linearized pIJIS1 plasmid (100 ng) to create the RS assay plasmid designated pIJPT1. DNAs were isolated from few colonies, and the upstream region of the indigoidine synthetase gene was Sanger-sequenced to confirm the error-free creation of the promoter cloning site in pIJPT1. ACS Paragon Plus Environment

Page 11 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Construction of the RS library. The TRP1 auxotrophic marker was amplified using the 60 bp forward primer (ProRanTRP_FW) containing the homology sequence to the first 40 bp sequence of the indigoidine synthetase gene and the 20 bp primer sequence, and the 130 bp degenerate reverse primer (ProRanTRP_RV) containing the 40 bp homology sequence to pIJPT1, the 70 bp degenerate RS sequence and the 20 bp primer sequence (Table S1). The PCR reaction was performed in a total volume of 50 µL containing 10 µl of the 5X MyTaq reaction buffer, 2.5 µL of each primer (10 µM), 0.5 µL of MyTaq DNA polymerase (BIOLINE), 1 µL of template (50 ng), and 33.5 µL of dH2O using a thermocycler as follows: initial denaturation (95 °C, 5 min), 35 cycles of denaturation (95 °C, 30 s), annealing (55 °C, 30 s) and extension (72 °C, 1 min), and a final extension (72 °C, 10 min). The resulting PCR product was column-purified and diluted in TE buffer to a concentration of 100 ng/µl. One microgram of the HpaI-linearized pIJPT1 plasmid was transformed into yeast along with 1 µg of the PCR product, and selected on the URA and TRP dropout SC agar plates. Approximately 5,000 colonies were observed from each plate. Approximately 10,000 colonies on the two separate plates were collected to a single 10 ml conical tube. Mixed cells each containing an unique RS sequence were precipitated by centrifuge at 12,000 rpm for 1 min, and the DNA mini-prep was performed using zymolyase lysis protocol (ZYMO RESEARCH). The isolated DNA mixture was transformed into E. coli S17, and transferred to S. albus J1074. The transformants were selected on the ISP4 agar plate containing the hygromycin (100 µg/mL) and nalidixic acid (25 µg/mL). Colonies that displayed a blue phenotype were visually selected, re-streaked on the R5A agar plates and roughly classified into three groups (A, B and C) based on the intensity of a blue color. Visually selected colonies were inoculated into 20 ml of the R5A liquid media in 50 ml conical tubes, and cultured in a shaking incubator (200 rpm, 30 °C) for 5 days. Then, 1 ml aliquot of each culture was centrifuged at 12,000 rpm for 10 min, and then 200 µL of the supernatant was mixed with 900 µL of dimethyl sulfoxide (DMSO) and used for measuring OD at 600 nm. All experiments were performed in triplicate. The blue colonies were divided into strong, medium and weak based on their OD600 values (strong: OD600 1.0 ~ 1.5; medium: OD600 0.7 ~ 1.0; weak: OD600 0.4 ~ 0.7). To recover the RS sequences from the library, each colony was cultured in a TSB liquid media for 3 days, and a genomic DNA was isolated for sequencing. The RS region was amplified from the S. albus genomic DNA using primers, pIJPT1_TRP1_FW and pIJPT1_scree_RV (Table S1). A total volume of 20 µL contained 4 µl of the 5X MyTaq reaction buffer, 2.5 µL of each primer (10 µM), 0.2 µL of MyTaq DNA polymerase (BIOLINE), 1 µL of template, and 9.8 µL of dH2O. The PCR reaction was performed using a thermocycler as follows: initial denaturation (95 °C, 5 min), 35 cycles of denaturation (95 °C, 30 s), annealing (55 °C, 30 s) and extension (72 °C, 30 s), and a final extension (72 °C, 10 min). The resulting PCR products were column-purified, dissolved in 50 µL of TE buffer and sequenced by Sanger sequencing (Macrogen). Construction of RS cassettes. To allow for engineering of biosynthetic gene clusters using our RS library, the set of RS cassettes were designed to contain two oppositely placed RSs with an auxotrophic marker or a 360 bp spacer sequence between RSs. The RS cassettes with auxotrophic markers were constructed by amplifying the HIS3 or LEU2 selectable markers with forward and reverse primers both containing the 70 bp RSs and 20 bp primer sequences. The PCR reaction was performed in a total volume of 50 µL contained 10 µl of the 5X ACS Paragon Plus Environment


Page 12 of 25

MyTaq reaction buffer, 2.5 µL of each primer (10 µM), 0.5 µL of MyTaq DNA polymerase (BIOLINE), 1 µL of template, and 33.5 µL of water using a thermocycler as follows: initial denaturation (95 °C, 5 min), 35 cycles of denaturation (95 °C, 30 s), annealing (55 °C, 30 s) and extension (72 °C, 1 min), and a final extension (72 °C, 10 min). Marker-free promoter cassettes were synthesized as 500 bp gBlock gene fragments from IDT that contain two 70 bp oppositely positioned RS sequences and 360 bp random spacer sequences between RSs. The resulting marker-containing or marker-free RS cassettes were used as templates to amplify clusterspecific RS cassettes for re-factoring experiments. Re-factoring of the ACT biosynthetic gene cluster. For the replacement of a single bidirectional promoter region, the strong, medium or weak RS cassette containing the HIS3 selectable marker was amplified using a primer sets that contain the cassette primer sequence and 40 bp homology sequences to the ACT cluster (ACT_PE1_SAS1_FW ~ ACT_PE1_SAW1_RV in table S1). The PCR reaction was performed in a total volume of 50 µL that contained 10 µl of the 5X MyTaq reaction buffer, 2.5 µL of each primer (10 µM), 0.5 µL of MyTaq DNA polymerase (BIOLINE), 1 µL of template, and 33.5 µL of water using a thermocycler as follows: initial denaturation (95 °C, 5 min), 35 cycles of denaturation (95 °C, 30 s), annealing (55 °C, 1 min) and extension (72 °C, 2 min), and a final extension (72 °C, 10 min). The resulting PCR products were columnpurified and diluted in TE buffer to a concentration of 200 ng/µL. Then, pTARa:ACT was co-transformed with the cluster-specific RS cassettes into yeast using the LiAc/ss carrier DNA/PEG transformation method. The transformants were selected on TRP HIS dropout SC agar plates. Four colonies were picked from each plate and cultured in a 1.5 ml of corresponding dropout SC liquid media and grown overnight. The DNA mini-prep was performed with the overnight cultures using a zymolyase lysis protocol (ZYMO RESEARCH). Correct insertion of the promoter cassettes was confirmed by PCR-based genotyping using the primer sets (Table S1) that generate amplicons bridging between the ACT cluster and newly inserted promoter cassettes. The promoter-engineered ACT clusters were shuttled into S. albus J1074 via intergenic conjugation, and integrated into its genome. For the quantification of ACT production, S. albus J1074 harboring the re-factored ACT cluster was grown in 20 ml of the R5A liquid media in a 50 ml conical tube for 5 days at 30 °C with shaking (200 rpm). The cultures were extracted with the 20 ml of ethyl acetate, and dried in vacuo. The resulting extracts were dissolved in the final volume 500 ul of methanol and used for HPLC and LC-MS analysis. The production of ACT or shunt production were confirmed by HPLC analysis (HPLC conditions: 30 min gradient from 5% to 100% aqueous acetonitrile containing 0.1% trifluoroacetic acid, C18, 4.6 mm × 150 mm, 1mL/min). For multiplex re-factoring of the ACT gene cluster, the CRISPR array containing 20 bp target sequences to four promoter regions in the ACT cluster was synthesized as a gBlock fragment from IDT. A synthetic CRISPR array was cloned into pCRCT using a golden gate cloning in a total reaction volume of 15 µL containing 1 µL of the gBlock fragment (10 ng/µl), 1 µL of pCRCT (100 ng/µl), 1.5 µL of T4 DNA ligase reaction buffer, 1.5 µl of 10X BSA, 1 µl of BsaI (NEB), 1 µl of T4 DNA ligase (NEB) and 8 µL of dH2O was mixed in a PCR tube. The reaction was performed using a thermocycler as follows: 25 cycles of 3 min at 37 °C and 4 min at 16 °C, and then 1 cycle of 5 min at 50 °C and 5 min at 80 °C. Five microliters of the reaction mixture was transformed into E. coli EC100 by electroporation, and transformants were selected on LB agar plates containing 100 µg/ml of ACS Paragon Plus Environment

Page 13 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


ampicillin. The correct incorporation of a CRISPR array into pCRCT was confirmed by Sanger sequencing of mini-prep DNA using a sequencing primer pCRCT_seq (Table S1). Then, pCRCT:ACT (pCRCT containing the ACT CRISPR array) was transformed into yeast, and transformants were selected on a URA dropout SC agar plate. For the multiplex re-factoring, two marker-containing strong RS cassettes (HIS3 and LEU2), and two marker- free strong cassettes were amplified to contain 40 bp homology sequences to the ACT cluster. The resulting PCR products were column-purified and dissolved in TE to the concentration of 400 ng/ul. The four cluster-specific RS cassettes were co-transformed with pTARa:ACT into yeast containing a pCRCT:ACT, and selected on a URA, TRP, LEU and HIS dropout SC agar plate. After five days of incubation at 30 °C, a few colonies were picked, inoculated into the same liquid dropout SC media and cultured overnight with shaking (200 rpm). The 1.5 ml of overnight cultures were used for yeast mini-prep using a zymolyase lysis protocol. The correct insertion of all four RS cassettes was confirmed by PCR-based genotyping using the primer sets (ACT_GT_1_FW ~ ACT_GT_4_RV in table S1) that generate amplicons bridging between the gene cluster and RS cassette. Finally, the re-factored ACT cluster was transferred to S. albus for the heterologous expression study in the same way as described above.



Page 14 of 25

Supporting Information The Supporting Information is available free of charge on the ACS Publication website at DOI: The list of primers and double stranded DNA fragments used in this study: the list of synthetic strong, medium and weak regulatory sequences; the map of the RS assay vector pIJPT1; the experimental protocol of ACT cluster cloning Author Information Corresponding Author: *Prof. Hahk-Soo Kang, Department of Biomedical Science and Engineering, Konkuk University, 120 Neungdong-ro, Gwangjin-gu, Seoul 05029, Korea; Telephone: +82-2-450-4136; Email: [email protected] Author contributions: C.-H.J. and H.-S.K. designed and conducted the experiments. J.-P.K. provided some reagents, and helped design the experiment. C.-H.J. and H.-S.K. analyzed the data and wrote the manuscript. Notes: The authors declare no conflict of interest. Acknowledgments This work was supported by Next-Generation BioGreen21 Program (PJ0131892018) and the National Research Foundation (NRF-2016R1D1A1B03930103).


Page 15 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


References 1. Machado, H., Tuttle, R. N., and Jensen, P. R. (2017) Omics-based natural product discovery and the lexicon of genome mining, Curr. Opin. Microbiol. 39, 136-142. 2. Pan, G., Xu, Z., Guo, Z., Hindra, Ma, M., Yang, D., Zhou, H., Gansemans, Y., Zhu, X., Huang, Y., Zhao, L. X., Jiang, Y., Cheng, J., Van Nieuwerburgh, F., Suh, J. W., Duan, Y., and Shen, B. (2017) Discovery of the leinamycin family of natural products by mining actinobacterial genomes, Proc. Natl. Acad. Sci. U S A 114, E11131-E11140. 3. Cimermancic, P., Medema, M. H., Claesen, J., Kurita, K., Brown, L. C. W., Mavrommatis, K., Pati, A., Godfrey, P. A., Koehrsen, M., Clardy, J., Birren, B. W., Takano, E., Sali, A., Linington, R. G., and Fischbach, M. A. (2014) Insights into Secondary Metabolism from a Global Analysis of Prokaryotic Biosynthetic Gene Clusters, Cell 158, 412-421. 4. Doroghazi, J. R., Albright, J. C., Goering, A. W., Ju, K. S., Haines, R. R., Tchalukov, K. A., Labeda, D. P., Kelleher, N. L., and Metcalf, W. W. (2014) A roadmap for natural product discovery based on large-scale genomics and metabolomics, Nat. Chem. Biol. 10, 963-968. 5. Jensen, P. R., Chavarria, K. L., Fenical, W., Moore, B. S., and Ziemert, N. (2014) Challenges and triumphs to genomics-based natural product discovery, J. Ind. Microbiol. Biotechnol. 41, 203-209. 6. Craney, A., Ahmed, S., and Nodwell, J. (2013) Towards a new science of secondary metabolism, J. Antibiot. (Tokyo) 66, 387-400. 7. Liu, G., Chater, K. F., Chandra, G., Niu, G., and Tan, H. (2013) Molecular regulation of antibiotic biosynthesis in streptomyces, Microbiol. Mol. Biol. Rev. 77, 112-143. 8. Scherlach, K., and Hertweck, C. (2009) Triggering cryptic natural product biosynthesis in microorganisms, Org. Biomol. Chem. 7, 1753-1760. 9. Kang, H. S., Charlop-Powers, Z., and Brady, S. F. (2016) Multiplexed CRISPR/Cas9- and TAR-Mediated Promoter Engineering of Natural Product Biosynthetic Gene Clusters in Yeast, ACS Synth. Biol. 5, 1002-1010. 10. Luo, Y., Huang, H., Liang, J., Wang, M., Lu, L., Shao, Z., Cobb, R. E., and Zhao, H. (2013) Activation and characterization of a cryptic polycyclic tetramate macrolactam biosynthetic gene cluster, Nat. Commun. 4, 2894. 11. Montiel, D., Kang, H. S., Chang, F. Y., Charlop-Powers, Z., and Brady, S. F. (2015) Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters, Proc. Natl. Acad. Sci. U S A 112, 8953-8958. 12. Olano, C., Garcia, I., Gonzalez, A., Rodriguez, M., Rozas, D., Rubio, J., Sanchez-Hidalgo, M., Brana, A. F., Mendez, C., and Salas, J. A. (2014) Activation and identification of five clusters for secondary metabolites in Streptomyces albus J1074, Microb. Biotechnol. 7, 242-256. 13. Shao, Z., Rao, G., Li, C., Abil, Z., Luo, Y., and Zhao, H. (2013) Refactoring the Silent Spectinabilin Gene Cluster Using a Plug-and-Play Scaffold, ACS Synth. Biol. 2, 662-669. 14. Bai, C., Zhang, Y., Zhao, X., Hu, Y., Xiang, S., Miao, J., Lou, C., and Zhang, L. (2015) Exploiting a precise design of universal synthetic modular regulatory elements to unlock the microbial natural products in Streptomyces, Proc. Natl. Acad. Sci. U S A 112, 12181-12186. 15. Seghezzi, N., Amar, P., Koebmann, B., Jensen, P. R., and Virolle, M. J. (2011) The construction of a library of synthetic promoters revealed some specific features of strong Streptomyces promoters, Appl. Microbiol. Biotech. 90, 615-623. 16. Siegl, T., Tokovenko, B., Myronovskyi, M., and Luzhetskyy, A. (2013) Design, construction and characterisation of a synthetic promoter library for fine-tuned gene expression in actinomycetes, Metab. Eng. 19, 98-106. 17. Sohoni, S. V., Fazio, A., Workman, C. T., Mijakovic, I., and Lantz, A. E. (2014) Synthetic promoter library for modulation of actinorhodin production in Streptomyces coelicolor A3(2), PLoS One 9, e99701. 18. Luo, Y., Zhang, L., Barton, K. W., and Zhao, H. (2015) Systematic Identification of a Panel of Strong Constitutive Promoters from Streptomyces albus, ACS Synth. Biol. 4, 1001-1010. 19. Reverchon, S., Rouanet, C., Expert, D., and Nasser, W. (2002) Characterization of indigoidine Biosynthetic genes in Erwinia chrysanthemi and role of this blue pigment in pathogenicity, J. Bacteriol. 184, 654-665. 20. Takahashi, H., Kumagai, T., Kitani, K., Mori, M., Matoba, Y., and Sugiyama, M. (2007) Cloning and characterization of a Streptomyces single module type non-ribosomal peptide synthetase catalyzing a blue pigment synthesis, J. Biol. Chem. 282, 9073-9081. 21. Hong, H. J., Hutchings, M. I., Hill, L. M., and Buttner, M. J. (2005) The role of the novel Fem protein VanK in vancomycin resistance in Streptomyces coelicolor, J. Biol. Chem. 280, 13055-13061. ACS Paragon Plus Environment


Page 16 of 25

22. Scholtissek, S., and Grosse, F. (1987) A cloning cartridge of lambda t(o) terminator, Nucleic Acids Res. 15, 3185. 23. Ward, J. M., Janssen, G. R., Kieser, T., Bibb, M. J., Buttner, M. J., and Bibb, M. J. (1986) Construction and characterisation of a series of multi-copy promoter-probe plasmid vectors for Streptomyces using the aminoglycoside phosphotransferase gene from Tn5 as indicator, Mol. Gen. Genet. 203, 468-478. 24. Joska, T. M., Mashruwala, A., Boyd, J. M., and Belden, W. J. (2014) A universal cloning method based on yeast homologous recombination that is simple, efficient, and versatile (vol 100, pg 46, 2014), J. Microbiol. Meth. 102, 65-65. 25. Wang, W., Li, X., Wang, J., Xiang, S., Feng, X., and Yang, K. (2013) An engineered strong promoter for streptomycetes, Appl. Environ. Microbiol. 79, 4484-4492. 26. Wang, W. S., Yang, T. J., Li, Y. H., Li, S. S., Yin, S. L., Styles, K., Corre, C., and Yang, K. Q. (2016) Development of a Synthetic Oxytetracycline-Inducible Expression System for Streptomycetes Using de Novo Characterized Genetic Parts, ACS Synth. Biol. 5, 765-773. 27. Labes, G., Bibb, M., and Wohlleben, W. (1997) Isolation and characterization of a strong promoter element from the Streptomyces ghanaensis phage I19 using the gentamicin resistance gene (aacC1) of Tn1696 as reporter, Microbiology-Uk 143, 1503-1512. 28. Bibb, M. J., Janssen, G. R., and Ward, J. M. (1985) Cloning and analysis of the promoter region of the erythromycin resistance gene (ermE) of Streptomyces erythraeus, Gene 38, 215-226. 29. Myronovskyi, M., and Luzhetskyy, A. (2016) Native and engineered promoters in natural product discovery, Nat. Prod. Rep. 33, 1006-1019. 30. Hua, S. B., Qiu, M. S., Chan, E., Zhu, L., and Luo, Y. (1997) Minimum length of sequence homology required for in vivo cloning by homologous recombination in yeast, Plasmid 38, 91-96. 31. Horbal, L., Siegl, T., and Luzhetskyy, A. (2018) A set of synthetic versatile genetic control elements for the efficient expression of genes in Actinobacteria, Sci. Rep. 8, 491. 32. Salis, H. M., Mirsky, E. A., and Voigt, C. A. (2009) Automated design of synthetic ribosome binding sites to control protein expression, Nat. Biotechnol. 27, 946-950. 33. Johns, N. I., Gomes, A. L. C., Yim, S. S., Yang, A., Blazejewski, T., Smillie, C. S., Smith, M. B., Alm, E. J., Kosuri, S., and Wang, H. H. (2018) Metagenomic mining of regulatory elements enables programmable species-selective gene expression, Nature Methods. 15, 323-329. 34. Jeong, Y., Kim, J. N., Kim, M. W., Bucca, G., Cho, S., Yoon, Y. J., Kim, B. G., Roe, J. H., Kim, S. C., Smith, C. P., and Cho, B. K. (2016) The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2), Nat. Commun. 7. 35. Taguchi, T., Yabe, M., Odaki, H., Shinozaki, M., Metsa-Ketela, M., Arai, T., Okamoto, S., and Ichinose, K. (2013) Biosynthetic conclusions from the functional dissection of oxygenases for biosynthesis of actinorhodin and related Streptomyces antibiotics, Chem. Biol. 20, 510-520. 36. Nass, N. M., Farooque, S., Hind, C., Wand, M. E., Randall, C. P., Sutton, J. M., Seipke, R. F., Rayner, C. M., and O'Neill, A. J. (2017) Revisiting unexploited antibiotics in search of new antibacterial drug candidates: the case of gamma-actinorhodin, Sci. Rep. 7, 17419. 37. Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P., and Boeke, J. D. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCRmediated gene disruption and other applications, Yeast 14, 115-132. 38. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method, Nat. Protoc. 2, 31-34. 39. Kim, J. H., Feng, Z., Bauer, J. D., Kallifidas, D., Calle, P. Y., and Brady, S. F. (2010) Cloning large natural product gene clusters from the environment: piecing environmental DNA gene clusters back together with TAR, Biopolymers 93, 833-844.


Page 17 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure captions: Figure 1. Overview of the indigoidine synthetase-based promoter assay system. The RS assay plasmid designated pIJPT1 was constructed using the single module NRPS enzyme indigoidine synthetase as a reporter. The core promoter sequence could be synthesized as a double strand DNA fragment and cloned into the cloning site located between the terminator and RBS sequences upstream of the indigoidine synthetase gene. Then, the promoter construct is transferred to a heterologous host, and the level of indigoidine production is measured simply by recording OD of the culture supernatant at 600 nm. Figure 2. Characterization of the ermE*, SF14, kasO* and otrB promoters. (a) To test the functionality of our RS assay system, the four promoter constructs were created using the most well-characterized strong Streptomyces constitutive promoters including ermE*p, SF14p, kasO*p and otrBp. (b) Indigoidine production was measured by recording OD600 of the ten-fold diluted culture supernatants in DMSO. The comparison of indigoidine production demonstrated that among the four promoters tested kasO*p showed the strongest promoter activity while the weakest promoter was ermE*p. (c) The time-course experiment of indigoidine production was conducted to determine the time point at which the indigoidine production reaches a maximum. (d) The cell density was monitored over time to evaluate the effect of the level of indigoidine production on cell growth. Figure 3. Construction of the library of synthetic Streptomyces RSs. (a) The pool of approximately 10,000 unique RSs was created by randomizing both the promoter and RBS regions except for the -10 and -35 consensus sequences in the core promoter region and the Shine-Dalgarno sequence in the RBS region. (b) kasO*p, SF14 and ermE*p were used as references for the classification of RSs based on their activities. The RS activity was measured by recording OD600 of the five-fold diluted culture supernatants in DMSO. RSs that displayed OD600 similar to that of kasO*p were classified as strong RSs, OD600 similar to SF14 as medium RSs, and OD600 similar to ermE*p as weak RSs. (c) As a result of screening, we recovered the total 55 unique synthetic RS sequences including the sequences of 15 strong, 19 medium and 21 weak RSs. Figure 4. Comparison of GC contents and predicted translation initiation rates between the strong, medium and weak RS libraries. (a) The comparison of average GC contents between the strong, medium and weak RS libraries. (b) The predicted translation initiation rates for the strong, medium and weak libraries. The translation initiation rate of 5’-untranslated region for each RS in the libraries was predicted using the RBS calculator v2.0. Of the predicted values, the graph shows only the highest (brown bar), lowest (blue bar) and average (grey bar) values for each library. Figure 5. Re-factoring of the ACT biosynthetic gene cluster using synthetic RS cassettes. (a) We created bidirectional RS cassettes with the synthetic RS sequences to allow for re-factoring of biosynthetic gene clusters either to activate silent biosynthetic gene clusters or to improve the production yield of known ACS Paragon Plus Environment


Page 18 of 25

metabolites. Synthetic RS cassettes with the HIS3 selectable marker were constructed by placing two RSs in opposite directions, and the HIS3 marker gene sequence between them. For the marker-free promoter cassettes, the HIS3 marker was replaced with 360 bp random spacer sequences. (b) The bidirectional promoter region (P1 & P2) in the ACT cluster that transcribes the minPKS-containing operon was re-factored with the strong, medium or weak RS cassette. The level of ACT and shunt products produced by the native or re-factored ACT gene clusters were compared by HPLC analysis. (C) The phenotype comparison on the R5A rich media between the native and re-factored ACT biosynthetic gene clusters. Figure 6. Multiplex re-factoring of the ACT gene cluster using mCRISTAR. (a) Heterologous expression of the native ACT gene cluster in S. albus J1074 led to the ACT production in the R5A rich media, but showed no ACT production in the ISP4 minimal media indicating that the ACT gene cluster is silent in a minimal media. (b) The total seven promoter regions in the ACT gene cluster were simultaneously replaced with our strong synthetic RS cassettes using the mCRISTAR platform, and the re-factored ACT gene cluster produced ACT in the minimal media.


Page 19 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 1 S. albus

kasO*p

ermE*p

Promoter Cloning Site BsrGI

HpaI

HindIII

strong1

RBS

TGTACACTGCGGTTAACGATGAAAGCTTGAACAGGAGGCCCCATATG

weak2

synthesized promoter

terminator

Indigoidine synthetase O

recombination

HygR

pIJPT1 phi-BT1 integrase

CEN/ARS

NH 2

HN O

OD600

O NH

H 2N

O

strong2

indigoidine weak1

URA3

strong

medium

weak

medium1 medium2



Figure 2

(a)

(b)

Indigoidine production 0.6

SF14p

ermE*p

pIJPT1/SF14p

kasO*p

OD600

pIJPT1/ermE*p

otrBp

pIJPT1/kasO*p

0.4

0.2

pIJPT1/otrBp

(c)

Indigoidine production

ot rB

ka sO *

empty vector ermE* SF14 kasO*

0.4

OD600

0.4

Cell growth 0.6

empty vector ermE* SF14 kasO* otrB

0.6

(d)

SF

Ba ck gr ou nd

er m

E*

14

0

OD600

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 25

otrB

0.2

0.2

0

0

1

2

3

4

days

5

6

7

1

2

3

4

5

6

days


7

Page 21 of 25

Figure 3

(a)

(b)

Randomized regulatory sequence -35

RBS

-10

TRP1

RV

NNN NNNNNNN

Indigoidine synthase

40bp

TRP1

yeast recombination

OD600

NNNNNNNNNNTTGNCNNNNNNNNNNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNAGGAGGNNNNNNATG

pIJPT1/RandomP

40bp

screening in S. albus

(c)

Indigoidine production 1.4 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4

St ro M ng ed iu m W ea k ot rB Ka sO * SF 14 er m E*

FW

1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2

kasO* A01 A09 A12 A13 A15 A17 A26 A35 A36 A37 A46 A48 A51 A56 C06 SF14 A04 A05 A07 A10 A20 A25 A29 A34 A41 A44 A47 A49 B01 B26 B29 B38 B42 B46 B55 ermE* A31 A32 B11 B16 B19 B21 B24 B25 B27 B28 B31 B35 B36 B40 B41 B45 B52 B56 B57 C01 C02

OD600

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


strong

medium


weak


Figure 4

(a)

GC content

Percentage (%)

70 65 60 55 50 45 40

Strong Medium

(b)

Weak

Predicted translation initiation rate HIghest

Lowest

Average

2500

Arbitrary Unit

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

2000 1500 1000 500 0

Strong Medium Weak


Page 22 of 25

Page 23 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


Figure 5

(a)

(b) with marker

marker-free

HIS3 RS (70bp)

RS (70bp)

P9

P6 P5

P10 P7

P4 P3

P8

P2 P1

360bp spacer RS (70bp)

RS (70bp)

ACT

(c) S1: ACT +shunts

W1

ProKO

W1

HIS

W1_HIS

M1

HIS

M1_HIS

HIS

S1_HIS

HIS

ProKO

M1

shunts

native: ACT

S1 S1 ProKO

ProKO

M1: ACT +shunts

ACT

ACT

W1: ACT

10

12

13

15

17

18

20 min

20 22 23 25 27 28 30 min



Figure 6

(a)

native ACT gene cluster

Heterologous expression in S. albus rich media (R5A)

minimal media (ISP4)

ACT production

(b)

1!

2!

3!

silent

4!

CRISPR array 4

3 P6 P5

P7

2

1

P4 P3

P2 P1

mCRISTAR

LEU

HIS

strong RS cassettes Heterologous expression in S. albus rich media (R5A)

minimal media (ISP4)

Inhibited growth

ACT production


Page 24 of 25

Page 25 of 25 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60


TOC graphic Randomized Regulatory Sequence

S. albus

N10-TTGNCN-N18-TANNNT-N18-AGGAGG-N6-ATG

pIJPT1 assay plasmid

OD600 O

NH 2

HN O

O NH

H 2N

Promoter Engineering

strong

medium

O

weak

RS library


Regulatory Sequences for Use in Promoter E - ACS Publications

Recommend Documents