Role of Surface Exposed Tryptophan as Substrate Generators for

Wentworth et al. also provide evidence that ACWOP is capable of ... Using mAb-1, its mutant W53A, and two other antibodies, mAb-2 and mAb-3, .... A tw...
0 downloads 0 Views 2MB Size
Download PDF
Article pubs.acs.org/molecularpharmaceutics

Role of Surface Exposed Tryptophan as Substrate Generators for the Antibody Catalyzed Water Oxidation Pathway Alavattam Sreedhara,*,† Kimberly Lau,† Charlene Li,‡ Brian Hosken,‡ Frank Macchi,‡ Dejin Zhan,§ Amy Shen,§ Daniel Steinmann,∥ Christian Schöneich,∥ and Yvonne Lentz† †

Late Stage Pharmaceutical Development, ‡Protein Analytical Chemistry, and §Early Stage Cell Culture, Genentech, Inc., South San Francisco, California 94080, United States ∥ Department of Pharmaceutical Chemistry, University of Kansas, Lawrence, Kansas 66047, United States S Supporting Information *

ABSTRACT: The reaction of singlet oxygen with water to form hydrogen peroxide was catalyzed by antibodies and has been termed as the antibody catalyzed water oxidation pathway (ACWOP) (Nieva and Wentworth, Trends Biochem. Sci. 2004, 29, 274−278; Nieva et al. Immunol. Lett. 2006, 103, 33−38). While conserved and buried tryptophans in the antibody are thought to play a major role in this pathway, our studies with a monoclonal antibody, mAb-1 and its mutant W53A, clearly demonstrate the role of surface-exposed tryptophans in production of hydrogen peroxide, via the photo-oxidation pathway. Reactive oxygen species (ROS) such as singlet oxygen and superoxide were detected and site-specific tryptophan (Trp53) oxidation was observed under these conditions using RP-HPLC and mass spectrometry. The single mutant of the surface exposed Trp53 to Ala53 (W53A) results in a 50% reduction in hydrogen peroxide generated under these conditions, indicating that surface exposed tryptophans are highly efficient in transferring light energy to oxygen and contribute significantly to ROS generation. ACWOP potentially leads to the chemical instability of mAb-1 via the generation of ROS and is important to consider during clinical and pharmaceutical development of mAbs. KEYWORDS: monoclonal antibodies, tryptophan, reactive oxygen species, singlet oxygen, superoxide, photo-oxidation, immunoglobulins, quantum yield, integrating sphere

■

INTRODUCTION Photodegradation of proteins, including antibodies, has been a topic of interest for many groups. Wei et al. identified a single Trp residue responsible for the loss of binding and biological activity after the mAb was exposed to UV light.1 Similarly, a human IgG1 mAb in a high concentration liquid formulation was subjected to intense light and demonstrated to undergo covalent aggregate formation in addition to fragmentation at the hinge region and oxidation of key amino acids including Trp, His, and Met.2 Recently, Stroop et al. have shown that photodegradation of a mAb in histidine buffers was mediated via histidine-derived photosensitizers.3 However, mechanistic details of the type of reactive oxygen species (ROS) formed under these conditions and/or the role of specific amino acids in the protein sequence have not been thoroughly elucidated. Wentworth et al. reported in a seminal paper that antibodies, irrespective of their antigen specificity, produce H2O2 from molecular oxygen in a catalytic process.4 Nieva et al. later reported the reaction of singlet oxygen with water to produce hydrogen peroxide, termed as the antibody catalyzed water oxidation pathway (ACWOP).4,5 Wentworth’s group demonstrated this phenomenon using various antibodies after exposing them to light and found that all antibodies produced © 2012 American Chemical Society

peroxide, although to different extents. On the basis of isotope incorporation experiments and kinetic data, the authors proposed that antibodies use water as an electron source, facilitating its addition to singlet oxygen to form H2O3 as the first intermediate in a reaction cascade that ultimately leads to the generation of H2O2.6 They also report that the rate of H2O2 generation continued to be linear over a period of time, generating as much as 500 molar equiv of peroxide per mole of antibody, and that the antibody structure was inert to the oxidizing prowess of peroxide. The authors also mention that the reduction of singlet oxygen to hydrogen peroxide was probably due to the conserved tryptophan (Trp) in the buried regions of the antibodies rather than surface exposed ones, explaining why several different antibodies displayed this phenomenon.4,6a While light activation of Trp is not a component of the ACWOP, Wentworth et al. used UV light as a convenient way to generate singlet oxygen and superoxide in order to study the putative ACWOP catalytic reaction. Received: Revised: Accepted: Published: 278

July 31, 2012 October 4, 2012 November 9, 2012 November 9, 2012 dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

anion are reported to occur with a rate constant of 1.9 × 1010 M−1 s−1.16 A fully human monoclonal antibody (mAb-1) that induces tumor cell apoptosis through proapoptotic receptor death receptor5 (DR5) has been evaluated both in vitro and in vivo for use in cancer therapy.17 Biochemical studies showed that mAb-1 binds DR5 tightly and selectively. During clinical development of this monoclonal antibody, we noticed that it was particularly susceptible to oxidation and potency loss during storage under pharmaceutically relevant conditions. Using mAb-1, its mutant W53A, and two other antibodies, mAb-2 and mAb-3, respectively, we will show that certain residues on mAbs, particularly Trp, are involved in generating ROS in the production of hydrogen peroxide and that surface accessibility contributes significantly in this process. Trp53 in mAb-1 is found to be more efficient in transferring light energy, and it may be linked to ACWOP as a substrate generator. Such a pathway leads to site specific Trp oxidation in mAb-1 and finally to various oxidative degradation mechanisms of other amino acids such as methionines via the photocatalyzed process.

Further support to the hypothesis came from Datta et al. when they reported the use of docking and molecular dynamics (HierDock) techniques to determine the antibody structural sites that stabilize the intermediates formed during the reaction of water and singlet oxygen.7 The reaction intermediates are stabilized at the interface of light and heavy chains of the antibodies and T-cell receptors (TCR). This inter Greek key domain (IGKD) is unique to antibodies and TCR and probably serves as a catalytic site. Wentworth et al. also provide evidence that ACWOP is capable of regioselectively converting antibody bound benzoic acid into p-hydroxybenzoic acid as well as hydroxylating the 4position of the phenyl ring of a single tryptophan residue located in the antibody molecule.8 Such highly selective chemical reactions are evidence for the formation of shortlived hydroxylating radical species such as hydrotrioxy radical, HO3*, which may act as a masked hydroxyl radical (HO*) in a biological environment. Further, X-ray analysis of the 4hydroxytryptophan (TrpL163) is presented bearing the signature of a hydroxyl radical reactive oxygen species. TrpL163 is located in the constant region of the Fab light chain (LC) with a solvent accessible area of 113 Å2. However, the authors propose that solvent accessibility alone is unlikely to cause oxidation as TrpH97 on the heavy chain (HC) is nearly as accessible (113 Å2) but not oxidized. Regioselective oxidation of TrpL163 is most likely due to the fact that it lies in close proximity to the site of generation of the reactive oxygen species. Zhu et al. probed nine different crystal structures and reported structural evidence for modification of two specific antibody residues within the interfacial region of the variable and constant domains of different murine Fabs by ROS generated during antibody catalyzed water oxidation process.6b Crystal structures reveal oxidative modification of TrpL163 and hydroxylation of glutamine (GlnH6). These specific modifications provide evidence for the generation of hydroxyl radical or a hydrotrioxy radical in the antibody-catalyzed water oxidation pathway. Chin et al. have recently reported that the three-dimensional conformation of proteins, including immunoglobulins, resulted in decreased quantum yields for the production of singlet oxygen as compared to the excited state amino acids, including Trp, and its derivatives.9 Since the quantum yield for ovalbumin was greater than those predicted based on surface aromatic amino acids, the authors indicate energy transfer from buried residues inside the protein. Trp is a unique amino acid with interesting roles in the folded structures and in many binding sites of proteins. It has also been shown to be capable of forming various interactions with neighboring amino acids, solvents, or other polar molecules.10 Recently Kayser et al. categorized Trp residues based on their solvent accessibility and their rigidity.11 Surface Trp residues have very high flexibility as well as high solvent accessibility and also interesting phosphorescence behavior.12 Additionally, among the various amino acids, Trp possesses strong absorbance in the UV region (260−290 nm) making it a target of many photo-oxidation studies.13 Trp has also been hypothesized as an endogenous photosensitizer enhancing the oxygen dependent photo-oxidation of tyrosine.14 Photoexcitation studies of Trp results in formation of solvated electrons and Trp cation radicals (TrpH+•). The interaction of solvated electrons with neighboring disulfide bonds, peptide linkages, or other constituents of the protein such as Met, Tyr, Phe, and His has been reported in the literature.15 Reactions of solvated electrons with molecular oxygen leading to superoxide

■

EXPERIMENTAL SECTION Materials and Methods. mAb-1, -2, and -3 are IgG1 monoclonal antibodies with the same framework but possess different complimentarity determining regions (CDRs) and were expressed in Chinese hamster ovary (CHO) cell lines. All mAbs were purified by a series of chromatography methods including affinity purification by protein A chromatography and ion-exchange chromatography. All mAbs were formulated at 10−50 mg/mL in 20 mM histidine HCl at pH 6.0 with 120 mM sucrose and 0.02% polysorbate 20 as a liquid formulation until specified otherwise. For photo-oxidation studies in D2O, mAb-1 (50 mg/mL) in 20 mM histidine HCl, 120 mM sucrose, and 0.02% polysorbate 20 at pH 6.0 was freeze-dried and subsequently reconstituted in either H2O (as control) or D2O to a final mAb concentration of 25 mg/mL. Long-term stability studies were carried out with formulations containing 20 mg/ mL mAb-1 and stored either at 2−8 °C for up to 43 months (real time stability) or at 30 °C for up to 3 months (accelerated stability). Construction of Expression Plasmids. Both heavy chain and light chain cDNAs were under the control of Cytomegalovirus immediate-early gene promoter and enhancer (CMV). Each CMV transcriptional start site is followed by splice donor and acceptor sequences, which define introns that are removed from the final transcripts.18 In the heavy chain transcription unit, the intron contains the coding sequence for a fusion protein containing both Streptomyces alboniger puromycin-Nacetyl transferase (PUR)19 and the murine dihydrofolate reductase (DHFR) activities.20 This fusion protein puromycin, dihydrofolate reductase (PUR-DHFR), is used as the selectable marker for selection. Site Directed Mutagenesis to Change Amino Acid 53 from Tryptophan to Alanine (W53A Mutant). To generate W53A single mutant mAb-1 expression plasmid, the Stratagene quick change II XL site directed mutagenesis kit was used to mutate 53W (TGG) to A (GCC) in mAb-1 expression plasmid following the manufacture’s instruction. The following primers were used for the W53A mutagenesis: (1) forward primer, AGTGGGTCTCTGGTATCAATGCCCAGGGTGGTAGCACAGG, and (2) reverse primer, CCTGTGCATCCACCCTGGGCATTGATACCAGAGACCCACT. The W53A muta279

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

for 20 min at initial conditions prior to the next sample injection. A liquid chromatography−mass spectrometry (LC−MS) system coupled to the HPLC system was used to confirm the identity of the RP-HPLC peaks. For MS analysis, papain digested and DTT reduced samples were analyzed using an Agilent 1090 HPLC equipped with a Varian Pursuit 3 μm diphenyl 250 × 2.0 mm column. The column temperature was maintained at 65 °C. The system was equilibrated with 70% solvent A (0.1% trifluoroacetic acid (TFA)/water) and 30% solvent B (0.08% TFA/acetonitrile) for 20 min at a flow rate of 0.2 mL/min prior to injection of ∼50 μg of digested/reduced mAb-1. After injection, the gradient was held at 30% solvent B for 4 min before initiation of a linear gradient going from 30% solvent B to 34% solvent B in 14 min, then to 40% solvent B in 70 min. The column was washed with 95% solvent B for 10 min before re-equilibration for 20 min at initial conditions prior to the next sample injection. The eluent was directed to a PE Sciex API 3000 electrospray ionization triple quadrupole mass spectrometer operating in the positive ion mode. The electrospray voltage was 5 kV with an orifice potential of 80 V. LC−MS data were interpreted using the PE Sciex BioAnalyst 1.4 deconvolution software program, with masses determined by converting a series of multiply charged ion peaks into distinct zero charge state molecular mass peaks. LC−MS/MS Tryptic Peptide Mapping. Photo-oxidized samples were analyzed using tryptic peptide digest followed by LC−MS/MS. 20 μL (1 mg) of each mAb-1 stressed sample was diluted with 980 μL of denaturing buffer containing 6 M guanidinium HCl, 360 mM Tris, and 2 mM EDTA, pH 8.6. Samples were reduced with 20 μL of 1 M DTT for 1 h at 37 °C. Samples were then carboxymethylated with 50 μL of 1.0 M IAA for 15 min at room temperature. The alkylation reaction was quenched by the addition of 10 μL of 1.0 M DTT. The reduced and carboxymethylated samples were buffer exchanged into digestion buffer (25 mM Tris-HCl, 2 mM CaCl2, pH 8.2) using PD-10 columns (GE Healthcare). Sequencing grade trypsin (Promega) was added to each sample at an enzyme-tosubstrate ratio of 1:50 (by weight). The digestion was carried out at 37 °C for 5 h and then quenched by adding 10% TFA to a final concentration of 0.3% TFA. Peptide mapping was performed on an Agilent 1200 HPLC system equipped with a Jupiter C18 column (Phenomenex, 2.0 × 250 mm, 5 μm particle size) and coupled to a Thermo Fisher LTQ mass spectrometer. Solvent A consisted of 0.1% TFA in water, and solvent B consisted of 0.09% TFA in 90% acetonitrile. A two-step gradient was used: 0−10% B in 20 min followed by 10−40% B over 137 min. The flow rate was 0.25 mL/min, the column temperature was 55 °C, and the protein load was 40 μg. Peptides were identified by submitting the MS and MS/MS scans to the Mascot search engine from Matrix Science. The oxidation level at each site was determined by extracted ion chromatography (EIC) using Xcalibur software. Oxidation values reported for W are the sum of +4, +16, and +32 species. LC−MS/MS Lys-C Peptide Mapping. Real time stability samples of mAb-1 and samples after extensive light exposure were analyzed using Lys-C peptide digest followed by LC−MS/ MS. Approximately 500 μg of sample was diluted with 490 μL of denaturation buffer containing 6 M guanidinium-HCl, 360 mM Tris, and 3 mM EDTA at pH 8.6. Samples were reduced with 5 μL of 1 M DTT for 1 h at 37 °C. Samples were then carboxymethylated with 10 μL of 1.8 M IAA for 15 min at

tion in expression plasmid was confirmed by DNA sequencing. The deglycosylated W53A mutant antibody sample was analyzed by electrospray ionization mass spectrometry (ESIMS) using an Agilent ESI-TOF mass spectrometer after reduction of the disulfide bonds with DTT or without reduction. Cell Culture. CHO cells were cultured in a proprietary DMEM/F12-based medium in shake flask vessels at 37 °C and 5% CO2. Cells were passaged with a seeding density of 3 × 105/mL, every three to four days. Stable Transfection and Antibody Production. CHO cells were transfected using Lipofectamine 2000 CD according to the manufacturer’s recommendation (Invitrogen, Carlsbad, CA). Transfected cells were centrifuged and seeded into DMEM/F-12-based selective (GHT-free) medium with various concentrations of methotrexate (MTX). About three weeks after seeding, individual colonies were picked into 96-well plates. Picked colonies were evaluated for antibody production by taking the supernatant for ELISA analysis. Top clones from each mutant were scaled up for production using a fed-batch culture with a 14-day process. Photo-Oxidation Studies. mAb-1, mAb-2 and mAb-3 (1 mL/glass vial) were exposed to light in an Atlas SunTest CPS+ Xenon Test Instrument (Chicago, IL) for various periods of time (e.g., 3−24 h) with an irradiance level of 250 W/m2, a total UV dose of 538 W-h/m2, and a total visible dose of 1.32 million lx h over a 24 h period. Control vials were wrapped with aluminum foil and treated similarly. Photo-oxidation studies with the mutant W53A were carried out for 3 h under the light box conditions stated above. Quantification of Hydrogen Peroxide. The amount of hydrogen peroxide generated in mAb-1 samples after exposure to light was measured using the Amplex Ultra Red Assay (Invitrogen, Carlsbad, CA) following the manufacturer’s recommended procedure. On addition of horseradish peroxidase (HRP), the dye reacts 1:1 stoichiometrically with H2O2, resulting in the production of fluorescent oxidation product resorufin. In this study, fluorescence readings were obtained using a Spectra Max M2Microplate Reader (Molecular Devices, Sunnyvale, CA) with excitation and emission set at 560 and 590 nm, respectively. Final H2O2 concentrations were determined using a standard curve ranging from 0 to 20 μm. RP-HPLC Assay. Oxidation of HC Fab and HC Fc was measured by RP-HPLC using an Agilent, Inc. 1100/1200 HPLC system (Santa Clara, CA) equipped with UV detection at 280 nm in conjunction with a Varian, Inc. Pursuit 3 μm, 2 mm i.d. × 250 mm diphenyl column (Palo Alto, CA). The column temperature was maintained at 65 °C. mAb-1 samples were diluted to 1 mg/mL in a buffer containing 100 mM TrisHCl, 4 mM EDTA, 1 mM cysteine, pH 7.4. Papain was added at a 1:100 (w:w) enzyme:substrate ratio and incubated for 2 h at 37 °C. The papain digested samples were then reduced in a buffer containing 50 mM dithiothreitol (DTT) for 30 min at 37 °C prior to injection. The RP-HPLC column was equilibrated with 66% solvent A (0.1% trifluoroacetic acid (TFA)/water) and 34% solvent B (0.1% TFA/acetonitrile) for 20 min at a flow rate of 0.2 mL/ min prior to injection of ∼6 μg of digested/reduced mAb-1. After injection, the gradient was held at 34% solvent B for 50 min before initiation of a linear gradient going from 34% solvent B to 54% solvent B in 50 min. The column was then washed with 95% solvent B for 10 min before re-equilibration 280

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

Figure 1. (A) Production of H2O2 as a function of time by 20 mg/mL mAb-1, mAb-2, and mAb-3 in formulation buffer, pH 6.0 (n = 3). (B) Time dependent generation of H2O2 by 20 mg/mL mAb-1 (light exposure under ICH guidelines) (n = 3). mAb-1 in buffer (closed diamond); formulation buffer is 20 mM histidine HCl, 0.02% PS20, 120 mM sucrose, pH 6 (closed triangle). (C) Concentration dependent generation of hydrogen peroxide by mAb-1 (3 h light exposure under ICH guidelines); (n = 3). mAb-1 in 20 mM His-HCl buffer containing both 120 mM sucrose and 0.02% w/v polysorbate 20, pH 6.0 (dark histogram); mAb-1 in 20 mM His-HCl, pH 6.0 alone (gray histogram). (D) Production of H2O2 by 50 mg/ mL mAb-1 in the presence of antioxidants such as 100 mM mannitol (gray histogram) and 1 mM L-methionine (white histogram).

room temperature in the dark. The alkylation was quenched by adding DTT to a final concentration of 30 mM. The reduced and S-carboxy-methylated samples were exchanged into digestion buffer (25 mM Tris, 1 mM EDTA, pH 8.3) using NAP-5 columns (GE Healthcare). Sequencing grade Lys-C (Roche Bioscience, Palo Alto, CA) was added to each sample at an enzyme-to-substrate ratio of 1:83 (by weight). Digestion was allowed to proceed for 5 h at 37 °C and then quenched by addition of 10% TFA to a final concentration of 0.2% TFA. Peptide mapping was performed on an Agilent 1100 HPLC system equipped with a Zorbax C-8 column (Agilent, 300SBC8, 2.1 × 150 mm, 300 Å, 3.5 μm particle size) and coupled to a Thermo Fisher LTQ mass spectrometer. Solvent A consisted of 0.1% TFA in water, and solvent B consisted of 0.08% TFA in acetonitrile. A multistep gradient was used; after injection, a linear gradient was initiated, going from 1% B to 22.5% B in 25 min, then to 23% B in 5 min, 24% B in 5 min, then to 40% B in 14 min, where the gradient was held at 40% B for 10 min. The flow rate was 0.2 mL/min, the column temperature was 52 °C, and the protein load was 20 μg. Peptides were identified by submitting the MS and MS/MS scans to the Mascot search engine from Matrix Science and also by manual identification using Thermo-Finnigan XCalibur software. Detection of Reactive Oxygen Species. Singlet Oxygen. The involvement of singlet oxygen was experimentally

determined in the presence of sodium azide, a quencher of O2, or in the presence of D2O. Inhibition of Peroxide Production by NaN3. The presence of singlet oxygen was indirectly determined using the singlet oxygen quencher, NaN3. A solution containing 50 mg/mL of mAb-1 in 20 mM histidine HCl at pH 6.0 with 120 mM sucrose and 0.02% polysorbate 20 in glass vials was incubated in the presence of various concentrations (10−50 mM) of NaN3 in the same buffer. The samples were exposed to light (as described in the section Photo-Oxidation Studies) for 3 h, and H2O2 quantities were determined using the Amplex assay. Enhanced Peroxide Generation in D2O. The presence of singlet oxygen was indirectly determined using D 2 O. Lyophilized mAb-1 was reconstituted with D2O to a final concentration of 25 mg/mL. The samples were exposed to light (as described in the section Photo-Oxidation Studies) for 3 h, and H2O2 quantities were determined using the Amplex assay. Superoxide Anion. Detection of superoxide, O2−, in the oxidation pathway of mAb-1 was experimentally determined through the presence of the enzyme superoxide dismutase (SOD). mAb-1 (50 mg/mL) was exposed to light for 3 h in the presence and absence of 150 U of SOD. Buffer with SOD alone (no mAb) was also exposed to light for 3 h and used as a control. Total hydrogen peroxide produced after light exposure was measured by the Amplex assay as mentioned above. 1

281

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

X-ray Crystallography. Crystallographic methods and analysis for mAb-1’s Fab fragment with the ectodomain of its receptor DR5 are described elsewhere.17 The crystal structure was obtained with 3.2 Å resolution. The surface area of the selected Trp in the CDR of mAb-1 was calculated using the CCP4 suite of programs.21 Action Spectra. The wavelength dependence of H2O2 generation was studied with a custom-built photolysis system.22 The light source was composed of an arc lamp power supply (model 68806; Oriel Instruments, Stratford, CT), a convective lamp housing (Oriel Instruments) equipped with a 75 W Xe arc lamp (model 6251NS, Newport Corporation, Irvine, CA), and a monochromator (model 77250; Oriel Instruments) with a 2 nm band pass. The light flux was integrated by means of an integrating sphere (Labsphere Inc., North Sutton, NH) connected to an integrating sphere system control (SC-5500; Labsphere Inc.). Stock solutions of mAb-1 were diluted with 1× PBS buffer to concentrations of 2.5−5 mg/mL for irradiations at 260−300 nm and 25 mg/mL for irradiations at 310 nm. Samples of 400 μL were irradiated in a 500 μL, 10 mm quartz cuvette (Hellma USA, Plainview, NY) placed within the integrating sphere. The light dose absorbed by the mAb was calculated with the integrating sphere setup from the difference of transmittance of mAb containing samples and that of a 1× PBS buffer containing sample. Photolysis times were 3−24 h and adjusted to yield similar concentrations of H2O2 of ca. 2 μM, which were determined with a customized Amplex assay: 50 μL of Amplex working solution was added to the sample, and the fluorescence was measured after 30 min incubation protected from light with a Shimazu RF-5000U fluorescence spectrometer (Shimadzu Scientific Instruments Inc., Columbia, MD). The excitation wavelength was 560 nm, and the detection wavelength was 590 nm; the respective bandwidths were set to 5 nm. The fluorescence was corrected with identically treated nonirradiated protein samples.

was found to be independent of the polysorbate-20 (Figure 1C), indicating that autoxidation of polysorbate-20 probably does not contribute to this mechanism. We also tested the effect of 120 mM sucrose, 100 mM mannitol, and 1 mM Lmethionine on hydrogen peroxide formation under these conditions.24 Results clearly indicate that all these radical scavengers/antioxidants do not affect the formation of hydrogen peroxide in any significant manner (Figures 1C and 1D). Analytical Characterization of mAb-1 Oxidation. Characterization of the oxidized mAb-1 was performed using three methods: a site-specific tryptic peptide map, a site specific Lys-C peptide map, and a more quantitative but less specific RP-HPLC assay that measures total oxidation in the HC Fab and Fc domains. The tryptic and Lys-C peptide maps were used to identify oxidation sites and degradation products, methionine sulfoxide (+16), hydroxytryptophan (+16 and +32), and kynurenine (+4) that were observed in the photolyzed mAbs. Extracted ion chromatograms (XIC) were used to calculate the amount of Met and Trp oxidation in oxidized peptides relative to the native peptides. Some oxidation was detected at four of the eight Met and Trp residues in the Fab HC. Photo-oxidation occurred predominantly at Trp53 in the HC CDR 2 as shown in Figure 2. The

■

Figure 2. LC−MS/MS tryptic peptide map analysis of mAb-1 (50 mg/ mL) in formulation buffer exposed to light. Samples: 1 = T0; 2 = 24 h; 3 = 48 h; 4 = 72 h; and 5 = 96 h light exposure under ICH guidelines.

RESULTS Production of Hydrogen Peroxide by Various mAbs. Photoreactivity of various mAbs under similar formulation conditions was tested and compared to foil covered controls. As predicted by Wentworth et al., all tested mAbs produced hydrogen peroxide under these conditions.4 However, mAb-1 consistently produced higher amounts of hydrogen peroxide than mAb-2 and mAb-3 (Figure 1A) under similar experimental conditions. Since all mAbs tested in this study were IgG1 mAbs and have identical Fc regions, we focused on the differences in the Fab region. All three mAbs bind to three different antigens and, as expected, differ substantially in the Fab sequences. Our attention was drawn to Trp53 that resides in the heavy chain CDR H2 in mAb-1 based on primary sequence analysis of the three mAbs and the fact that photo-oxidation reactions can be driven by aromatic amino acids such as tryptophan. Production of hydrogen peroxide by mAb-1 in 20 mM His-HCl, pH 6.0 increased linearly with increasing time of exposure (Figure 1B). As reported previously by Wentworth et al, buffer alone contributed negligibly in this process.4 Production of hydrogen peroxide was dependent on the concentration of mAb-1 (Figure 1C). Since autoxidation of formulation components such as polysorbate-20 can lead to hydrogen peroxide formation,23 we tested the effect of polysorbate-20 on hydrogen peroxide generation by mAb-1. Hydrogen peroxide formation

RP separation was performed after papain digestion and reduction that resulted in three fragments: HC Fab, HC Fc, and LC. Peaks were identified by RP-LC/MS. The oxidized Fab species eluted before the main fragment and were reported as a percentage of the total Fab peak area. In order to bridge the two methods the same set of UV exposed samples were analyzed by the RP and peptide mapping assays. The % Fab oxidation measured by RP was plotted as a function of the % Fab oxidation measured by the peptide map. A linear fit of the data demonstrated a strong correlation (slope = 0.9, R2 = 1.0; Figure 1S, Supporting Information) between the two methods. Therefore, the RP assay is a good surrogate for peptide mapping and suitable for measuring oxidation at Trp53. A near linear correlation was also observed between the hydrogen peroxide generated using the Amplex assay and Fab oxidation detected by RP-HPLC (slope = 1.0, R2 = 1.0; Figure 2S, Supporting Information). This indicates the intermediate ROS are localized on or near the Trp on the Fab region of the protein. Samples exposed to light for varying amounts of time (0, 3, and 6 h) showed an increase in percent Fab oxidation. However when the same samples, after exposure to light, were stored in the dark at 30 °C over 4 weeks, only a marginal 282

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

further increase in percent Fab oxidation was detected by the RP-HPLC method (Figure 3). This indicates that the amount

Figure 5. % Fab oxidation in mAb-1 (50 mg/mL) exposed to light in 20 mM His-HCl in the presence and absence of 10 mM NaN3. % Fab oxidation after light exposure was quantified by RP-HPLC.

Figure 3. % Fab oxidation in mAb-1 (25 mg/mL) by RP-HPLC after light exposure for 3 or 6 h and storage at 30 °C for 28 days.

generated was measured using the Amplex assay. The amount of hydrogen peroxide generated in D2O was approximately 1.7 times that in H2O under similar experimental conditions (Figure 6). Singlet oxygen is known to have a longer half-life in

of ROS depends on the time of light exposure and that no ROS are formed in the absence of light. Some marginal increase in Met oxidation was observed in the Fc region indicating that hydrogen peroxide generated during this pathway affects methionines in the Fc region (data not shown). Reactive Oxygen Species (ROS) in ACWOP Promoted by mAb-1. Various intermediate ROS by antibodies during ACWOP have been postulated in the literature. mAb-1 was exposed to light in the presence of various concentrations of sodium azide (NaN3), a known singlet oxygen quencher.25 The amount of hydrogen peroxide generated during this reaction was quantified using the Amplex assay (Figure 4). At a 50 mg/

Figure 6. Generation of hydrogen peroxide by mAb1 (25 mg/mL) upon 6 h light exposure in D2O vs H2O (n = 3).

D2O26 as compared to H2O, and any singlet oxygen reactions, including hydrogen peroxide generation, are facilitated in D2O. Samples of mAb-1 exposed to light in D2O or H2O were also analyzed using the RP-HPLC method, and the results corroborate the observation that the extent of Fab oxidation in D2O was almost twice when compared to the same reaction conducted in H2O (Figure 7). Since the lifetime of singlet oxygen in D2O is considerably longer than that in H2O, the increased % Fab oxidation seen in D2O is not unexpected. The involvement of superoxide anion was confirmed using the superoxide dismutase (SOD) assay.27 In biological systems SOD removes O2•− by catalyzing the reaction 2O2•− + 2H+ → H2O2 + O2. SOD is a highly selective probe for superoxide owing to the rapid reaction of this enzyme converting

Figure 4. Evidence of singlet oxygen production in the reaction of mAb1 (50 mg/mL) with light (n = 3).

mL mAb-1 concentration, both 10 mM and 50 mM azide inhibited the formation of hydrogen peroxide at all time points (3 h, 6 h, and 24 h light exposure), demonstrating that singlet oxygen is one of the ROS in this pathway. RP-HPLC analysis of the samples that were photo-oxidized in the presence of 0 and 10 mM NaN3 was also conducted. The RP-HPLC analysis indicated that Fab oxidation in mAb-1 occurred when exposed to light and that this reaction was inhibited in the presence of 10 mM NaN3 (Figure 5). Data indicate that singlet oxygen is probably generated in the Fab region of mAb-1 and reacts quite rapidly at the site of generation since singlet oxygen is known to be very reactive with electron rich amino acids such as Trp. Further proof of singlet oxygen during photo-oxidation experiments came from studies conducted in D2O. Lyophilized mAb-1 was reconstituted either with D2O or with H2O to give a final mAb-1 concentration of 25 mg/mL. Samples were incubated in the light box for 6 h, and the amount of hydrogen peroxide

Figure 7. % Fab oxidation in mAb-1 (25 mg/mL) (1) exposed to light in D2O, (2) D2O control,6a (3) exposed to light in H2O, (4) H2O control. % Fab oxidation after 3 h light exposure was quantified by RPHPLC. 283

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

maximum for both the proteins was still around 278 nm, and the absorption coefficients of mAb-1 and the single mutant W53A were 1.63 M−1 cm−1 and 1.56 M−1 cm−1, respectively, indicating that a change in one Trp on the CDR did not influence the absorption coefficients to a great extent. The wild type (wt) mAb-1 and its mutant, W53A, were formulated using the same buffers (20 mM His-HCl buffer, pH 6.0) at 10 mg/ mL and incubated in the light box for 3 h at the same time. Hydrogen peroxide generation was quantified by the Amplex assay, and the results are shown in Table 2. The single mutant,

superoxide to hydrogen peroxide. mAb-1 at 50 mg/mL was exposed to light for 3 h in the presence and absence of 150 U of SOD. Hydrogen peroxide generated in this reaction was quantified using the Amplex assay as described in the previous section. Under these conditions mAb-1 produced twice as much hydrogen peroxide in the presence of SOD than in its absence, indicating that superoxide is one of the ROS involved in the ACWOP (Table 1). SOD and or buffer alone by itself Table 1. Amount of H2O2 Produced (n = 3) by Photoirradiating Wild Type mAb-1 in 20 mM His-HCl Buffer, pH 6.0 Using Singlet Oxygen Enhancer, D2O; Superoxide Anion Detector, 150 U of SOD; and Singlet Oxygen Inhibitor, 10 mM NaN3 sample 25 25 50 50 50

mg/mL, mg/mL, mg/mL, mg/mL, mg/mL,

wt wt wt wt wt

mAb-1/H2O mAb-1/D2O mAb-1 control mAb-1/SOD mAb-1/NaN3

Table 2. Amount of H2O2 Produced (n = 3) Using 10 mg/ mL Wild Type mAb-1 or W53A in 20 mM His-HCl Buffer, pH 6.0 after Light Exposure for 3 h

H2O2, μM

type of ROS inferred

sample

19.52 ± 2.97 34.54 ± 5.93 41.32 ± 0.28 86.39 ± 20.85 not detected

N/A 1 O2 N/A O2− 1 O2

wt mAb-1, control wt mAb-1, light W53A, control W53A, light

H2O2, μM 0.80 12.51 0.70 6.19

± ± ± ±

0.02 0.59 0.02 1.00

W53A, resulted in a decrease by about 50% in the production of hydrogen peroxide under similar conditions, indicating that the surface exposed Trps are highly efficient in transferring light energy to oxygen, and act as substrate (singlet oxygen and superoxide) generators. Further proof of the involvement of Trp53 in generating H2O2 was found when we recorded the action spectra of both the wt mAb-1 and W53A (Figure 9). The efficiency of H2O2

did not contribute to the generation of peroxide under these conditions (data not shown), while 10 mM NaN3 added to the SOD reaction decreased the yield of hydrogen peroxide 4-fold (Figure 3S in the Supporting Information). Role of Trp53 in mAb-1. We carefully analyzed the role of the surface exposed tryptophan, Trp53 in mAb-1 (Figure 8). The X-ray crystal structure of mAb-1 has recently been published.17

Figure 8. X-ray crystal structure of the Fab of mAb-1 depicting various tryptophans in conserved regions as well as Trp53 on CDR.

Figure 9. Normalized action spectra of wt mAb-1 (gray squares) and W53A (black diamonds) overlaid with absorbance spectrum of mAb-1 (dark line).

The surface exposure of Trp53 in mAb-1 was analyzed using the CCP4 suite of programs and found to be around 115 Å2, whereas the surface exposure of Trp106 and Trp111 was found to be around 45 Å2 and 29 Å2 respectively.21 Other Trps close to the CDR but outside the antigen binding sites (Trp36 and Trp47) had negligible surface exposure as typically expected for this hydrophobic amino acid. While there is uncertainty in the absolute values of surface exposure based on the resolution of the crystal structure, we believe that they serve a good purpose for relative evaluation within the same structure. The major difference in the aromatic residues in CDR sequences of the three mAbs tested in this study is the presence of a surface exposed and photoreactive Trp (Trp53). In order to probe the reactivity and involvement of Trp53 in generating H2O2 we created a single alanine mutant, W53A. The absorption

formation (yield of H2O2/absorbed light dose) at a given wavelength was multiplied by the absorbance of the sample at that wavelength to obtain the action spectrum. A Cary 50 Bio spectrometer (Varian Inc., CA) with a 10 mm quartz cell (Hellma USA) containing 0.25 mg/mL was used to measure the absorbance spectrum. In the relative scale of the action spectrum the value obtained at 280 nm with wt mAb-1 was set arbitrarily to 1. The absorbance spectrum of the wt mAb-1 was overlaid in the action spectrum at 280 nm. The action spectra of mAb-1 and W53A overlay with the absorption spectrum of Trp indicating that the H2O2 generated was predominantly driven by Trp. Quantification and normalization of the data with respect to mAb-1 indicates that the W53A mutant produced at least 50% less hydrogen peroxide under similar experimental conditions. 284

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

■

Article

DISCUSSION mAb-1 is a fully human monoclonal antibody that induces tumor cell apoptosis through DR5. Biochemical studies showed that mAb-1 binds DR5 tightly and selectively, and the structural features of its interaction with DR5 were recently reported.17 Xray crystallographic analysis of the complex between the mAb-1 Fab fragment and the DR5 ectodomain revealed interactions involving the mAb-1 light-chain CDR L1, L2, and L3 as well as heavy-chain CDRs H1, H2, and H3. mAb-1 along with several other mAbs are in clinical development and are important tools for oncology treatments. The potential for light-induced damage to proteins, including mAbs, is well reported in the literature and has been a topic of a recent review.28 Based on the photosensitivity of proteins during their production or delivery, it is recommended to study the effect of both visible and ultraviolet light on drug product quality during formulation and clinical development of proteins as required by International Conference on Harmonisation (ICH).29 Under similar experimental conditions of light, pH, and buffer conditions, mAb-1 produced H2O2 in almost 2-fold excess as compared to other mAbs tested herein, mAb-2 and mAb-3 as determined by the Amplex assay (Figure 1A). Total H2O2 production was found to be dependent on mAb-1 concentration (Figure 1B) but independent of buffer composition and the presence of polysorbate-20 (Figure 1C). All three mAbs contain the same framework but possess different CDRs. This indicates that certain amino acids in the nonconserved (i.e., CDR) portion of the mAb may play a significant role in the H2O2 generation via the ACWOP. Primary sequence comparisons indicated mAb-1 was the only antibody in this series that contained Trp (Trp53) on the heavy chain CDR, and X-ray crystallography of the Fab portion of mAb-1 shows that Trp53 was highly surface exposed (115 Å2, Figure 2).17 Trp is known to be highly photosensitive and, hence, can act as a source for oxidant formation.30 Potentially, Trp53 in mAb1 acts as a sensitizer that absorbs light and forms an excited state. Efficient sensitizers can transfer their energy to the ground state of oxygen (3O2) and produce singlet oxygen (1O2) via a type II process or lead to superoxide anion via a type I process.31 In H2O, singlet oxygen has a relatively short lifetime and does not diffuse far from the site of its production.32 Singlet oxygen is a powerful oxidant, and its reaction with Trp leading to the generation of various products such as N-formylkynurenine (NFK), kynurenine (Kyn), and mono- and dihydroxy Trp, among other products, is well-known.33 Similarly another ROS that is commonly detected in biological systems is the superoxide anion. Many compounds, including Trp, have been shown to produce superoxide.27 Though one electron reduction of singlet oxygen to yield superoxide may be thermodynamically possible, it is not typically kinetically favored.34 However, superoxide generation from singlet oxygen has been reported in the past.35 Generation of various intermediate ROS by mAb-1, such as singlet oxygen and superoxide ion (O2−), was experimentally determined. Specifically, both sodium azide and D2O were used to detect the generation of singlet oxygen while superoxide dismutase was used to identify superoxide anion (Table 1). Additional experiments carried out using 50 mg/mL mAb-1 in the presence of 150 U of SOD plus 10 mM NaN3 showed that the hydrogen peroxide formation decreased 4-fold. These

results indicate that superoxide is probably formed from one electron reduction of singlet oxygen. While a variety of ROS including dihydrogen trioxide, ozone, and hydroxyl radical surrogates such as hydrotrioxy radical (HO3•) have been postulated in previous studies on ACWOP, our results clearly indicate the formation of superoxide in this pathway along with singlet oxygen. The ROS react with Trp and generate various oxidation products such as hydroxy-Trp (+16), NFK or dihydroxy Trp (+32), and kyn (+4).11 LC−MS analysis after Lys-C digest of mAb-1 was performed after extensive exposure to light and for mAb-1 samples under normal drug product storage conditions (2−8 or 30 °C). The detected Trp oxidation products are shown in Figure 10. It is clear from this data that the monohydroxy derivatives (+16 species) are predominant in all the analyzed samples.

Figure 10. LC−MS/MS Lys-C peptide map analysis of the Trp 53 oxidation products in various lots of mAb-1 under different conditions. Samples: 1, lot 1, 43 months at 2−8 °C; 2, lot 2, 33 months at 2−8 °C; 3, lot 2, 3 months at 30 °C; 4, lot 3, 3 months at 30 °C; 5, lot 4, 3 months at 30 °C; 6, lot 5, exposed to light for 24 h (1.2 million lx h).

Fenton reactions are commonly encountered during protein production and storage, as the protein bulk intermediates are routinely stored in stainless steel containers. Antioxidants such as sucrose, mannitol, and L-methionine do not affect peroxide generation under photo-oxidation conditions by 50 mg/mL mAb-1 (Figures 1C and 1D), whereas NaN3 completely quenched the reaction. These antioxidants had no effect on peroxide generation even at a 15-fold lower concentration of mAb-1 (data not shown). If the monohydroxy (+16) species were formed due to the Fenton reaction, that largely produces hydroxyl radicals, then antioxidants for hydroxyl species would have prevented the formation of oxidation as well as the predominant end product in the reaction, i.e., hydrogen peroxide. Although Basu-Modak and Tyrrell report that NaN3 may not be a specific singlet oxygen quencher,36 Chernovitz and Jonah have shown that hydroxyl radicals decay similarly in D2O and H2O.37 Singlet oxygen has a distinct isotope effect as reported earlier.26b While hydroxyl radicals in mAb-1 studies cannot be completely ruled out based on NaN3 data alone, results from D2O and antioxidants studies indicate that singlet oxygen is predominantly produced under these conditions rather than hydroxyl radicals. While the +16 and +32 species were detected predominantly on Trp53, evidence for the production of +4 species (kynurenine) was also found. No other oxidation products 285

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

absence of metal ions, methionine (Met) oxidation was observed as anticipated.40 Oxidation at several Met sites, Met34, Met83, Met254, and Met430 in mAb-1, was also detected after prolonged incubation with hydrogen peroxide whereas marginal Fc methionine oxidation (Met254 and Met430) was also detected after ACWOP (data not shown). The oxidative reactivity of methionines eventually leads to the consumption of the hydrogen peroxide that is generated via ACWOP or any other oxidation pathway. Methionine residues in mAbs may ultimately serve as a peroxide sink, supporting the suggestion that evolution may have selected these residues to be prominently placed at exposed surfaces of proteins not only for binding to receptors but also to serve as internal antioxidants in proteins.41 While methionine residues are regenerated through methionine sulfoxide reductases in vivo,42 a similar enzyme or mechanism for Trp regeneration from oxidized tryptophan residues has not yet been reported to our knowledge.

for nearby Trp or other amino acids were found in the LC−MS analysis. The generation of various site-specific (Trp53) oxidation products indicates that ROS are produced within close proximity of Trp53, as both singlet oxygen and superoxide react with Trp within a few Å of their production.38 It can be inferred from this data that Trp53 oxidation under real time or accelerated storage conditions (2−8 or 30 °C respectively) in mAb-1 is probably due to ROS such as singlet oxygen or superoxide ion. When hydrogen peroxide was added to mAb-1 in histidine formulation buffer and incubated at 30 °C for 4 weeks, a 3−5% increase in Fc Met oxidation was observed (data not shown). Under the same conditions, Trp53 in mAb-1 was found to be fairly inert to treatment with hydrogen peroxide and no oxidation at Trp53 was observed. This indicates that both singlet oxygen and/or superoxide play a crucial role in Trp53 oxidation. The involvement of Trp53 in photo-oxidation was investigated further by replacing Trp with Ala (W53A). The W53A mutant generated 2-fold lower H2O2 than wt mAb-1 under similar photo-oxidation conditions. While a single mutant (W53A) results in the loss of two Trp residues (one on each Fab of mAb-1), a 50% reduction in hydrogen peroxide was quite unexpected if only conserved Trp residues were involved in this pathway. In other words, these data suggest that surface exposed Trps in mAb-1 contribute to approximately 50% of the ROS generated via this pathway (Table 2), much higher than previously predicted.4,6 This also indicates that while surface exposed Trp residues such as Trp53 are highly efficient in transferring light energy to oxygen, converting it to various ROS and finally to H2O2 via ACWOP, the conserved Trp residues also contribute substantially in this pathway. While the intermediate ROS, such as singlet oxygen and superoxide, can potentially damage Trp residues, the H2O2 generated via this pathway can oxidize other amino acids such as methionines on the Fc region. Yan and Boyd have demonstrated the production of H2O2 in buffers by radical chain reductions of molecular oxygen that ultimately resulted in hinge fragmentation in IgG1 antibodies.39 Results presented herein clearly indicate the propensity of Trp53 of mAb-1 in initiating (by absorbing light energy), propagating the oxidation reaction (by either a type 1 electron process or a type II energy transfer process), and ultimately generating hydrogen peroxide (Scheme 1). While addition of hydrogen peroxide to mAbs (including mAb-1) did not yield any Trp oxidation in the

■

CONCLUSIONS

■

ASSOCIATED CONTENT

Typical IgG1 mAbs contain several Trps in the Fc and the Fab regions, however most of the Trps are buried and play an important role in the folding.10 While conserved Trps may play an important role in ACWOP as described by Wentworth and others, our results clearly demonstrate that surface exposed Trp (e.g., Trp53 residue in mAb-1) plays a distinct role in this mechanism, probably acting as substrate (singlet oxygen and superoxide) generators. While catalytic sites near the IGKD are deemed important,7 other factors such as accessible surface area, oxygen availability, and influence of neighboring amino acids are probably important for Trp to transfer energy to molecular oxygen creating ROS. mAb-1 may have promoted the initiation, propagation, and termination of ROS after light exposure (Scheme 1) leading to site-specific oxidation at Trp53. Trp oxidation leading to loss of biological activity has been reported before.1 Photodegradation and oxidation of proteins is a major concern during clinical development of biologics since it may lead to both chemical and physical degradation. However, as Kerwin and Remmele mention in their recent review, the mechanisms of lightinduced degradation of proteins, including antibodies, have not been clearly elucidated.28 Our data suggests that surface exposure of Trp plays an important part in enabling light energy capture and transferring that energy to molecular oxygen generating ROS. Although H2O2 is ultimately produced during ACWOP, the intermediate ROS such as 1O2 and O2− cause significant Trp oxidation, whereas the hydrogen peroxide formed during this pathway affects other amino acids including Met on the mAb. ACWOP and light exposure therefore provide new insights into antibody stability and should be carefully considered during clinical and pharmaceutical development of monoclonal antibodies. To this end, we are further investigating the role of pharmaceutical excipients, buffer species, formulation conditions and mitigation strategies.

Scheme 1. Proposed Reaction Mechanism for Oxidation in mAb-1a

* Supporting Information S

Additional figures as discussed in the text. This material is available free of charge via the Internet at http://pubs.acs.org.

a

Trp is tryptophan, and Met is methionine on the mAb; Trpox and Metox are oxidized Trp and oxidized Met on the mAb respectively. 286

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

■

Article

(10) Samanta, U.; Pal, D.; Chakrabarti, P. Environment of tryptophan side chains in proteins. Proteins: Struct., Funct., Genet. 2000, 38 (3), 288−300. (11) Kayser, V.; Chennamsetty, N.; Voynov, V.; Helk, B.; Trout, B. L. J. Fluoresc. 2011, 21, 275−288. (12) Cioni, P.; Strambini, G. B. Acrylamide quenching of protein phosphorescence as a monitor of structural fluctuations in the globular fold. J. Am. Chem. Soc. 1998, 120 (45), 11749−57. (13) Creed, D. Photochem. Photobiol. 1984, 39, 537−62. (14) Babu, V.; Joshi, P. C. Tryptophan as an Endogenous Photosensitizer to Elicit Harmful Effects of Ultraviolet-B. Indian J. Biochem. Biophys. 1992, 29 (3), 296−8. (15) Bent, D. V.; Hayon, E. Excited state chemistry of aromatic amino acids and related peptides. III. Tryptophan. J. Am. Chem. Soc. 1975, 97, 2612−9. (16) Nikogosyan, D. N.; Gorner, H. Photolysis of Aromatic-AminoAcids in Aqueous-Solution by Nanosecond 248 and 193 Nm LaserLight. J. Photochem. Photobiol., B 1992, 13 (3−4), 219−34. (17) Adams, C.; Totpal, K.; Lawrence, D.; Marsters, S.; Pitti, R.; Yee, S.; Ross, S.; Deforge, L.; Koeppen, H.; Sagolla, M.; Compaan, D.; Lowman, H.; Hymowitz, S.; Ashkenazi, A. Structural and functional analysis of the interaction between the agonistic monoclonal antibody Apomab and the proapoptotic receptor DR5. Cell Death Differ. 2008, 15 (4), 751−61. (18) Lucas, B. K.; Giere, L. M.; DeMarco, R. A.; Shen, A.; Chisholm, V.; Crowley, C. W. High-level production of recombinant proteins in CHO cells using a dicistronic DHFR intron expression vector. Nucleic Acids Res. 1996, 24 (9), 1774−9. (19) Vara, J. A.; Portela, A.; Ortin, J.; Jimenez, A. Expression in Mammalian-Cells of a Gene from Streptomyces-Alboniger Conferring Puromycin Resistance. Nucleic Acids Res. 1986, 14 (11), 4617−24. (20) Simonsen, C. C.; Levinson, A. D. Isolation and Expression of an Altered Mouse Dihydrofolate-Reductase cDNA. Proc. Natl. Acad. Sci. U.S.A. 1983, 80 (9), 2495−9. (21) Bailey, S. The CCP4 Suite - Programs for Protein Crystallography. Acta Crystallogr., Sect. D: Biol. Crystallogr. 1994, 50, 760−3. (22) Barron, L. B.; Waterman, K. C.; Filipiak, P.; Hug, G. L.; Nauser, T.; Schoneich, C. Mechanism and kinetics of photoisomerization of a cyclic disulfide, trans-4,5-dihydroxy-1,2-dithiacyclohexane. J. Phys. Chem. A 2004, 108 (12), 2247−55. (23) Donbrow, M.; Azaz, E.; Pillersdorf, A. Autoxidation of polysorbates. J. Pharm. Sci. 1978, 67 (12), 1676−81. (24) Ji, J. A.; Zhang, B. Y.; Cheng, W.; Wang, Y. J. Methionine, Tryptophan, and Histidine Oxidation in a Model Protein, PTH: Mechanisms and Stabilization. J. Pharm. Sci. 2009, 98 (12), 4485−500. (25) Hasty, N.; Merkel, P. B.; Radlick, P.; Kearns, D. R. Tetrahedron Lett. 1972, 49−52. (26) (a) Merkel, P. B.; Nillso, R.; Kearns, D. R. J. Am. Chem. Soc. 1972, 94, 1030−1. (b) Wilkinson, F.; Helman, W. P.; Ross, A. B. J. Phys. Chem. Ref. Data 1995, 24, 663−1021. (27) McCormick, J. P.; Thomason, T. Near-Ultraviolet Photooxidation of Tryptophan - Proof of Formation of Superoxide Ion. J. Am. Chem. Soc. 1978, 100 (1), 312−3. (28) Kerwin, B. A.; Remmele, R. L., Jr. Protect from light: Photodegradation and protein biologics. J. Pharm. Sci. 2007, 96 (6), 1468−79. (29) Q5C, International Conference on Harmonisation, Quality of Biotechnological Products: Stability Testing of Biotechnological/Biological Products. (30) Davies, M. J. Singlet oxygen-mediated damage to proteins and its consequences. Biochem. Biophys. Res. Commun. 2003, 305 (3), 761− 70. (31) Ogilby, P. R. Chem. Soc. Rev. 2010, 39, 3181−209. (32) Kuimova, M. K.; Yahioglu, G.; Ogilby, P. R. Singlet Oxygen in a Cell: Spatially Dependent Lifetimes and Quenching Rate Constants. J. Am. Chem. Soc. 2009, 131 (1), 332−40. (33) Gracanin, M.; Hawkins, C. L.; Pattison, D. I.; Davies, M. J. Singlet-oxygen-mediated amino acid and protein oxidation: Formation

AUTHOR INFORMATION

Corresponding Author

*Late Stage Pharmaceutical Development, Genentech, Inc., South San Francisco, CA 94080. E-mail: [email protected]. Tel: 650 467 8488. Notes

The authors declare the following competing financial interest(s): AS, KL, CL, BH, FM, DZ, AYS and YL are full time employees of Genetech.

■

ACKNOWLEDGMENTS The authors would like to thank Sarah Hymowitz for help with surface area calculations in mAb-1, Kiren Khanduja for some experimental help with the Amplex assay and Mary Mallaney for purifying the mutant W53A. We wish to thank Jun Liu for helpful discussions, and John Wang and Mary Cromwell for critical review of the manuscript. The authors are indebted to the reviewers for detailed and in depth review and novel insights into our data.

■

REFERENCES

(1) Wei, Z.; Feng, J.; Lin, H.-Y.; Mullapudi, S.; Bishop, E.; Tous, G. I.; Casas-Finet, J.; Hakki, F.; Strouse, R.; Schenerman, M. A. Identification of a single tryptophan residue as critical for binding activity in a humanized monoclonal antibody against respiratory syncytial virus. Anal. Chem. 2007, 79 (7), 2797−2805. (2) Qi, P.; Volkin, D. B.; Zhao, H.; Nedved, M. L.; Hughes, R.; Bass, R.; Yi, S. C.; Panek, M. E.; Wang, D.; Dalmonte, P.; Bond, M. D. Characterization of the Photodegradation of a Human IgG1Monoclonal Antibody Formulated as a High-Concentration Liquid Dosage Form. J. Pharm. Sci. 2009, 98 (9), 3117−3130. (3) Stroop, S. D.; Conca, D. M.; Lundgard, R. P.; Renz, M. E.; Peabody, L. M.; Leigh, S. D. Photosensitizers Form in Histidine Buffer and Mediate the Photodegradation of a Monoclonal Antibody. J. Pharm. Sci. 2011, 100 (12), 5142−5155. (4) Wentworth, A. D.; Jones, L. H.; Wentworth, P., Jr.; Janda, K. D.; Lerner, R. A. Antibodies have the intrinsic capacity to destroy antigens. Proc. Natl. Acad. Sci. U.S.A. 2000, 97 (20), 10930−5. (5) (a) Nieva, J.; Kerwin, L.; Wentworth, A. D.; Lerner, R. A.; Wentworth, P., Jr. Immunoglobulins can utilize riboflavin (Vitamin B2) to activate the antibody-catalyzed water oxidation pathway. Immunol. Lett. 2006, 103 (1), 33−8. (b) Nieva, J.; Wentworth, P., Jr. The antibody-catalyzed water oxidation pathway–a new chemical arm to immune defense? Trends Biochem. Sci. 2004, 29 (5), 274−8. (6) (a) Wentworth, P., Jr.; Jones, L. H.; Wentworth, A. D.; Zhu, X.; Larsen, N. A.; Wilson, I. A.; Xu, X.; Goddard, W. A., 3rd; Janda, K. D.; Eschenmoser, A.; Lerner, R. A. Antibody catalysis of the oxidation of water. Science 2001, 293 (5536), 1806−11. (b) Zhu, X.; Wentworth, P., Jr.; Wentworth, A. D.; Eschenmoser, A.; Lerner, R. A.; Wilson, I. A. Probing the antibody-catalyzed water-oxidation pathway at atomic resolution. Proc. Natl. Acad. Sci. U.S.A. 2004, 101 (8), 2247−52. (7) Datta, D.; Vaidehi, N.; Xu, X.; Goddard, W. A. Mechanism for antibody catalysis of the oxidation of water by singlet dioxygen. Proc. Natl. Acad. Sci. U.S.A. 2002, 99 (5), 2636−41. (8) Wentworth, P., Jr.; Wentworth, A. D.; Zhu, X.; Wilson, I. A.; Janda, K. D.; Eschenmoser, A.; Lerner, R. A. Evidence for the production of trioxygen species during antibody-catalyzed chemical modification of antigens. Proc. Natl. Acad. Sci. U.S.A. 2003, 100 (4), 1490−3. (9) Chin, K. K.; Trevithick-Sutton, C. C.; McCallum, J.; Jockusch, S.; Turro, N. J.; Scaiano, J. C.; Foote, C. S.; Garcia-Garibay, M. A. Quantitative determination of singlet oxygen generated by excited state aromatic amino acids, proteins, and immunoglobulins. J. Am. Chem. Soc. 2008, 130 (22), 6912−3. 287

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288

Molecular Pharmaceutics

Article

of tryptophan peroxides and decomposition products. Free Radical Biol. Med. 2009, 47 (1), 92−102. (34) Buettner, G. R. The Pecking Order of Free-Radicals and Antioxidants - Lipid-Peroxidation, Alpha-Tocopherol, and Ascorbate. Arch. Biochem. Biophys. 1993, 300 (2), 535−43. (35) Saito, I.; Matsuura, T.; Inoue, K. Formation of Superoxide Ion from Singlet Oxygen - on the Use of a Water-Soluble Singlet Oxygen Source. J. Am. Chem. Soc. 1981, 103 (1), 188−90. (36) Basu-Modak, S.; Tyrrell, R. M. Singlet Oxygen: A primary effector in the ultraviolet A/Near-visible light induction of the human heme oxygenase gene. Cancer Res. 1993, 53, 4505−10. (37) Chernovitz, A. C.; Jonah, C. D. Isotopic dependence of recombination kinetics in water. J. Phys. Chem. 1988, 92, 5946−50. (38) (a) Lindig, B. A.; Rodgers, M. A. J. Rate Parameters for the Quenching of Singlet Oxygen by Water-Soluble and Lipid-Soluble Substrates in Aqueous and Micellar Systems. Photochem. Photobiol. 1981, 33 (5), 627−34. (b) Rodgers, M. A. J.; Bates, A. L. A Laser Flash Kinetic Spectrophotometric Examination of the Dynamics of Singlet Oxygen in Unilammellar Vesicles. Photochem. Photobiol. 1982, 35 (4), 473−77. (39) Yan, B.; Boyd, D. Breaking the light and heavy chain linkage of human immunoglobulin G1 (IgG1) by radical reactions. J. Biol. Chem. 2011, 286 (28), 24674−84. (40) Lam, X. M.; Yang, J. Y.; Cleland, J. L. Antioxidants for prevention of methionine oxidation in recombinant monoclonal antibody HER2. J. Pharm. Sci. 1997, 86 (11), 1250−5. (41) Levine, R. L.; Mosoni, L.; Berlett, B. S.; Stadtman, E. R. Methionine residues as endogenous antioxidants in proteins. Proc. Natl. Acad. Sci. U.S.A. 1996, 93 (26), 15036−40. (42) (a) Moskovitz, J. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense, protein regulation, and prevention of aging-associated diseases. Biochim. Biophys. Acta, Proteins Proteomics 2005, 1703 (2), 213−9. (b) Moskovitz, J. Roles of methionine suldfoxide reductases in antioxidant defense, protein regulation and survival. Curr. Pharm. Des. 2005, 11 (11), 1451−7.

288

dx.doi.org/10.1021/mp300418r | Mol. Pharmaceutics 2013, 10, 278−288