RNA Internal Standard Synthesis by Nucleic Acid Sequence-Based

Anal. Chem. 2007, 79, 1548-1554

RNA Internal Standard Synthesis by Nucleic Acid Sequence-Based Amplification for Competitive Quantitative Amplification Reactions Wan-Yu Lo and Antje J. Baeumner*

Department of Biological and Environmental Engineering, Cornell University, Ithaca, New York 14853

Nucleic acid sequence-based amplification (NASBA) reactions have been demonstrated to successfully synthesize new sequences based on deletion and insertion reactions. Two RNA internal standards were synthesized for use in competitive amplification reactions in which quantitative analysis can be achieved by coamplifying the internal standard with the wild type sample. The sequences were created in two consecutive NASBA reactions using the E. coli clpB mRNA sequence as model analyte. The primer sequences of the wild type sequence were maintained, and a 20-nt-long segment inside the amplicon region was exchanged for a new segment of similar GC content and melting temperature. The new RNA sequence was thus amplifiable using the wild type primers and detectable via a new inserted sequence. In the first reaction, the forwarding primer and an additional 20-ntlong sequence was deleted and replaced by a new 20-ntlong sequence. In the second reaction, a forwarding primer containing as 5′ overhang sequence the wild type primer sequence was used. The presence of pure internal standard was verified using electrochemiluminescence and RNA lateral-flow biosensor analysis. Additional sequence deletion in order to shorten the internal standard amplicons and thus generate higher detection signals was found not to be required. Finally, a competitive NASBA reaction between one internal standard and the wild type sequence was carried out proving its functionality. This new rapid construction method via NASBA provides advantages over the traditional techniques since it requires no traditional cloning procedures, no thermocyclers, and can be completed in less than 4 h. Nucleic acid amplification has become an essential analytical tool over the past 15 years in biomedical research for gene expression monitoring as well as in routine clinical diagnostics. A reliable amplification method that allows small amounts of input RNA to be quantified is therefore of great interest. Considerable effort has been put toward the development of accurate quantifications. Two main strategies are used for effective quantification: end-point quantification and real-time quantification. Real-time quantification is based on the detection of fluorescent reporter molecules during the reaction as an indicator of amplicon * To whom correspondence should be addressed. E-mail: [email protected].

1548 Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

production throughout the process of the amplification. It provides a wide dynamic range of detection compared to traditional endpoint detection. However, its applications are limited by the costs of the devices required to perform a real-time analysis and the reaction components, as well as the lack of specificity of some probes in non-polymerase chain reaction (PCR)-based target amplification technologies.1-3 In the case of end-point quantification, the use of internal standards that compete with the sample sequence for amplification is the most reliable approach. The internal standard contains the same primer binding sites as the target sequence and can thus theoretically equally compete with the target for primers, nucleotides, and enzymes in the reactions. It differs from the sample sequence either in length or by a specific recognition site. In contrast, all other quantification methods are only based on the assumption that the efficiencies of the reactions are equal. Either external standards used for standard curve calibrations or endogenous internal standards in a multiplex amplification are typical methods that can be amplified in parallel with the sample of interest. These methods may provide accurate standard curves, which can eliminate the tube-to-tube variations, to quantify the amount of the unknown sample. However, variations in each individual sample cannot be ruled out.4-6 The development of quantitative competitive molecular amplification reactions such as the nucleic acid sequence-based amplification (NASBA) reaction, the PCR and reverse transcriptase PCR (RT-PCR) have been demonstrated. Quantitative competitive PCR or RT-PCR have been used for the detection of viral or bacterial pathogens as well as cellular RNA or DNA7-12 since it (1) Gore, H. M.; Wakeman, C. A.; Hull, R. M.; McKillip, J. L. Biochem. Biophy. Res. Commun. 2003, 311, 386-390. (2) Sto ¨cher, M.; Leb, V.; Ho¨lzl, G.; Berg, J. J. Clin. Virol. 2002, 25, S47-S53. (3) Leone, G.; Schijndel; van Gemen, B.; Kramer, F. R.; Schoen, C. D. Nucleic Acids Res. 1998, 26, 2150-2155. (4) Hazari, S.; Acharya, S. K.; Panda, S. K. J. Virol. Methods 2003, 116, 45-54. (5) Van Deursen, P. B. H.; Gunther, A. W.; Spaargaren-van Riel, C. C.; van den Eijnden, M. M. E. D.; Vos, H. L.; van Gemen, B.; van Strijp, D. A. M. W.; Tacken, N. M. M.; Bertina, R. M. Nucleic Acids Res. 1999, 27, e15. (6) Reischl, U.; Kochanowski, B. Mol. Biotechnol. 1995, 3, 55-69. (7) Li, W.; Drake, M. A. Appl. Environ. Microbiol. 2001, 67, 3921-3924. (8) Kelleher, K. L.; Leck, K. J.; Hendry, I. A.; Matthaei, K. I. Brain Res. Protocols 2001, 6, 100-107. (9) Shepard, R. N.; Schock, J.; Robertson, K.; Shugars, D. C.; Dyer, J.; Vernazza, P.; Hall, C.; Cohen, M. S.; Fiscus, S. A. J. Clin. Microbiol. 2000, 38 (4), 1414-1418. (10) Vener, T.; Nygren, M.; Andersson, A.; Uhlen, M.; Albert, J.; Lundeberg, J. J. Clin. Microbiol. 1998, 36 (7), 1864-1870. 10.1021/ac0615302 CCC: $37.00

© 2007 American Chemical Society Published on Web 01/19/2007

was first described.13-15 NASBA is an ideal alternative to RT-PCR since it does not react with contaminating DNA. Thus, in recent years, quantitative NASBA assays have been developed for the detection of various viral and bacterial RNA16-22 ever since NASBA was first introduced.23 Currently, the most commonly used strategy to generate internal DNA or RNA standards is a multistep process that includes cloning of the genes into vectors, a ligation reaction, transforming competent cells, growing bacteria cultures, restriction digestion, isolation, and purification. Additional precautions have to be taken for the synthesis of RNA standards to avoid any possible contamination prior to transcription and inaccurate quantification of the RNA product yield thereafter. The time, expertise, and labor required to generate RNA internal standards are among the main reasons that only a limited number of RNA internal standards are used for quantitative amplifications on a routine basis.8,24 NASBA is routinely used for the amplification of RNA sequences, and insertion of sequences via a 5′ overhang on one of the two primers has been demonstrated.25 However, NASBA has not yet been shown to be capable of cloning-type procedures for the synthesis of new sequences that include insertion, deletion, and replacement reactions. The objective of this study was to develop a rapid and novel method for the construction of internal RNA standards using two consecutive simple NASBA reactions. Internal standard RNA was constructed from Escherichia coli clpB target sequence26 by inserting a sequence to replace 20 nt of the target E. coli sequence. Thus, the internal standards can be distinguished by a capture (or detection) probe in a sandwich assay but can be amplified using the same set of primers as used for the wild type RNA, and thus, coamplification in one vial in a competitive format is possible. The strategy of the two consecutive NASBA reactions is shown in Figure 1, which is a primer-derived deletion and insertion reaction. (11) Clementi, M.; Menzo, S.; Bagnarelli, P.; Manzin, A.; Valenza, A.; Varaldo, P. E. PCR Methods Appl. 1993, 2, 191-196. (12) Tompkins, L. S. N. Engl. J. Med. 1992, 327, 1290-1297. (13) Gilliland, G.; Perrin, K.; Blanchard, K.; Bunn, H. F. Proc. Natl. Acad. Sci. U.S.A. 1990, 87, 2725-2729. (14) Becker-Andre´, M.; Hahlbrock, K. Nucleic Acids Res. 1989, 17, 9437-9446. (15) Wang, A. M.; Doyle, M. V.; Mark, D. F. Proc. Natl. Acad. Sci. U.S.A. 1989, 86, 9717-9721. (16) Hayashi, T.; Kobayashi, H.; Miyachi, H.; Ohshima, T.; Ujiiye, T.; Kawase, M.; Hotta, T.; Takemura, Y. Clin. Chim. Acta 2004, 342, 115-126. (17) Greijer, A. E.; Adriaanse, H. M.; Kahl, M.; Tacken, N. M.; Oldenburg, N.; Sijlmans, A.; van de Crommert, J. M.; Dekkers, C. A.; Sillekens, P. T.; Middeldorp, J. M. J. Virol. Methods. 2001, 96 (2), 133-47. (18) Romano, J. W.; Shurtliff, R. N.; Dobratz, E.; Gibson, A.; Hickman, K.; Markham, P. D.; Pal, R. J. Virol. Methods 2000, 86, 61-70. (19) Damen, M.; Sillekens, P.; Cuypers, H. T. M.; Frantzen, I.; Melsert, R. J. Virol. Methods 1999, 82, 45-54. (20) Van Gemen, B.; Kievits, T.; Nara, P.; Van Strijp, D.; Malek, L. T.; Sooknanan, R.; Huisman, H. G.; Lens, P. J. Virol. Methods 1993, 43, 177-188. (21) Van Gemen, B.; Beuningen, R.; Nabbe, A.; Strijp, D.; Jurriaans, S.; Lens, P.; Kievits, T.J. Virol. Methods 1994, 49, 157-168. (22) Kievits, T.; Van Germen, B. T.; Van Strijp, D.; Schukkink, R.; Dircks, M.; Adriaanse, H.; Malek, L. T.; Sooknanan, R.; Huisman, H. G.; Lens, P. J. Virol. Methods 1991, 35, 273-286. (23) Compton, J. Nature 1991, 350, 91-92. (24) Zimmermann, K.; Mannhalter, J. W. BioTechnology 1996, 21, 268-279. (25) Wu, S. J.; Lee, E. M.; Putvatana, R.; Shurtliff, R. N.; Porter, K. R.; Suharyono, W.; Watt, D. M.; King, C. C.; Murphy, G. S.; Hayes, C. G.; Romano, J. W. J. Clin. Microbiol. 2001, 39, 2794-2798. (26) Min, J.; Baeumner, A. J. Anal. Biochem. 2002, 303, 186-193.

Figure 1. Principle of RNA internal standard synthesis by two consecutive NASBA reactions. The amplicons are shown in the 3′5′ direction as they produce an antisense RNA sequence of the original wild type RNA. Primer 1 contains the T7 RNA polymerase promoter sequence as 5′ end overhang. (A) The original E. coli target sequence after NASBA amplification. (B) Primer design for two NASBA reactions during which the original capture probe sequence is replaced by a new sequence. First, the original capture probe sequence is deleted from the RNA amplicon using primer 2′ and the new capture probe sequence is introduced as 5′ overhang on primer 2′. Second, the new capture probe sequence is used as primer 2 location (primer 2′′), and the original primer 2 sequence is reintroduced as 5′overhang on primer 2′′.

First, the original capture probe sequence was deleted from the RNA amplicon by not including the 3′ end of the amplicon in the reaction; i.e., a sequence adjacent to the 5′ end of the capture probe sequence was used as new primer 2 location (primer 2′) amplifying only everything from that nucleotide on. Thus, the original primer 2 and the original capture probe locations are eliminated from the new amplicon. Also, the new capture probe sequence is introduced into this new amplicon by using it as 5′ end overhang of primer 2′ in the same reaction. This results in preinternal standards. In the second NASBA reaction, this amplicon is used as starting material. Here, the new capture probe sequence is used as primer 2 location (primer 2′′), and the original primer 2 sequence is reintroduced as 5′overhang on primer 2′′. MATERIALS AND METHODS Reagents. All general chemicals and supplies were purchased from Sigma (St. Louis, MO) or VWR (Bridgeport, NY). Dipalmitoylphosphatidylglycerol (DPPG), dipalmitoylphosphatidylcholine (DPPC), cholesterol, and extrusion membranes were purchased from Avanti Polar Lipids (Alabaster, AL). Streptavidin and sulforhodamine B were purchased from Molecular Probes, Inc. (Eugene, OR). Polyethersulfone membranes were purchased from Pall Corp. (Pensacola, FL). Oligonucleotide probes were purchased from Operon Biotechnologies, Inc. (Alameda, CA). Bacterial Strain and Growth Condition. E. coli was chosen as the model organism for the new internal standard RNA Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

1549

Table 1. Primer and Probe Sequences for the Amplification and Detection of E. coli clpB mRNAa function

sequence (5'f3')

primer 1 primer 2 capture probec detection probed E. coli clpB target amplicone

T7b + TTACTGGACGGCGACAA AAATCCACATTTCTGACGA CTGAAACTGCTGAGCGAGAA GTCTGGTGAATTGGTTCCG UUACUGGACG GCGACAAUCC GGUCUUCAUU AACUUCCAGG CGAAUAACUU UACCCGGAAC CAAUUCACCA GACAGUAUUU GCUGUGCCAA CGGGUUUUCG AUCUGCUGCU GGAUAGCACG UUUCAAAGGA CGUGCACCAU AGACAGGAUC GUAACCGUUC UCGCUCAGCA GUUUCAGCGC CUCGUCAGAA AUGUGGAUUU

length (nt)

location in clpB

46 19 20 19 200

2558-2574 2375-2383 2388-2417 2502-2520 2375-2574

a The NASBA reaction results in the antisense RNA sequence of the original clpB mRNA segment. b The T7 promoter sequence (5′ AATTCTAATACGACTCACTATAGGGAAGG 3′) was added to the 5′ end. c The capture probe was biotinylated at the 5′ end for both ECL-based and liposome-based detection. d The detection probe was cholesterol-tagged at the 3′ end for the lateral-flow assay and labeled with tris(2,2bipyridine)ruthenium(II) complex at the 5′ end for the ECL-based detection. e NASBA product sequence, where primer locations are in boldface type.

construction. Generic E. coli K12 and E. coli O157:H7 were obtained from Dr. Randy Worobo (Cornell University, Geneva, NY). E. coli was grown in tryptic soy broth (TSB) at 37 °C to exponential growth phase until the optical density at 600 nm reached ∼0.4. RNA Extraction and Quantification. E. coli or E. coli O157: H7 was grown to exponential growth phase in TSB broth. In order to stimulate the production of the heat shock mRNA, the cells were heated at 41 °C for 15 min in a heating block prior to RNA extraction using the RNeasy Mini Kit (Qiagen, Valencia, CA). Subsequently, the cells were disrupted by incubation with lysozyme (400 µg/mL) in 10 mM Tris-HCl/1 mM EDTA buffer (pH 8.0) for 5 min at room temperature. RNA was extracted and purified from the lysate following the RNeasy Mini Kit instructions via a silica-guanidine thiocyanate method with spin columns provided as proprietary lysis buffer and isolation reagent in the RNeasy Mini Kit. RediPlate 96 RiboGreen RNA Quantification Kit was used for RNA quantification (Molecular Probes). All samples including the RNA standards in the kit were treated with a DNA free kit (Ambion, Inc., Austin, TX) prior to RNA quantification. Eight different RNA standard concentrations (0, 5, 15, 40, 100, 250, 500, and 1000 ng/mL) were analyzed simultaneously with the RNA samples. All samples and RNA standards were incubated in the microtiter plate for 10 min at room temperature. A fluorescence reader (Bio-Rad Fluor-S Imager) with excitation wavelength of 480 nm and emission wavelength of 520 nm was used to detect the fluorescence intensity. Broad white light was used for excitation and a 520-nm-long pass filter for emission measurements. The RiboGreen reagent bound to RNA has excitation/ emission maximums of ∼500/525 nm. Nucleic Acid Sequence-Based Amplification. NASBA reactions were carried out in a total volume of 20 µL containing 40 mM Tris (pH 8.5; Sigma), 12 mM MgCl2 (Sigma), 70 mM KCl (VWR), 5 mM dithiothriotol (Boehringer, Ridgefield, CT), 15% dimethyl sulfoxide (Sigma), 1 mM each of deoxynucleoside triphosphate (dATP, dCTP, dGTP, dTTP) (Bioline, Randolph, MA), 2 mM each of ATP, UTP, and CTP, 1.5 mM GTP, 0.5 mM ITP, and 5 µL of enzyme mix (0.08 unit of RNase H, 32 units of 1550 Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

T7 RNA polymerase, and 6.4 units of avian myeloblastosis virus reverse transcriptase) (Life Sciences, Inc., St. Petersburg, FL), and 0.2 µM each of primer. Five microliters of RNA was added to 10 µL of NASBA buffer solution, and the resultant mixture was preincubated at 65 °C for 5 min prior to incubation at 41 °C. The enzyme mixture was then added after cooling for 5 min at 41 °C, and the amplification was performed at 41 °C for 90-120 min in a water bath. The RNA amount used for the internal standard construction was 14 fg. Rapid Construction of Internal Standard RNA. (1) E. coli Sequence. The E. coli sequence coded for heat shock protein clpB was selected from accession number U00096 gi 48994873:c 2729622..2732195 at the National Center for Biotechnology Information (NCBI) through the Entrez Genomes division, GenBank, and the BLAST database. Primers and detection probes for the specific and highly sensitive detection of E. coli were determined previously by our research group.26 Primers and probes designed for NASBA and the detection of the amplicons are listed in Table 1. The NASBA amplification of a target E. coli sequence resulted in a 200-nucleotide product. (2) Internal Standard RNA Construction. Internal standard sequences were constructed using two consecutive NASBA reactions with the wild type E. coli clpB sequence (Table 1) as starting material. The capture probe sequence in the wild type amplicon was replaced by a randomized sequence of the same or similar length. Besides this new capture probe sequence, the remainder of the amplicon was the same and could therefore be amplified using the same forward and reversing primers as well as the same detection probe. The internal standard RNA was constructed in two separate NASBA reactions as outlined in Figure 1. (3) Considerations for NASBA Primer and Detection Probe Design. For successful competitive and quantitative assays the efficiency or kinetics of each reaction, i.e., amplification of the desired target sequence and the internal standard sequence, is the most important issue to be addressed. In addition, secondary structures of the NASBA amplicons at 41 °C, melting temperatures, and the total length of the amplicons should also be considered while designing appropriate primers. These were

Table 2. Primer and Probe Sequences for the Amplification and Detection of Internal Standards C and D function

sequence (5'f3')

length (nt)

primer 1 primer 2'C1b Primer 2'C2b primer 2'Db Primer 2'’Cc primer 2'’Dc capture probe Cd capture probe Dd detection probee

T7a + TTACTGGACGGCGACAA AGATTCGAAGAACTCTGCGC AACGGTTACGATCC AGATTCGAAGAACTCTGCGC AACCGTTGGC ACAGC AGGGAAGCTG TACCTCCTTAACGGTTACG ATCCAGT AAATCCACATTTCTGACGA AGATTCGAAGAACTC AAATCCACATTTCTGACGA AGGGAAGCTGTACCT AGATTCGAAGAACTCTGCGC AGGGAAGCTGTACCTCCT GTCTGGTGAATTGGTTCCG

46 34 35 36 34 34 20 18 19

a The T7 promoter sequence (5′ AATTCTAATACGACTCACTATAGGGAAGG 3′) was added to the 5′ end of the primer 1 sequence. b Primer 2′C1, primer 2′C2, and primer 2′D are used for the insertion of a new capture probe C/D sequence to replace the original capture probe sequence of the wild type sequence. Capture probe C/D sequence are shown in bold. c Primer 2′′C and Primer 2′′D are used in the second NASBA reaction, in which the original primer 2 sequence is reintroduced as 5′ overhang (boldface type). d Capture probe C and D were biotinylated at the 5′ end for both ECL-based and lateral-flow biosensor-based detection. e The same detection probe was used for wild type and internal standard detection. The probe was modified with a cholesterol tag at the 3′ end for the lateral-flow assay and with a tris(2,2-bipyridine)ruthenium(II) complex at the 5′ end for ECL-based detection.

studied with different combinations of primer and probe designs by the use of DNASTAR software (DNASTAR Inc., Madison, WI) and BLAST GenBank database. Additionally, the new randomized capture sequences were also selected based on the uniqueness of the sequence, i.e., nonhomology to the target organism. The appropriate lengths of the internal standard sequences and a new sequence replacing the original capture probe region were investigated. The primer and probe sequences used for the construction of the two internal standards reported here are given in Table 2. Lateral-Flow Biosensor Assay. (1) Liposome Preparation. Liposomes were prepared using the reverse-phase evaporation method. In brief, DPPC (40.3 µmol), DPPG (21 µmol), and cholesterol (51.7 µmol) were first dissolved in a solvent mixture containing 3 mL of chloroform, 0.5 mL of methanol, and 3 mL of isopropyl ether. The mixture was sonicated homogeneously. The cholesterol-labeled reporter probe was diluted to a concentration of 300 µM in a 1:4 (v/v) mixture of methanol/formamide. A 50-µL aliquot of the cholesterol-labeled reporter probe solution was then added to the lipid mixture. A total 4 mL of a 45 °C liposome encapsulant (150 mM sulforhodamine B in 0.02 M potassium phosphate buffer pH 7.0) was added to the lipid mixture while sonicating for 4 min. The mixture was then placed onto the rotary evaporator, and the solvent was removed at 45 °C. The liposomes subsequently were extruded through 2 µM and then 0.6 µM polycarbonate membrane filters (each extruded 19-21 times) at 60 °C. The liposomes were purified using a Sephadex G50 column and dialyzed against potassium phosphate buffer, pH 7.0, with an osmolarity 75 mmol/kg higher than the liposome encapsulant. The osmolarity was typically adjusted with sucrose. (2) Multizone Membrane Preparation. A mixture containing 20 pmol of streptavidin and 60 pmol of capture probe per strip in a sodium carbonate buffer (0.4 M NaHCO3/Na2CO3 with 5% methanol, pH 9.0) was incubated for 15 min at room temperature. This streptavidin-probe solution was spotted onto polyethersulfone membranes, ∼1.5 cm from the bottom of the membranes using a thin-layer chromatography applicator (Linomat, Camag, Wilmington, NC). Subsequently, the other capture zones were created at 1-cm intervals along the same membrane strip in the final order of capture zones D, C, and 2. The membranes were

dried in a vacuum oven (15 psi) at 52 °C for 1.5 h and were then incubated in a blocking solution of 0.5% poly(vinylpyrrolidone) and 0.15% casein in Tris buffer saline (0.02 M Tris base, 0.15 M NaCl, 0.01% NaN3, pH 7.0) for 30 min. The membranes were allowed to fully dry in a vacuum oven at 25 °C for 2-3 h. They were cut into strips of 5 mm × 75 mm for use and stored at 4 °C in vacuum-sealed polypropylene bags. (3) Biosensor Assay Format. A vertical flow assay format was developed based on earlier protocols. A 2-µL aliquot of liposomes, 2 µL of hybridization solution (40% formamide, 9× SSC (1Mtmex SSC: 15 mM sodium citrate, 150 mM NaCl, pH 7.0), 0.6% Ficoll, 0.6 M sucrose, and 0.01% Triton X-100), and 1 µL of NASBA amplicon were incubated at 41 °C for 10 min in a glass tube. After incubation, a membrane strip was inserted into the glass, and the hybridization mixture was allowed to migrate up the strip. Subsequently, 40 µL of running buffer (25% formamide, 6× SSC, 0.2% Ficoll, 0.2 M sucrose, and 0.01% Triton X-100) was added to the glass tube. After ∼8 min, the solution reached the top of the membrane strip and the assay was complete. The signal at each capture zone was measured with a BR-10 reflectometer (Eseco Co., Cushing, OK). Electrochemiluminescence (ECL) Detection. NASBA products were detected using an ECL system. The detection system involved a single hybridization reaction with two oligonucleotide probes (capture and detection probe), which were specific for NASBA amplicons. A 5′-biotinylated capture probe 2, C, or D was immobilized onto the surface of streptavidin-coated M280 magnetic beads, respectively (Dynal, Inc., Lake Success, NY.), at room temperature for 1 h resulting in a concentration of 2 × 1011 molecules/µL and 0.5 mg of beads/µL of solution. They were stored in phosphate buffer saline (1× PBS) containing 0.1% bovine serum albumin. The ECL detection probe labeled at the 5′ end with ruthenium (Ru2+) was purchased from IGEN International, Inc. (Gaithersburg, MD). Hybridization solution containing 5 µL of 1:200 diluted NASBA product, 10 µL of biotin capture probe solution (final probe concentration 2 × 1012 molecules), and 10 µL of ECL detection probe (final concentration 2 × 1012 molecules) was incubated at 60 °C for 5 min and then at 41 °C for 30 min. After hybridization was conducted, 300 µL of assay buffer (Organon Teknika, Inc. Durham, NC) containing tripropylamine was Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

1551

Table 3. Comparison of the Original Capture Probe (2) and the Two New Probes (C, D) with Respect to Length, GC Content, and Melting Temperature. probe

sequence(5'f3')

length (nt)

GC (%)

Tm (°C)

capture 2 capture C capture D

CTGAAACTGCTGAGCGAGAA AGATTCGAAGAACTCTGCGC AGGGAAGCTGTACCTCCT

20 20 18

50 50 55.6

60.4 60.4 59.9

added to each reaction, and the ECL signals were read on the NucliSens ECL reader (Organon Teknika Inc.). RESULTS AND DISCUSSION In the following, experiments are described designing the two internal standards, ISC and ISD, and a variation thereof, and proving their successful construction using ECL and biosensor assays. The final internal standard C construct is then also used in a competitive assay with wild type RNA in order to prove its functionality. The capture sequences for the internal standards were selected based on total length, uniqueness of the sequence with respect to the E. coli genome, GC content, and melting temperature. The effect on the secondary structure of the overall amplicon was minimized. Additionally, the formation of primer hairpins and primer dimers was examined prior to the construction work. Thus, the internal standards were designed to be as similar to the wild type sequence as possible in order to increase the likelihood of similar amplification reaction kinetics and efficiencies (Table 3). Capture probes C and D were also analyzed for homology to the E. coli genome using BLAST 2 sequence analysis on the NCBI website. No homology of either capture probe sequence to the E. coli sequence was found. The default value of the statistically significance threshold for reporting matches against database sequences in this program is 10, such that 10 matches are expected to be found merely by chance. Synthesis of Preinternal Standards. Three primers 2 (primer 2′C1 and primer 2′C2, primer 2′D, Table 2) were designed, in order to synthesize two preinternal standards C (pISC1 and pISC2) with different lengths of the amplified NASBA products, and one preinternal standard D (pISD). Preinternal standard sequences (pISC1, pISC2, pISD) do not contain primer 2 sequences (Figure 1). Since deletion reactions have not been reported yet with NASBA, pISC was designed with a replacement of the capture sequence (pISC1) and also with the deletion of an additional 64-nt-long sequence (pISC2). We wanted to determine whether a significantly shorter amplicon (32% shorter) affected the NASBA construction, amplification, and sandwich assay detection. In the case of pISD, varying concentrations of NASBA primers (0.2, 0.4, 2 µM) were investigated in order to determine the optimal concentration with respect to a complete deletion/ insertion reaction. Thus, the higher the specific signal for capture probe D and the lower the signal for the original capture probe, the better the construction NASBA reaction. The amplicons pISC1, pISC2, and pISD were quantified and analyzed for specificity using two hybridization sandwich-based detection methods with extremely low limits of detection, an ECL assay,21 and a colorimetric liposome-based lateral flow biosensor 1552 Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

Table 4. Effect of Final Primer Concentrations Used during the Preinternal Standard Synthesis NASBA Reactions on the ECL Signal Obtained with Capture Probe D.

capture probe 2 capture probe D ratio D to 2

0.2 µM

0.4 µM

2 µM

5900 183 200 31

4600 638 900 139

1100 1 669 400 1518

Table 5. Average ECL Readings of ISC and ISD Constructed by Primer 2′′C and Primer 2′′D, Respectively, Containing a 5′ Overhang Encoding clpB Primer 2 Sequencea

capture probe 2 capture probe C capture probe D

negative control

ISC

ISD

2600 ( 160 3200 ( 130 3100 ( 190

2900 ( 300 44400 ( 4300

2600 ( 230 624600 ( 35000

a Negative controls were done with water instead of RNA. Analyses were done in six replicates.

assay.27 Analyses were typically carried out in six replicates. It was found that the deletion/insertion reactions of the first construction NASBA reaction were successful: the preinternal standards lacked the original capture sequence and were quantifiable with their respective new capture sequences C and D. For example, ECL signals of the original capture sequence were equal to the background signal of 6200 arbitrary units, while the specific signals for capture probe C were 479 000 and 463 000 for pISC1 and pISC2, respectively. The 64-nt additional deletion in pISC2 was feasible; however, it did not result in higher NASBA amplification or better sandwich assay detection. The variation of primer concentrations showed that higher primer concentrations resulted in better construction NASBA conditions. That is, the signal obtained with the original capture sequence using ECL decreased to the level of the background signal with 2 µM primers, which means that no traces of the original wild type sequences were present in the amplicon. At the same time, the specific signal of capture probe D increased significantly. Overall, ratios of the capture probe D signals to the original capture probe signals increased with the highest primer concentration to ∼50-fold over the ratio obtained with a 10 times lower primer concentration (Table 4). Synthesis of Internal Standards C and D. Preinternal standards pISC1 and pISD were subsequently used as starting material for the second construction NASBA reaction in which the original primer 2 sequence was reinserted into the amplicons in order to generate fully functional internal standards that could be amplified together with the wild type sequence, yet be detected with different capture probes (Figure 1). Both internal standards were analyzed using ECL with the original capture probe and capture probes C and D. As expected, both ISC and ISD showed no cross reactivity with the original capture probe and produced high signals with their respective probes (Table 5). NASBA of Wild Type, ISC1, and ISD RNA with the Same Primers. Internal standards ISC1 and ISD and wild type RNA (27) Baeumner, A. J.; Pretz, J.; Fang, S. Anal. Chem. 2004, 76 (4), 888-894.

Figure 2. ECL detections of wild type E. coli target (WT), internal standard C1 (ISC1), and internal standard D (ISD) amplified by clpB primer sets in separate NASBA reactions. Each NASBA reaction was carried out in six replicates with the exception of the negative control (three replicates).

Figure 3. Lateral flow liposome-based biosensor assay result of the amplifications of wild type and internal standards C and D by the same clpB primer sets. Actual polyethersulfone membrane strips of the three capture zones (original capture probe, capture probes C and D) are shown, and the average reflectometer readings are calculated for each set of six replicates (three replicates for the negative control).

were amplified (in separate vials) using wild type primers 1 and 2. The amplicons were then detected using the original capture probe and capture probes C and D via ECL (Figure 2) and the biosensor assay (Figure 3). Both sets of experiments showed that the construction of the internal standards was successful, that no cross reactivity of the old and new capture zones existed, and that no traces of wild type RNA were left in the internal standards that could have led to amplification of wild type RNA and thus detection in the internal standard vials. The difference in signal

Figure 4. Fixed internal standard C1 concentration at 1.232 ng added to various wild type RNA concentrations at 0.0144, 0.144, 1.44, 7.22, and 14.44 ng, corresponding to log values of 4.16, 5.16, 6.16, 6.86, and 7.16, in competitive NASBA reactions. The ECL signal ratio of the original capture probe to capture probe C (ratio orig/C) was calculated to examine the competition between wild type and internal standard in a reaction tube. Two batches of the same experiments were conducted with triplicates in each sample individually.

obtained for ISC1 and ISD was due to the different starting amounts of RNA used in the reactions; i.e., NASBA had not gone to completion after the 90-min reaction time, resulting in different end levels of RNA. Competitive Amplification of Wild Type and Internal Standard RNA. The ultimate use of the internal standards is in a quantitative competitive NASBA reaction in order to quantify the target sequence present in a sample. Thus, three different amounts of internal standards C1 (12.32 pg, 0.1232 ng, and 1.232 ng) were added into various E. coli target concentrations (from 0.144 pg to 14.44 ng) and competitive NASBA reactions were performed. The amplicons were subsequently analyzed using ECL with the original capture probe and with capture probe C. In Figure 4, the ratio of ECL signals obtained for the original capture probe and capture probe C (ratio orig/C) for 1.232 ng of ISC1 was plotted over the log values of the wild type RNA concentrations 0.0144, 0.144, 1.44, 7.22, and 14.44 ng, corresponding to log value of 4.16, 5.16, 6.16, 6.86, and 7.16. This ratio of the capture probe signals was used to assist in the evaluation of the competition between an internal standard and wild type target in one NASBA reaction tube. Ideally, the ratio will reach 1 when two starting concentrations are equal. Hence, it was found in this set of experiments that the ratio orig/C was 1.02 and 1.03 in two different batches of competitive NASBA reactions when a mixture of 1.44 ng of wild type E. coli RNA and 1.232 ng of internal standard C was used (with a theoretical ratio of 1.01). Similarly, log ratios of 0.93 and 0.95 were found for ISC1 and wild type amounts of 12.32 and 14.4 pg, respectively (theoretical log ratio is 1.01). These data indicated that the internal standard C1 could be equally coamplified with target E. coli target in the same reaction tube and thus fulfilled the ideal characteristics of an internal standard. In future applications, an unknown concentration of wild type RNA could be amplified in two tubes with two different concentrations of internal standard C1, providing a two-point Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

1553

dose-response curve, which will allow quantification of the wild type RNA. CONCLUSION The purpose of this study was to prove that NASBA reactions can be used for cloning-type insertion, deletion, and replacement reactions and with this to develop a simple and effective method to construct an internal standard RNA that can be used in quantitative competitive amplification reactions such as NASBA and RT-PCR. Using only two consecutive NASBA reactions, deletion, insertion, and replacement of sequences within an RNA amplicon was achieved, resulting in high-quality RNA that was successfully used in a competitive NASBA reaction. The ease of synthesis, especially in comparison to the traditional cloning and

1554

Analytical Chemistry, Vol. 79, No. 4, February 15, 2007

in vitro transcription that has so far been required for internal RNA construction, could lead to a significant increase in the use of competitive NASBA and RT-PCR reactions in the future. ACKNOWLEDGMENT The authors thank Dr. Junhong Min for helpful discussions and The Ministry of Education in Taiwan for partial financial support. We also thank Dr. Richard Montagna from Innovative Biotechnologies International for access to the NucliSens Reader.

Received for review August 16, 2006. Accepted November 23, 2006. AC0615302